Deactivation of the mitochondrial pyruvate dehydrogenase complex (PDC) is important for the metabolic switching of cancer cell from oxidative phosphorylation to aerobic glycolysis. Studies examining PDC activity regulation have mainly focused on the phosphorylation of pyruvate dehydrogenase (E1), leaving other post-translational modifications largely unexplored. Here, we demonstrate that the acetylation of Lys 488 of pyruvate dehydrogenase complex component X (PDHX) commonly occurs in hepatocellular carcinoma, disrupting PDC assembly and contributing to lactate-driven epigenetic control of gene expression. PDHX, an E3-binding protein in the PDC, is acetylated by the p300 at Lys 488, impeding the interaction between PDHX and dihydrolipoyl transacetylase (E2), thereby disrupting PDC assembly to inhibit its activation. PDC disruption results in the conversion of most glucose to lactate, contributing to the aerobic glycolysis and H3K56 lactylation-mediated gene expression, facilitating tumor progression. These findings highlight a previously unrecognized role of PDHX acetylation in regulating PDC assembly and activity, linking PDHX Lys 488 acetylation and histone lactylation during hepatocellular carcinoma progression and providing a potential biomarker and therapeutic target for further development.
Humans ; Acetylation ; Carcinoma, Hepatocellular/genetics* ; Liver Neoplasms/genetics* ; Pyruvate Dehydrogenase Complex/genetics* ; Gene Expression Regulation, Neoplastic ; Animals ; Mice ; Cell Line, Tumor ; Protein Processing, Post-Translational ; Histones/metabolism* ; Disease Progression

OBJECTIVE: To explore and quantify the association of hot night exposure during the sperm development period (0-90 lag days) with semen quality. METHODS: A total of 6,640 male sperm donors from 6 human sperm banks in China during 2014-2020 were recruited in this multicenter study. Two indices (i.e., hot night excess [HNE] and hot night duration [HND]) were used to estimate the heat intensity and duration during nighttime. Linear mixed models were used to examine the association between hot nights and semen quality parameters. RESULTS: The exposure-response relationship revealed that HNE and HND during 0-90 days before semen collection had a significantly inverse association with sperm motility. Specifically, a 1 °C increase in HNE was associated with decreased sperm progressive motility of 0.0090 (95% confidence interval [ CI]: -0.0147, -0.0033) and decreased total motility of 0.0094 (95% CI: -0.0160, -0.0029). HND was significantly associated with reduced sperm progressive motility and total motility of 0.0021 (95% CI: -0.0040, -0.0003) and 0.0023 (95% CI: -0.0043, -0.0002), respectively. Consistent results were observed at different temperature thresholds on hot nights. CONCLUSION Our findings highlight the need to mitigate nocturnal heat exposure during spermatogenesis to maintain optimal semen quality.
Humans ; Male ; Semen Analysis ; Adult ; Sperm Motility ; Hot Temperature/adverse effects* ; China ; Middle Aged ; Spermatozoa/physiology* ; Young Adult

Because of the unclear active substances, metabolic pathways, and targets of new drugs of traditional Chinese medicine(TCM), non-clinical safety evaluation often fails to accurately locate the target organs and tissue exposed to medicinal toxicity. The human use experience(HUE) contains important safety information of TCM, while the clinical safety data in the past HUE are few and have not been effectively applied. Standardized prospective HUE studies should be carried out to collect the clinical safety data, in which appropriate physical and chemical indicators(including blood, urine, and stool routine), liver biochemical indicators, kidney biochemical indicators, and cardiovascular biochemical indicators should be selected for safety evaluation, and the detection time point and sample size should be rationally designed. Importance should be attached to the observation of symptoms and signs of adverse events/reactions in patients as well as the safety information of special groups such as the elderly, children, and pregnant women. The adverse events of TCM should be observed, judged, and treated according to the theory and the diagnosis and treatment mode of TCM. The clinical safety information about the HUE should be comprehensively collected for new drugs of TCM to make up for the lack of extrapolation of toxicological test results to humans. The unique advantages of clinical origin of new drugs of TCM should be given full play for cross-reference of the results of toxicological research and the conclusions of HUE safety evaluation. In addition, benefit-risk assessment should be conducted based on HUE, and a panoramic safety evaluation system characterized by macro and micro combination and in line with the characteristics of TCM should be established to improve the success rate in the research and development of new drugs of TCM.
Humans ; Drugs, Chinese Herbal/adverse effects* ; Medicine, Chinese Traditional/adverse effects* ; Drug-Related Side Effects and Adverse Reactions ; Female

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Sarin(GB)is a typical representative of nerve agents with high toxicity,and very low amount can cause death.GB can cause water and atmospheric environment poisoning,so the detection of GB in water and air is of great significance.In this work,a colorimetric sensor array(CSA)based on GB inhibition of cholinesterase activity was constructed to detect GB with high selectivity.A 4×4 colorimetric array was constructed using acetylcholinesterase(AChE),butyryl cholinesterase(BuChE)and the corresponding substrate acetylthiocholine iodide(S-ACh),butyryl thiocholine iodide(S-BCh),acetylcholine chloride(ACh),butyryl choline chloride(BCh)and 2,6-dichloroindophenol ethyl ester(DCIE).The linear curve of the sensor was Y=131.3×lgC+271.6(R2=0.997),where Y was the array response Euclidean distance,C was the concentration of GB(mg/L),the linear range was 0.03?0.32 mg/L,and the detection limit was 27.6 μg/L.The method could effectively distinguish chemical warfare agents(CWA)such as VX,Soman(GD),mustard gas(HD),Louie reagent(L),and had high anti-interference ability,sensitivity and good repeatability.It was successfully applied to the detection of GB in simulated water and simulated air samples,and the sample recovery rate was 97.2% ?100.9%.This method would be potentially applied to the field rapid detection of nerve agents.

