Objective : To investigate the protective effect of dimethyl fumarate(DMF) on maternal intrahepatic cholestasis(ICP) during pregnancy induced by di(2-ethylhexyl) phthalate(DEHP) exposure and its mechanism. Methods : Thirty-two 8-week-old female institute of cancer research(ICR) mice were randomly divided into 4 groups: Ctrl group, DEHP group, DMF group and DEHP+DMF group. DEHP and DEHP+DMF groups were treated with DEHP(200 mg/kg) by gavage every morning at 9:00 a.m. DMF and DEHP+DMF groups were treated with DMF(150 mg/kg) from day 13 to day 16 of gestation by gavage. After completion of gavage on day 16 of pregnancy, maternal blood, maternal liver, placenta, and amniotic fluid were collected from pregnant mice after a six-hour abrosia. The body weight of the mother rats and the body weight of the fetus rats were sorted and analyzed; the levels of total bile acid(TBA), alkaline phosphatase(ALP), aspartate aminotransferase/alanine aminotransferase(AST/ALT) in serum and TBA in liver, amniotic fluid and placenta were detected by biochemical analyzer; HE staining was used to observe the pathological changes of liver tissue; Quantitative reverse transcription PCR(RT-qPCR) was used to detect the expression levels of tumor necrosis factor-α(TNF-α), interleukin(IL)-6, IL-1, IL-18 and NOD-like receptor thermal protein domain associated protein 3(NLRP3) in the liver; Western blot was used to detect the expression of the nuclear factor KappaB(NF-κB) and NLRP3. Results : Compared with the control group, the body weight of the DEHP-treated dams and pups decreased(P<0.05); the levels of TBA, ALP, AST/ALT in the serum of dams and the levels of TBA in the liver, amniotic fluid, and placenta of dams increased(P<0.05); the histopathological results showed that liver tissue was damaged, bile ducts were deformed, and there was inflammatory cell infiltration around them; the levels of inflammation-related factors TNF-α, IL-6, IL-1, IL-18 and NLRP3 transcription in maternal liver increased(P<0.05); the expression of NF-κB and NLRP3 protein in maternal liver significantly increased( P<0. 05). Compared with the DEHP group,the body weight of both dams and fetuses significantly increased in DEHP + DMF group( P<0. 05); the levels of TBA,ALP,AST/ALT in the serum of dams and amniotic fluid of fetuses decreased( P<0. 05); the degree of liver lesions was improved; the transcription levels of inflammation-related factors TNF-α,IL-6,IL-1,IL-18 and NLRP3 in maternal liver decreased( P<0. 05); the expression of NF-κB and NLRP3 protein in maternal liver significantly decreased( P<0. 05). Conclusion DMF can effectively protect the DEHP exposure to lead to female ICP,and its mechanism may be through inhibiting the NF-κB/NLRP3 pathway and reducing liver inflammation.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Recent advances in large models demonstrate significant prospects for transforming the field of medical imaging. These models, including large language models, large visual models, and multimodal large models, offer unprecedented capabilities in processing and interpreting complex medical data across various imaging modalities. By leveraging self-supervised pretraining on vast unlabeled datasets, cross-modal representation learning, and domain-specific medical knowledge adaptation through fine-tuning, large models can achieve higher diagnostic accuracy and more efficient workflows for key clinical tasks. This review summarizes the concepts, methods, and progress of large models in medical imaging, highlighting their potential in precision medicine. The article first outlines the integration of multimodal data under large model technologies, approaches for training large models with medical datasets, and the need for robust evaluation metrics. It then explores how large models can revolutionize applications in critical tasks such as image segmentation, disease diagnosis, personalized treatment strategies, and real-time interactive systems, thus pushing the boundaries of traditional imaging analysis. Despite their potential, the practical implementation of large models in medical imaging faces notable challenges, including the scarcity of high-quality medical data, the need for optimized perception of imaging phenotypes, safety considerations, and seamless integration with existing clinical workflows and equipment. As research progresses, the development of more efficient, interpretable, and generalizable models will be critical to ensuring their reliable deployment across diverse clinical environments. This review aims to provide insights into the current state of the field and provide directions for future research to facilitate the broader adoption of large models in clinical practice.
Humans ; Diagnostic Imaging/methods* ; Precision Medicine/methods* ; Image Processing, Computer-Assisted/methods*

This study aimed to explore the pharmacological mechanism of Yourenji Capsules(YRJ) in improving osteoporosis by combining network pharmacology and proteomics technologies. The SD rats were randomly divided into a blank control group and a 700 mg·kg~(-1) YRJ group. The rats were subjected to gavage administration with the corresponding drugs, and the blank serum, drug-containing serum, and YRJ samples were compared using ultra performance liquid chromatography-quadrupole time-of-flight tandem mass spectrometry(UPLC-Q-TOF-MS/MS) to analyze the main components absorbed into blood. Network pharmacology analysis was conducted based on the YRJ components absorbed into blood to obtain related targets of the components and target genes involved in osteoporosis, and Venn diagrams were used to identify the intersection of drug action targets and disease targets. The STRING database was used for protein-protein interaction(PPI) network analysis of potential target proteins to construct a PPI network. Gene Ontology(GO) functional enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment were performed using Enrichr to investigate the potential mechanism of action of YRJ. Ovariectomy(OVX) was performed to establish a rat model of osteoporosis, and the rats were divided into a sham group, a model group, and a 700 mg·kg~(-1) YRJ group. The rats were given the corresponding drugs by gavage. The femurs of the rats were subjected to label-free proteomics analysis to detect differentially expressed proteins, and GO functional enrichment and KEGG pathway enrichment analyses were performed on the differentially expressed proteins. With the help of network pharmacology and proteomics results, the mechanism by which YRJ improves osteoporosis was predicted. The analysis of the YRJ components absorbed into blood revealed 23 bioactive components of YRJ, and network pharmacology results indicated that key targets involved include tumor necrosis factor(TNF), tumor protein p53(TP53), protein kinase(AKT1), and matrix metalloproteinase 9(MMP9). These targets are mainly involved in osteoclast differentiation, estrogen signaling pathways, and nuclear factor-kappa B(NF-κB) signaling pathways. Additionally, the proteomics analysis highlighted important pathways such as peroxisome proliferator-activated receptor(PPAR) signaling pathways, mitogen-activated protein kinase(MAPK) signaling pathways, and β-alanine metabolism. The combined approaches of network pharmacology and proteomics have revealed that the mechanism by which YRJ improves osteoporosis may be closely related to the regulation of inflammation, osteoblast, and osteoclast metabolic pathways. The main pathways involved include the NF-κB signaling pathways, MAPK signaling pathways, and PPAR signaling pathways, among others.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Osteoporosis/metabolism* ; Proteomics ; Rats ; Rats, Sprague-Dawley ; Network Pharmacology ; Female ; Protein Interaction Maps/drug effects* ; Capsules ; Humans ; Signal Transduction/drug effects*

The efficacy of Xiangmei Pills on rats with ulcerative colitis(UC) was investigated by characterizing the spectrum of the active chemical components of Xiangmei Pills. Rapid identification and classification of the main chemical components were performed,and the therapeutic effects of Xiangmei Pills on the proteins and intestinal flora of UC rats were analyzed to explore the mechanism of its action in treating UC. Fifty SD rats were acclimatized to feeding for 3 d and randomly divided into blank group, model group,mesalazine group(0. 4 g·kg~(-1)), low-dose group of Xiangmei Pills(1. 89 g·kg~(-1)), and high-dose group of Xiangmei Pills(5. 67 g·kg~(-1)), with 10 rats in each group. 5% dextrose sodium sulfate(DSS) was given by gavage to induce the male SD rat model with UC,and the corresponding medicinal solution was given by gavage after 10 days, respectively. The therapeutic effect of Xiangmei Pills on rats with UC was evaluated according to body mass, disease activity index(DAI), and hematoxylin-eosin(HE) staining, and the histopathological changes in the colon were observed. Ultra-high performance liquid chromatography-quadrupole/electrostatic field orbitrap high-resolution mass spectrometry(UHPLC-Q-Orbitrap HRMS) technique was used to rapidly and accurately identify the main chemical constituents of Xiangmei Pills. Immunohistochemistry was used to detect the expression of aryl hydrocarbon receptor(AhR),interferon-γ(IFN-γ), mucin-2(MUC-2), and cytochrome P450 1A1(CYP1A1) in colon tissue. Interleukin-22(IL-22) expression in colon tissue was detected by immunofluorescence. The 16S r DNA high-throughput sequencing technique was used to study the modulatory effects of Xiangmei Pills on the intestinal flora structure of rats with UC. Pharmacodynamic results showed that compared with that of the blank group, the colon tissue of the model group was congested, and ulcers were visible in the mucosa; compared with that in the model group, the histopathology of the colon of the rats with UC in the groups of Xiangmei Pills were improved, with scattered ulcers and reduced inflammatory cell infiltration. Chemical analysis showed that a total of 45 components were identified by mass spectrometry information, including 15 phenolic acids, 8 coumarins, 15 organic acids, 3 amino acids, 2 flavonoids, and 2 other components. Compared with those in the blank group, the levels of Ah R, CYP1A1, MUC-2, and IL-22 proteins in the colon tissue of rats in the model group were significantly decreased, and the level of IFN-γ protein was significantly increased; the intestinal flora of rats in the model group was disorganized, with a decrease in the abundance of the flora; the relative abundance of Bacteroidetes,unclassified genera of Ascomycetes, Prevotella of the Prevotella family, and Prevotella decreased significantly, and that of Firmicutes decreased, but the difference was not statistically significant. The relative abundance of Bacteroidetes, Bifidobacterium, and Lactobacillus increased significantly. Compared with those of the model group, the levels of Ah R, CYP1A1, MUC-2, and IL-22proteins in the colonic tissue of the groups of Xiangmei Pills were significantly higher, and the levels of IFN-γ proteins were significantly lower. The recovery of the intestinal flora was accelerated, and the diversity of the intestinal flora was significantly increased. The relative abundance of Bacteroidetes was significantly increased, and that of unclassified genera of Ascomycetes,Lactobacillus, Prevotella of the Prevotella family, and Prevotella was significantly increased. The relative abundance of Bacteroidetes and Bifidobacterium was significantly decreased. This study demonstrated that Xiangmei Pills can effectively treat UC, mainly through the phenolic acid and organic acid components to stimulate the intestinal barrier, regulate protein expression and the relative abundance and diversity of intestinal flora, and play a role in the treatment of UC.
Animals ; Colitis, Ulcerative/metabolism* ; Drugs, Chinese Herbal/chemistry* ; Rats, Sprague-Dawley ; Male ; Rats ; Gastrointestinal Microbiome/genetics* ; Chromatography, High Pressure Liquid ; Humans ; Mass Spectrometry ; RNA, Ribosomal, 16S/genetics* ; Bacteria/drug effects*

OBJECTIVE: To compare the short-term clinical efficacy and safety of closed reduction with Kirschner wire fixation versus open reduction with plate fixation for treating osteoporotic Colles' fractures in middle-aged and elderly patients. METHODS: Between January 2018 and January 2023, 119 patients with Colles fractures were retrospectively analyzed, including 39 males and 80 females, aged from 48 to 74 years old with an average of(60.58±6.71) years old. The time from injury to operation ranged 1 to 13 days with an average of (5.29±2.52) days. According to the surgical method, they were divided into Kirschner wire fixation group (Kirschner wire group) and plate internal fixation group (plate group). In Kirschner wire group, there were a total of 68 patients, comprising 21 males and 47 females. The average age was (61.15±6.24) years old, ranged from 49 to 74 years old. Among them, 41 cases involved the left side while 27 cases involved the right side. In the plate group, there were a total of 51 patients, including 18 males and 33 females. The average age was (59.78±5.71) years old ranged from 48 to 72 years old. Among them, there were 31 cases on the left side and 20 cases on the right side. The following parameters were recorded before and after the operation:operation time, intraoperative blood loss, hospitalization days, hospitalization expenses, postoperative complications, and radiographic parameters of distal radius (distal radius height, ulnar deviation angle, palmar tilt angle). The clinical efficacy was evaluated at 3 and 12 months after the operation using Gartland-Werley and disabilites of the arm shoulder and hand (DASH) scores. RESULTS: The patients in both groups were followed up for a duration from 12 to 19 months with an average of(13.32±2.02) months. The Kirschner wire group exhibited significantly shorter operation time compared to the plate group 27.91(13.00, 42.00) min vs 67.52(29.72, 105.32) min, Z=-8.74, P=0.00. Intraoperative blood loss was also significantly lower in the Kirschner wire group than in the plate group 3.24(1.08, 5.40) ml vs 21.91(17.38, 26.44) ml, Z=-9.31, P=0.00. Furthermore, patients in the Kirschner wire group had a shorter length of hospital stay compared to those in the plate group (8.38±2.63) days vs (11.40±2.78) days, t=-3.12, P=0.00. Additionally, hospitalization cost was significantly lower in the Kirschner wire group than in the plate group 10 111.29(6 738.98, 13 483.60) yuan vs 15 871.11(11 690.40, 20 051.82) yuan, Z=-5.62, P=0.00. The incidence of complications was 2 cases in the Kirschner wire group and 1 case in the plate group, with no statistically significant difference(P>0.05). At 3 months postoprative, the radial height of the Kirschner wire group was found to be significantly smaller than that of the plate group, with measurements of (11.45±1.69) mm and (12.11±1.78) mm respectively (t=-2.06, P=0.04). However, there were no statistically significant differences observed in ulnar deviation angle and palmar tilt angle between the two groups (P>0.05). The DASH score and Gartland-Werley score in the Kirschner group were significantly higher than those in the plate group at 3 months post-operation (19.10±9.89) vs (13.47±3.51), t=4.34, P=0.00;(11.15±3.61) vs (6.41±2.75), t=8.13, P=0.00). However, there was no significant difference between the two groups at 12 months post-operation (P>0.05). CONCLUSION Compared to plate internal fixation, closed reduction with Kirschner wire support fixation yields a slightly inferior recovery of radial height;however, there is no significant disparity in the functional score of the affected limb at 12 months post-operation. Nonetheless, this technique offers advantages such as shorter operation time, reduced intraoperative blood loss, decreased hospitalization duration, and lower cost.
Humans ; Female ; Male ; Middle Aged ; Aged ; Fracture Fixation, Internal/instrumentation* ; Bone Wires ; Bone Plates ; Retrospective Studies ; Colles' Fracture/surgery* ; Minimally Invasive Surgical Procedures/methods* ; Open Fracture Reduction/methods* ; Osteoporotic Fractures/surgery*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test