To explore the correlation between MTHFR C677T gene polymorphism and hypertension, hyperhomocysteinemia(Hcy), and hyperlipidemia in the Tibetan population of Tibet.

Objective To study the five-year survival status and influencing factors of elderly patients with lung cancer complicated with chronic obstructive pulmonary disease (COPD). Methods A cohort study was conducted to follow up 450 patients with lung cancer and chronic obstructive pulmonary disease who were hospitalized in our hospital from January 2018 to December 2023. The endpoint of the follow-up was the end of a five-year period or death. The Life Tables method was used to calculate survival rates and plot survival curves. The Cox proportional hazards model was used to analyze the influencing factors of five-year survival. Results The results indicated that the overall five-year survival rate of patients was 4.89%, and it decreased year by year. Cox regression analysis showed that age, gender, family functioning, and psychological status significantly influenced patient survival rate (all P<0.05). Stratified analysis found that the smoking status, family functioning, and psychological status of male patients all had an impact on survival rate (all P<0.05), while the psychological status of female patients had a more significant impact on survival (P=0.008). Conclusion This study provides a scientific basis for comprehensive intervention of elderly lung cancer patients with COPD. It is recommended that clinical attention should be paid to psychological and family factors to improve patient prognosis.

Recent advances in large models demonstrate significant prospects for transforming the field of medical imaging. These models, including large language models, large visual models, and multimodal large models, offer unprecedented capabilities in processing and interpreting complex medical data across various imaging modalities. By leveraging self-supervised pretraining on vast unlabeled datasets, cross-modal representation learning, and domain-specific medical knowledge adaptation through fine-tuning, large models can achieve higher diagnostic accuracy and more efficient workflows for key clinical tasks. This review summarizes the concepts, methods, and progress of large models in medical imaging, highlighting their potential in precision medicine. The article first outlines the integration of multimodal data under large model technologies, approaches for training large models with medical datasets, and the need for robust evaluation metrics. It then explores how large models can revolutionize applications in critical tasks such as image segmentation, disease diagnosis, personalized treatment strategies, and real-time interactive systems, thus pushing the boundaries of traditional imaging analysis. Despite their potential, the practical implementation of large models in medical imaging faces notable challenges, including the scarcity of high-quality medical data, the need for optimized perception of imaging phenotypes, safety considerations, and seamless integration with existing clinical workflows and equipment. As research progresses, the development of more efficient, interpretable, and generalizable models will be critical to ensuring their reliable deployment across diverse clinical environments. This review aims to provide insights into the current state of the field and provide directions for future research to facilitate the broader adoption of large models in clinical practice.
Humans ; Diagnostic Imaging/methods* ; Precision Medicine/methods* ; Image Processing, Computer-Assisted/methods*

This study aimed to explore the pharmacological mechanism of Yourenji Capsules(YRJ) in improving osteoporosis by combining network pharmacology and proteomics technologies. The SD rats were randomly divided into a blank control group and a 700 mg·kg~(-1) YRJ group. The rats were subjected to gavage administration with the corresponding drugs, and the blank serum, drug-containing serum, and YRJ samples were compared using ultra performance liquid chromatography-quadrupole time-of-flight tandem mass spectrometry(UPLC-Q-TOF-MS/MS) to analyze the main components absorbed into blood. Network pharmacology analysis was conducted based on the YRJ components absorbed into blood to obtain related targets of the components and target genes involved in osteoporosis, and Venn diagrams were used to identify the intersection of drug action targets and disease targets. The STRING database was used for protein-protein interaction(PPI) network analysis of potential target proteins to construct a PPI network. Gene Ontology(GO) functional enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment were performed using Enrichr to investigate the potential mechanism of action of YRJ. Ovariectomy(OVX) was performed to establish a rat model of osteoporosis, and the rats were divided into a sham group, a model group, and a 700 mg·kg~(-1) YRJ group. The rats were given the corresponding drugs by gavage. The femurs of the rats were subjected to label-free proteomics analysis to detect differentially expressed proteins, and GO functional enrichment and KEGG pathway enrichment analyses were performed on the differentially expressed proteins. With the help of network pharmacology and proteomics results, the mechanism by which YRJ improves osteoporosis was predicted. The analysis of the YRJ components absorbed into blood revealed 23 bioactive components of YRJ, and network pharmacology results indicated that key targets involved include tumor necrosis factor(TNF), tumor protein p53(TP53), protein kinase(AKT1), and matrix metalloproteinase 9(MMP9). These targets are mainly involved in osteoclast differentiation, estrogen signaling pathways, and nuclear factor-kappa B(NF-κB) signaling pathways. Additionally, the proteomics analysis highlighted important pathways such as peroxisome proliferator-activated receptor(PPAR) signaling pathways, mitogen-activated protein kinase(MAPK) signaling pathways, and β-alanine metabolism. The combined approaches of network pharmacology and proteomics have revealed that the mechanism by which YRJ improves osteoporosis may be closely related to the regulation of inflammation, osteoblast, and osteoclast metabolic pathways. The main pathways involved include the NF-κB signaling pathways, MAPK signaling pathways, and PPAR signaling pathways, among others.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Osteoporosis/metabolism* ; Proteomics ; Rats ; Rats, Sprague-Dawley ; Network Pharmacology ; Female ; Protein Interaction Maps/drug effects* ; Capsules ; Humans ; Signal Transduction/drug effects*

The efficacy of Xiangmei Pills on rats with ulcerative colitis(UC) was investigated by characterizing the spectrum of the active chemical components of Xiangmei Pills. Rapid identification and classification of the main chemical components were performed,and the therapeutic effects of Xiangmei Pills on the proteins and intestinal flora of UC rats were analyzed to explore the mechanism of its action in treating UC. Fifty SD rats were acclimatized to feeding for 3 d and randomly divided into blank group, model group,mesalazine group(0. 4 g·kg~(-1)), low-dose group of Xiangmei Pills(1. 89 g·kg~(-1)), and high-dose group of Xiangmei Pills(5. 67 g·kg~(-1)), with 10 rats in each group. 5% dextrose sodium sulfate(DSS) was given by gavage to induce the male SD rat model with UC,and the corresponding medicinal solution was given by gavage after 10 days, respectively. The therapeutic effect of Xiangmei Pills on rats with UC was evaluated according to body mass, disease activity index(DAI), and hematoxylin-eosin(HE) staining, and the histopathological changes in the colon were observed. Ultra-high performance liquid chromatography-quadrupole/electrostatic field orbitrap high-resolution mass spectrometry(UHPLC-Q-Orbitrap HRMS) technique was used to rapidly and accurately identify the main chemical constituents of Xiangmei Pills. Immunohistochemistry was used to detect the expression of aryl hydrocarbon receptor(AhR),interferon-γ(IFN-γ), mucin-2(MUC-2), and cytochrome P450 1A1(CYP1A1) in colon tissue. Interleukin-22(IL-22) expression in colon tissue was detected by immunofluorescence. The 16S r DNA high-throughput sequencing technique was used to study the modulatory effects of Xiangmei Pills on the intestinal flora structure of rats with UC. Pharmacodynamic results showed that compared with that of the blank group, the colon tissue of the model group was congested, and ulcers were visible in the mucosa; compared with that in the model group, the histopathology of the colon of the rats with UC in the groups of Xiangmei Pills were improved, with scattered ulcers and reduced inflammatory cell infiltration. Chemical analysis showed that a total of 45 components were identified by mass spectrometry information, including 15 phenolic acids, 8 coumarins, 15 organic acids, 3 amino acids, 2 flavonoids, and 2 other components. Compared with those in the blank group, the levels of Ah R, CYP1A1, MUC-2, and IL-22 proteins in the colon tissue of rats in the model group were significantly decreased, and the level of IFN-γ protein was significantly increased; the intestinal flora of rats in the model group was disorganized, with a decrease in the abundance of the flora; the relative abundance of Bacteroidetes,unclassified genera of Ascomycetes, Prevotella of the Prevotella family, and Prevotella decreased significantly, and that of Firmicutes decreased, but the difference was not statistically significant. The relative abundance of Bacteroidetes, Bifidobacterium, and Lactobacillus increased significantly. Compared with those of the model group, the levels of Ah R, CYP1A1, MUC-2, and IL-22proteins in the colonic tissue of the groups of Xiangmei Pills were significantly higher, and the levels of IFN-γ proteins were significantly lower. The recovery of the intestinal flora was accelerated, and the diversity of the intestinal flora was significantly increased. The relative abundance of Bacteroidetes was significantly increased, and that of unclassified genera of Ascomycetes,Lactobacillus, Prevotella of the Prevotella family, and Prevotella was significantly increased. The relative abundance of Bacteroidetes and Bifidobacterium was significantly decreased. This study demonstrated that Xiangmei Pills can effectively treat UC, mainly through the phenolic acid and organic acid components to stimulate the intestinal barrier, regulate protein expression and the relative abundance and diversity of intestinal flora, and play a role in the treatment of UC.
Animals ; Colitis, Ulcerative/metabolism* ; Drugs, Chinese Herbal/chemistry* ; Rats, Sprague-Dawley ; Male ; Rats ; Gastrointestinal Microbiome/genetics* ; Chromatography, High Pressure Liquid ; Humans ; Mass Spectrometry ; RNA, Ribosomal, 16S/genetics* ; Bacteria/drug effects*

OBJECTIVE: To compare the short-term clinical efficacy and safety of closed reduction with Kirschner wire fixation versus open reduction with plate fixation for treating osteoporotic Colles' fractures in middle-aged and elderly patients. METHODS: Between January 2018 and January 2023, 119 patients with Colles fractures were retrospectively analyzed, including 39 males and 80 females, aged from 48 to 74 years old with an average of(60.58±6.71) years old. The time from injury to operation ranged 1 to 13 days with an average of (5.29±2.52) days. According to the surgical method, they were divided into Kirschner wire fixation group (Kirschner wire group) and plate internal fixation group (plate group). In Kirschner wire group, there were a total of 68 patients, comprising 21 males and 47 females. The average age was (61.15±6.24) years old, ranged from 49 to 74 years old. Among them, 41 cases involved the left side while 27 cases involved the right side. In the plate group, there were a total of 51 patients, including 18 males and 33 females. The average age was (59.78±5.71) years old ranged from 48 to 72 years old. Among them, there were 31 cases on the left side and 20 cases on the right side. The following parameters were recorded before and after the operation:operation time, intraoperative blood loss, hospitalization days, hospitalization expenses, postoperative complications, and radiographic parameters of distal radius (distal radius height, ulnar deviation angle, palmar tilt angle). The clinical efficacy was evaluated at 3 and 12 months after the operation using Gartland-Werley and disabilites of the arm shoulder and hand (DASH) scores. RESULTS: The patients in both groups were followed up for a duration from 12 to 19 months with an average of(13.32±2.02) months. The Kirschner wire group exhibited significantly shorter operation time compared to the plate group 27.91(13.00, 42.00) min vs 67.52(29.72, 105.32) min, Z=-8.74, P=0.00. Intraoperative blood loss was also significantly lower in the Kirschner wire group than in the plate group 3.24(1.08, 5.40) ml vs 21.91(17.38, 26.44) ml, Z=-9.31, P=0.00. Furthermore, patients in the Kirschner wire group had a shorter length of hospital stay compared to those in the plate group (8.38±2.63) days vs (11.40±2.78) days, t=-3.12, P=0.00. Additionally, hospitalization cost was significantly lower in the Kirschner wire group than in the plate group 10 111.29(6 738.98, 13 483.60) yuan vs 15 871.11(11 690.40, 20 051.82) yuan, Z=-5.62, P=0.00. The incidence of complications was 2 cases in the Kirschner wire group and 1 case in the plate group, with no statistically significant difference(P>0.05). At 3 months postoprative, the radial height of the Kirschner wire group was found to be significantly smaller than that of the plate group, with measurements of (11.45±1.69) mm and (12.11±1.78) mm respectively (t=-2.06, P=0.04). However, there were no statistically significant differences observed in ulnar deviation angle and palmar tilt angle between the two groups (P>0.05). The DASH score and Gartland-Werley score in the Kirschner group were significantly higher than those in the plate group at 3 months post-operation (19.10±9.89) vs (13.47±3.51), t=4.34, P=0.00;(11.15±3.61) vs (6.41±2.75), t=8.13, P=0.00). However, there was no significant difference between the two groups at 12 months post-operation (P>0.05). CONCLUSION Compared to plate internal fixation, closed reduction with Kirschner wire support fixation yields a slightly inferior recovery of radial height;however, there is no significant disparity in the functional score of the affected limb at 12 months post-operation. Nonetheless, this technique offers advantages such as shorter operation time, reduced intraoperative blood loss, decreased hospitalization duration, and lower cost.
Humans ; Female ; Male ; Middle Aged ; Aged ; Fracture Fixation, Internal/instrumentation* ; Bone Wires ; Bone Plates ; Retrospective Studies ; Colles' Fracture/surgery* ; Minimally Invasive Surgical Procedures/methods* ; Open Fracture Reduction/methods* ; Osteoporotic Fractures/surgery*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To illustrate the role of dehydrocorydaline (DHC) in chronic constriction injury (CCI)-induced neuropathic pain and the underlying mechanism. METHODS: C57BL/6J mice were randomly divided into 3 groups by using a random number table, including sham group (sham operation), CCI group [intrathecal injection of 10% dimethyl sulfoxide (DMSO)], and CCI+DHC group (intrathecal injection of DHC), 8 mice in each group. A CCI mouse model was conducted to induce neuropathic pain through ligating the right common sciatic nerve. On day 14 after CCI modeling or sham operation, mice were intrathecal injected with 5 µL of 10% DMSO or 10 mg/kg DHC (5 µL) into the 5th to 6th lumbar intervertebral space (L5-L6). Pregnant ICR mice were sacrificed for isolating primary spinal neurons on day 14 of embryo development for in vitro experiment. Pain behaviors were evaluated by measuring the paw withdrawal mechanical threshold (PWMT) of mice. Immunofluorescence was used to observe the activation of astrocytes and microglia in mouse spinal cord. Protein expressions of inducible nitric oxide synthase (iNOS), tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6), phosphorylation of N-methyl-D-aspartate receptor subunit 2B (p-NR2B), and NR2B in the spinal cord or primary spinal neurons were detected by Western blot. RESULTS: In CCI-induced neuropathic pain model, mice presented significantly decreased PWMT, activation of glial cells, overexpressions of iNOS, TNF-α, IL-6, and higher p-NR2B/NR2B ratio in the spinal cord (P<0.05 or P<0.01), which were all reversed by a single intrathecal injection of DHC (P<0.05 or P<0.01). The p-NR2B/NR2B ratio in primary spinal neurons were also inhibited after DHC treatment (P<0.05). CONCLUSION An intrathecal injection of DHC relieved CCI-induced neuropathic pain in mice by inhibiting the neuroinflammation and neuron hyperactivity.
Animals ; Neuralgia/etiology* ; Mice, Inbred C57BL ; Analgesics/pharmacology* ; Neuroinflammatory Diseases/pathology* ; Constriction ; Male ; Receptors, N-Methyl-D-Aspartate/metabolism* ; Nitric Oxide Synthase Type II/metabolism* ; Mice, Inbred ICR ; Microglia/pathology* ; Spinal Cord/drug effects* ; Female ; Mice ; Tumor Necrosis Factor-alpha/metabolism* ; Disease Models, Animal ; Constriction, Pathologic/complications* ; Interleukin-6/metabolism* ; Astrocytes/metabolism* ; Chronic Disease ; Neurons/metabolism*

Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C₀), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug‍-‍drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage* ; Drug Monitoring/methods* ; Humans ; Organ Transplantation ; Immunosuppressive Agents/administration & dosage* ; Delphi Technique

OBJECTIVES: To investigate the structural changes of rat thoracic aorta and changes in expression levels of Bmal1 and cyclins in thoracic aorta endothelial cells following heat stress. METHODS: Twenty male SD rats were randomized equally into control group and heat stress group. After exposure to 32 ℃ for 2 weeks in the latter group, the rats were examined for histopathological changes and Bmal1 expression in the thoracic aorta using HE staining and immunohistochemistry. In the cell experiments, cultured rat thoracic aortic endothelial cells (RTAECs) were incubated at 40 ℃ for 12 h with or without prior transfection with a Bmal1-specific small interfering RNA (si-Bmal1) or a negative sequence. In both rat thoracic aorta and RTAECs, the expressions of Bmal1, the cell cycle proteins CDK1, CDK4, CDK6, and cyclin B1, and apoptosis-related proteins Bax and Bcl-2 were detected using Western blotting. TUNEL staining was used to detect cell apoptosis in rat thoracic aorta, and the changes in cell cycle distribution and apoptosis in RTAECs were analyzed with flow cytometry. RESULTS: Compared with the control rats, the rats exposed to heat stress showed significantly increased blood pressures and lowered heart rate with elastic fiber disruption and increased expressions of Bmal1, cyclin B1 and CDK1 in the thoracic aorta (P<0.05). In cultured RTAECs, heat stress caused significant increase of Bmal1, cyclin B1 and CDK1 protein expression levels, which were obviously lowered in cells with prior si-Bmal1 transfection. Bmal1 knockdown also inhibited heat stress-induced increase of apoptosis in RTAECs as evidenced by decreased expression of Bax and increased expression of Bcl-2. CONCLUSIONS Heat stress upregulates Bmal1 expression and causes alterations in expressions of cyclins to trigger apoptosis of rat thoracic aorta endothelial cells, which can be partly alleviated by suppressing Bmal1 expression.
Animals ; ARNTL Transcription Factors/genetics* ; Male ; Aorta, Thoracic/metabolism* ; Rats ; Rats, Sprague-Dawley ; Endothelial Cells/metabolism* ; Apoptosis ; Cells, Cultured ; Heat-Shock Response ; Cyclin B1/metabolism* ; CDC2 Protein Kinase/metabolism* ; Cyclins/metabolism* ; RNA, Small Interfering ; bcl-2-Associated X Protein/metabolism*