Sepsis is a life-threatening organ dysfunction disease caused by a dysregulated host response to infection.It has com-plex pathophysiological changes,and in severe cases,it can rap-idly develop into septic shock and multiple organ dysfunction or multiple organ failure.At present,the pathological mechanism of sepsis and its induced organ dysfunction is complex and the in-fluencing factors are numerous.So far,there is still a lack of specific and effective treatment strategies.RNA modify-N6-methyladenosine(m6 A)is one of the most common post-tran-scriptional modifications on eukaryotic RNAs.It is involved in the regulation of the occurrence and development of a variety of inflammatory diseases,including sepsis,and even multiple organ dysfunction induced by sepsis by affecting the metabolism of RNAs.It includes cardiac dysfunction,acute lung injury(ALI)and acute kidney injury(AKI).Therefore,this article will dis-cuss the effect of m6A modification on the function of immune cells,and its important role in sepsis and its induced multiple or-gan dysfunction diseases by regulating inflammatory signals,py-roptosis,mitochondrial damage and ferroptosis.This will provide new therapeutic targets and strategies for the clinical prevention and treatment of sepsis and its induced multiple organ dysfunc-tion diseases.

Objective To investigate the potential mechanism of action of polygonatum odoratum in treating Alzheimer's disease through the utilization of network pharmacology and molecular docking techniques.Methods The methods employed include target screening,Gene Ontology(GO)function and Kyoto Encyclopedia of Genes and Genomes(KEGG)enrichment analysis,and molecular docking simulations to assess the binding interactions between the active compounds in polygonatum odoratum(POD)and the key target proteins associated with Alzheimer's disease.Subsequently,lipopolysaccharide(LPS)was used to induce an inflammatory cell model in BV2 microglial cells.After treating the cell model with POD extract for 24 hours,the cells were collected,and the expression of the target genes were detected by Real-time PCR.Results Eight active ingredients and 172 targets of POD were screened.The biological processes such as protein phosphorylation and signal transduction,protein binding and ATP binding were obtained by GO functional analysis.KEGG enrichment yielded PI3K/Akt,cAMP and other signaling pathways.The molecular docking result showed that the active ingredient of POD had well binding activity with epidermal growth factor receptor(EGFR),proto-oncogene tyrosine-protein kinase Src(SRC),tumor necrosis factor(TNF),STAT3.Through Real-time PCR experiments,the gene expressions of inducible nitric oxide synthase(iNOS),prostaglandin G/H synthase 2(PTGS2),interleukin(IL)-6,and IL-1β in the LPS-induced inflammatory cell model were significantly upregulated.After treating the inflammatory model with POD extract for 24 hours,the expression of TNF-α was significantly reduced,the expression of STAT3 was upregulated,there were no significant changes in the expressions of SRC and EGFR.Conclusion Network pharmacology suggests polygonatum odoratum's potential anti-Alzheimer's effects may be mediated through its interaction with targets such as EGFR,TNF,SRC,and STAT3.The experimental results suggest that polygonatum odoratum exerts an anti-inflammatory effect by acting on TNF-α,which may further alleviate the symptoms of Alzheimer's disease.

AIM To study the chemical constituents from Inula japonica Thunb.and their anti-asthmatic activity.METHODS Separation and purification were performed using silica gel and Sephadex LH-20,then the structures of obtained compounds were identified by physicochemical properties and spectral data.The effect of compounds on the release rate of β-Hex was evaluated by substrate coloration method.RESULTS Twenty-three compounds were isolated and identified as dehydrodontic acid(1),vitexin(2),alternariol(3),globuxanthone(4),1,3,6,7-tetrahydroxyxanthone(5),hydroxyhydrolapachol(6),isoscopoletin(7),elephanmollen(8),benzoylcholine(9),hoconobiflavone(10),clovandiol(11),hydroxydihydrobovolide(12),5,7-dihydroxycoumarin(13),scopoletin(14),orlichenol glucoside(15),urolignoside(16),9-angeloyloxythymol(17),6,3′,4′-trihydroxyaurone(18),flufuran(19),sweroside(20),guajadial(21),5,7,4′-trimethoxy-4-phenylcoumarin(22),dibutylphthalate(23).After intervention with compounds 9 and 16,the release rates of β-Hex were(56.64±2.37)％and(58.07±2.29)％,respectively.CONCLUSION Compounds 1-23 are isolated from Ⅰ.japonica for the first time.Compounds 9 and 16 have anti-asthmatic activity.

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets