Objective To investigate the relationship of neutrophil to lymphocyte ratio (NLR) and homocysteine (Hcy) with risk of coronary artery lesion progression in patients with hypertension. Methods The data of 306 patients with hypertension who received coronary angiography from January 2020 to January 2025 were included for retrospective investigation. The patients were divided into a non-progression group (175 cases) and a progression group (131 cases) based on the 6-month Gensini progression rate. The relationship between NLR and Hcy and coronary artery lesion progression was analyzed. Results Binary logistic regression analysis was applied to control confounding factors. After adjusting for confounding factors using Model1, Model2, and Model3, it was found that NLR and Hcy at admission were independently associated with the progression of coronary artery lesion in hypertensive patients [adjusted OR (95% CI) = 1.77 (1.48-2.11), 4.26 (2.71-6.69), P<0.001]. Receiver operating characteristic (ROC) curve revealed that the area under the curve of the combination of Hcy and NLR was 0.814 in predicting the progression of coronary artery lesion in hypertensive patients, which was higher than that of Hcy or NLR (Z/P=5.328, 2.077/<0.05). Conclusion Cardiovascular disease risk factors NLR and Hcy are independently associated with coronary artery lesion progression in patients with hypertension. Early detection of NLR and Hcy is helpful to predict the progression of coronary artery lesion.

Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.

Background: High-mobility group box protein 1 (HMGB1) is a chromatin-binding protein involved in arthritis, ischemia, sepsis, atherosclerosis, neurodegenerative disorders, meningitis, and cancer. HMGB1 exhibits dual roles in cancer, acting as either a tumor suppressor or oncoprotein depending on context. Objective: This research aimed to elucidate HMGB1’s functional significance in cutaneous squamous cell carcinoma (cSCC). Methods: We overexpressed HMGB1 in cSCC cell lines using recombinant adenovirus and examined its effects on cell proliferation, colony formation, and cell migration. Results: Immunohistochemical analysis revealed elevated HMGB1 expression levels in cSCC tissue relative to normal epidermis. To assess the influence of HMGB1, we employed recombinant adenoviruses expressing HMGB1 to transduce SCC cell lines (SCC12 and SCC13). Enhanced HMGB1 expression significantly promoted cellular proliferation and colony formation capacity.Notably, HMGB1 overexpression elevated the levels of proliferation regulators, including P63, SOX2, CDK4 and CDK6. Furthermore, HMGB1 overexpression substantially enhanced tumor invasiveness, accompanied by upregulation of epithelial-mesenchymal transition (EMT) biomarkers. Mechanistically, overexpression of HMGB1 enhanced transforming growth factor-β signaling by increasing phosphorylation of SMAD2/3, the key mediators of EMT. Conclusion These data imply that HMGB1 acts as a tumor-promoting factor in cSCC.

ObjectiveMigraine is a leading neurological disorder and the fourth most common cause of years lived with disability worldwide, affecting nearly 116 million individuals. Although pharmacological treatments are available, their efficacy is often limited by side effects and variable response rates. Repetitive transcranial magnetic stimulation (rTMS) over the dorsolateral prefrontal cortex (DLPFC) offers a safe, non-invasive alternative for migraine management. However, the neurophysiological mechanisms, particularly how rTMS modulates local cortical excitability and distributed pain-related circuits, remain poorly understood. Elucidating these mechanisms is essential for optimizing treatment protocols and improving clinical outcomes. MethodsThis study employed concurrent transcranial magnetic stimulation and electroencephalography (TMS-EEG) to investigate neuroplastic and neurocircuitry mechanisms of DLPFC-rTMS in migraine. Study 1 compared 30 migraineurs and 28 healthy controls to identify abnormalities in TMS-evoked potentials (TEPs) and significant current density (SCD) within sensory-discriminative regions including the primary somatosensory cortex (S1) and posterior insula (pINS), cognitive-affective regions including the anterior insula (aINS) and midcingulate cortex (MCC), and a descending modulatory region, the periaqueductal gray (PAG). Study 2 used a single-blind, crossover, sham-controlled design in 34 healthy participants. Each participant received both active (10 Hz, 80% RMT, 1 500 pulses) and sham DLPFC-rTMS in counterbalanced order. TMS-EEG and cold pain tolerance were assessed before and after each session. ResultsIn Study 1, migraineurs showed a significantly less negative N120 amplitude compared to healthy controls (P=0.027, Cohen’s d=0.60), indicating local intracortical disinhibition. No group differences were observed for N40, P60, or P180 components. At the source level, migraineurs exhibited significantly higher SCD in the S1, pINS, aINS, and MCC (allQ<0.05), but not in the ventroposterior thalamus (vpTHAL), mediodorsal thalamus (mdTHAL), or PAG. In Study 2, active rTMS significantly reduced SCD from pre- to post-stimulation in the S1, aINS, and MCC (all Q<0.05). Sham stimulation also reduced SCD in the S1 (Q<0.05) but not in the aINS or MCC. Although no significant group-level analgesic effect was observed between active and sham conditions (P=0.107), correlation analyses revealed that greater SCD reductions in the S1 and MCC were significantly associated with higher post-rTMS pain tolerance (R=-0.487 and -0.495, both Q<0.01) and larger improvements in pain tolerance(R=-0.487 and -0.451, both Q<0.05). No such correlations were found following sham stimulation, suggesting that the behavioural relevance of neural changes is specific to active rTMS. ConclusionThis study provides novel evidence that migraineurs exhibit both local neuroplastic abnormalities (reduced N120 amplitude) and hyperactivity in key pain-processing regions (S1, pINS, aINS, MCC). A single session of DLPFC-rTMS reduced hyperactivity in the aINS, MCC, and S1. Notably, greater reductions in the S1 and MCC were associated with improved pain tolerance. These findings identify distinct cortical circuitries, particularly within the cognitive-affective pain network, that may serve as potential biomarkers for optimizing rTMS treatment in migraine and other chronic pain conditions. Future studies should validate these results in patient populations experiencing spontaneous migraine attacks and explore multi-session or accelerated rTMS protocols.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the influence of different scanning conditions on the image quality of medical electron accelerator cone-beam computed tomography (CBCT) and provide a reference for the selection of scanning conditions for different body parts. Methods Set different scanning conditions, the Catphan 503 phantom was scanned using CBCT parameters to analyze the influence of spatial resolution, noise, uniformity, spatial geometric accuracy, and low-contrast resolution on the image quality of CBCT. RESULTS: For the head, chest, and abdomen, with the increase in scanning parameter values, the noise value decreased by 47.4%, 26.1%, and 51.3% respectively, and the uniformity values decreased by 30.2%, 26.6%, and 47.9% respectively. The low-contrast resolution values decreased by 50.6%, 34.2%, and 12.0%. The influence of different scanning conditions on spatial geometric accuracy and spatial resolution is not significant. CONCLUSION Different scanning parameters have a certain influence on the image quality of medical electron accelerator CBCT. Lower scanning parameters can be selected based on individual patients to reduce the additional radiation dose, providing a reference for the safe application of CBCT image guidance in radiotherapy.
Cone-Beam Computed Tomography/instrumentation* ; Phantoms, Imaging ; Particle Accelerators

Objective:This study aimed to compare the effects of cochlear implantation（CI） on vestibular function in patients with large vestibular aqueduct syndrome（LVAS） and in patients with extremely severe deafness with normal inner ear structure. Methods:A total of 28 LVAS patients and 28 patients with normal inner ear structure who suffered from extremely severe deafness were selected. The parameters of caloric tests, bone conduction evoked cervical vestibular-evoked myogenic potentials（cVEMP）, bone conduction evoked ocular vestibular-evoked myogenic potentials（oVEMP） and video head impulse tests（v-HIT） were compared between the two groups before and after CI. The data were analyzed using SPSS 26.0 software. Results:There was no significant difference in the results of the preoperative caloric test, v-HIT, and oVEMP（P1, N1） between the LVAS group and the control group（P>0.05）. Compared to the control group, the LVAS group exhibited a shorter cVEMP P1[（13.41±0.71）ms vs （16.28±0.89）ms, P<0.000 1], shorter N1[（19.83±0.54）ms vs （28.18±1.56）ms, P<0.000 1], higher amplitude[（123.60±83.80）μV vs （73.92±79.85）μV, P=0.049 4] and higher oVEMP amplitude[（16.60±13.87）μV vs （9.96±10.47）μV, P=0.028 5] before CI. The abnormal rate of caloric test increased in both groups after CI（25.00% vs 57.14%, P=0.028 8, 32.14% vs 82.14%, P=0.000 3, respectively）. There was no significant difference in the v-HIT parameters in both groups before and after the operation. As for the LVAS group, there was no statistically significant difference in cVEMP and oVEMP induction rates before and after operation. In the control group, there was a decrease in cVEMP induction rate（96.42% vs 64.28%, P=0.005 2） and oVEMP induction rate（96.42% vs 57.14%, P=0.000 9） after CI. LVAS group showed a shorter cVEMP P1[（13.41±0.71）ms vs （10.30±0.60）ms, P<0.000 1]; shorter cVEMP N1[（19.86±0.53）ms vs （18.97±1.33）ms, P=0.004 7]; decreased amplitude[（124.50±84.86）μV vs （64.35±61.57）μV, P=0.001 0] and shorter oVEMP amplitude[（15.92±13.03）μV vs （9.16±9.20）μV, P=0.009 9] after CI. The oVEMP N1 in the control group was longer than that before operation[（11.73 ± 0.91）ms vs （13.35 ± 2.60）ms, P=0.019 6], whereas there was no significant difference in other VEMP parameters after CI. Conclusion:Before CI, there was no significant difference in the results of the caloric test and v-HIT between the LVAS group and the control group, but the LVAS group exhibited increased sensitivity to acoustic stimulation-induced myogenic potentials. After CI, the function of the semicircular canal was impaired in both groups in the low-frequency area, and remained largely unaffected in the high-frequency area. Additionally, the function of the otolith in the LVAS group was less affected than that in the control group after CI, which may be related to the fact that the enlarged vestibular aqueduct of the LVAS patients acted as the third window of the inner ear.
Humans ; Vestibular Aqueduct/physiopathology* ; Cochlear Implantation ; Male ; Female ; Vestibular Evoked Myogenic Potentials ; Deafness/physiopathology* ; Child ; Adolescent ; Adult ; Young Adult ; Hearing Loss, Sensorineural/physiopathology* ; Vestibular Function Tests

Objective:To explore the clinical characteristics and treatment methods of middle ear cholesteatoma with intracranial and extracranial complications as the first diagnosis. Methods:A total of 244 patients were initially diagnosed with intracranial and/or extracranial complications associated with middle ear cholesteatoma at the First Affiliated Hospital of Zhengzhou University from January 2015 to January 2022, and medical records were collected and retrospectively analyzed. Results:Among 244 patients with intracranial and extracranial complications of middle ear cholesteatoma, 203 cases had one complication, 34 cases had 2 complications, and 7 cases had 3 or more complications. One hundred and eighty-six cases presented labyrinthitis, 41 cases had peripheral facial paralysis, 27 cases had periauricular abscess, 12 cases had meningitis, 10 cases had brain abscess, 7 cases had sigmoid sinus lesions, 6 cases had epidural abscess, and 4 cases demonstrated hydrocephalus. Conclusion:The destructive nature of middle ear cholesteatoma can lead to intracranial and extracranial complications. The incidence rate of extracranial complications is highest for labyrinthitis. Patients with otitis media who complained dizziness should raise clinical suspicion for potential labyrinthitis. The second most prevalent extracranial complication is peripheral facial paralysis, and early facial nerve decompression surgery is critical for better recovery of facial paralysis symptoms. Brain abscess is the most common intracranial complications, which has the highest fatality rate. Clinicians should be alert to otogenic brain abscess. Otolaryngology and neurosurgery teams should cooperate and evaluate patients' middle ear lesions and brain abscess, and jointly develop personalized treatment plans.
Humans ; Cholesteatoma, Middle Ear/surgery* ; Retrospective Studies ; Facial Paralysis/etiology* ; Brain Abscess/diagnosis* ; Male ; Female ; Otitis Media/complications* ; Meningitis/etiology* ; Labyrinthitis/etiology* ; Adult ; Middle Aged ; Young Adult

Objective:X-linked non-syndromic hearing loss is an extremely rare type of hearing impairment. This study conducted a phenotypic and genetic analysis of a family with X-linked dominant inheritance to explore the causes of hearing loss. Methods:Clinical data were collected from a patient with non-syndromic hearing loss who visited the Otorhinolaryngology Department of the First Affiliated Hospital of Zhengzhou University in June 2023. Phenotypic and genetic analyses were performed on family members, including audiometric tests, whole-exome sequencing, and PCR-Sanger sequencing verification. Audiological assessments comprised pure-tone audiometry, impedance audiometry, auditory brainstem response, and otoacoustic emission tests. Results:The affected individuals in this pedigree have X-linked dominant non-syndromic deafness caused by mutations in the SMPX gene. The proband, along with their mother and maternal grandmother, exhibit varying degrees of sensorineural hearing loss. Whole-exome sequencing revealed a novel pathogenic variant, NM_014332.3: c. 133-2A>C, in the SMPX gene in the proband. Sanger sequencing confirmed that the proband, proband's mother, and grandmother all carried this pathogenic variant. Conclusion:This study reports a novel pathogenic variant in the SMPX gene, providing additional medical evidence for the diagnosis and treatment of X-linked dominant inherited non-syndromic hearing loss. It enriches the mutation spectrum of the SMPX gene.
Humans ; Pedigree ; Mutation ; Phenotype ; Male ; Hearing Loss, Sensorineural/genetics* ; Exome Sequencing ; Female ; Adult ; Hearing Loss/genetics* ; Evoked Potentials, Auditory, Brain Stem ; Muscle Proteins

Most cancers are currently incurable, partly due to abnormal post-translational modifications (PTMs). In this study, we initially used multiple myeloma (MM) as a working model and found that SUMOylation activating enzyme subunit 1 (SAE1) promotes the malignancy of MM. Through proteome microarray analysis, SAE1 was identified as a potential target for bioactive colcemid or its derivative colchicine. Elevated levels of SAE1 were associated with poor clinical survival and increased MM proliferation in vitro and in vivo. Additionally, SAE1 directly SUMOylated and upregulated the total protein expression of p27, leading to LLPS-mediated nuclear export of p27. Our study also demonstrated the involvement of SAE1 in other types of cancer cells, and provided the first monomer crystal structure of SAE1 and its key binding model with colchicine. Colchicine also showed promising results in the Patient-Derived Tumor Xenograft (PDX) model. Furthermore, a controlled clinical trial with 56 MM patients demonstrated the clinical efficacy of colchicine. Our findings reveal a novel mechanism by which tumor cells evade p27-induced cellular growth arrest through p27 SUMOylation-mediated nuclear export. SAE1 may serve as a promising therapeutic target, and colchicine may be a potential treatment option for multiple types of cancer in clinical settings.