1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Ethical reflections on narrative wills in elderly end-of-life patients
Linan CHENG ; Fuman CAI ; Huiling LI ; Qian CHEN ; Fengying ZHANG
Chinese Medical Ethics 2025;38(6):712-717
Elderly end-of-life patients often experience distress due to being caught in dilemmas of contemplation and decision-making. Narrative wills, grounded in life values and premised on respecting individual wishes and needs, present an individual’s unique life story through narrative forms, conveying their overall experience, interpretation of meaning, and understanding of life. They are preserved and passed on in a way that meets individual expectations, thereby promoting human exploration, reflection, and growth regarding the meaning of life through interpersonal interactions that transcend space and time. This paper explored the concept of narrative wills among elderly end-of-life patients, the ethical value and ethical principles of narrative wills, and the moral and ethical risks. It also provided specific ethical interpretations, assisting in the application and development of narrative wills in elderly end-of-life patients.
3.Risk factors for lung cancer with coronary artery diseases and the advances of treatment
Linan YAN ; Lin DU ; Xun ZHANG ; Dong WEI ; Dongyan YANG ; Junshan LI ; Lianqun WANG
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2024;31(08):1229-1234
The coronary artery disease is a frequent severe disease of cardiovascular system in recent years. Meanwhile, lung cancer, with its high morbidity and mortality, is the most frequent malignant tumor of respiratory system in the world. Clinical studies have shown that the incidence of coronary artery disease and lung cancer is high throughout the year, and comorbidities are becoming more common, especially in elderly patients. The incidence of lung cancer and coronary heart disease may be related. This article summarizes the common risk factors (smoking and environmental pollution, fibrinogen, estrogen, and age), and treatment (surgical treatment, neoadjuvant therapy, and targeted therapy) progress of the two diseases, providing a theoretical basis for clinical prevention and treatment.
4.Study on the Mechanism of Panax Quinquefolium-Acorus Calamus Ameliorating Diabetic EncepHalopathy in Mice by Mediating Nrf2-Keap1 Signaling Pathway
Dezhi CUI ; You ZHOU ; Jianan LI ; Xu CHEN ; Linan HAN
Chinese Journal of Modern Applied Pharmacy 2024;41(9):1173-1182
OBJECTIVE
To observe the effects of Panax quinquefolium-Acorus calamus on learning and memory abilities in diabetes mellitus(DM) mice and investigate the mechanism of Panax quinquefolium-Acorus calamus in treating diabetic cognitive impairment(DCI) through network pharmacology and animal experiments.
METHODS
Diabetic mouse model was established by intraperitoneal injection of streptozotocin(80 mg·kg−1), followed by 8 weeks of oral administration and assessment of drug efficacy using the Morris water maze. The active ingredients and targets of Panax quinquefolium-Acorus calamus were collected using TCMSP, Swiss Target Prediction, and Gene Cards. The protein-protein interaction network of "Traditional Chinese Medicine-Ingredient-Disease targets" was constructed using the String platform and Cytoscape, visualized, and subjected to enrichment analysis using the Metascape database. The anti-DCI mechanism of Panax quinquefolium-Acorus calamus was examined through ELISA and Western blotting, while changes in hippocampal neurons of diabetic mice were observed using HE staining.
RESULTS
Panax quinquefolium-Acorus calamus reduced the escape latency of diabetic mice(P<0.05), without significant impact on swimming speed. Network pharmacology results indicated that the main components of Panax quinquefolium-Acorus calamus in treating DCI were ginsenoside Re, ginsenoside Rh2, and shanjin phenol, which regulated the Nrf2-Keap1 signaling pathway to treat DCI. Animal experiments demonstrated that Panax quinquefolium-Acorus calamus increased SOD activity(P<0.05), decreased MDA levels(P<0.01), enhanced the expression of HO-1, Keap1, Nrf2 in mouse brain(P<0.01), and alleviated the loosening of granule cell arrangement and nuclear condensation in the hippocampal CA1, CA3, and DG regions.
CONCLUSION
Using animal experiments combined with network pharmacology, this study preliminarily elucidates the potential targets and mechanisms of Panax quinquefolium-Acorus calamus in intervening DCI, and predictes the molecular basis for its intervention in DCI through molecular docking, providing insights for further in-depth research on Panax quinquefolium-Acorus calamus.
5.Nomogram Based on Conventional Ultrasound Combined with Contrast-Enhanced Ultrasound for Predicting Central Lymph Node Metastasis in Clinical Lymph Node-Negative Papillary Thyroid Carcinoma
Xiaomei ZHANG ; Qiaoli LI ; Xiaoyan GE ; Linan SHI ; Yanfei KANG ; Jun LI
Chinese Journal of Medical Imaging 2024;32(1):28-33,41
Purpose To establish a nomogram based on conventional ultrasound combined with contrast-enhanced ultrasound(CEUS)for predicting the probability of cervical central lymph node metastasis(CLNM)in clinical lymph node-negative(CN0)papillary thyroid carcinoma(PTC)patients.Materials and Methods A retrospective study was performed on 359 patients with single CN0 PTC,all of whom underwent thyroid surgery and prophylactic central compartment neck dissection in the First Affiliated Hospital of Shihezi University from September 2015 to March 2022.According to the postoperative pathological results,there were 116 cases with CLNM(+)and other 243 cases with CLNM(-).The indicators of gender,age,conventional ultrasound and CEUS were recorded,and multivariate stepwise Logistic regression was performed to screen out risk predictors to construct prediction models for CLNM in CN0 PTC.The receiver operating characteristic curves of prediction models were drawn,and the area under the curve(AUC)was further compared.The preferable prediction model was selected to establish the risk probability nomogram,and the prediction performance and clinical applicability of the nomogram model were assessed.Results Multivariate analysis showed that gender,age,the maximum diameter of nodule,capsule invasion and enhancement pattern on CEUS were risk factors for CLNM in CN0 PTC(all P<0.05).The AUC of prediction model 1 including the above five indicators was 0.753,and the AUC of prediction model 2 excluding CEUS indicator was 0.704.There were statistically significant difference in AUCs between the two models(Z=2.473,P=0.013).Prediction model 1 was selected to construct a risk probability nomogram for predicting CLNM in CN0 PTC.The nomogram had a C-index of 0.753 and showed well consistency on the calibration curve.Clinical decision curve analysis indicated that the nomogram could achieve ideal net benefit when the threshold probability was between 10.7%to 81.5%.Conclusion Gender,age,the maximum diameter of nodule,capsule invasion and enhancement pattern on CEUS may be the risk predictors for CLNM in CN0 PTC.The nomogram model based on the above indicators can predict the probability of CLNM effectively,and the CEUS indicators can substantially improve the prediction performance of the model.
6.Clinical comprehensive evaluation of recombinant Mycobacterium tuberculosis fusion protein
Xiaofeng NI ; Sha DIAO ; Siyi HE ; Xuefeng JIAO ; Xiao CHENG ; Zhe CHEN ; Zheng LIU ; Linan ZENG ; Deying KANG ; Bin WU ; Chaomin WAN ; Binwu YING ; Hui ZHANG ; Rongsheng ZHAO ; Liyan MIAO ; Zhuo WANG ; Xiaoyu LI ; Maobai LIU ; Benzhi CAI ; Feng QIU ; Feng SUN ; Naihui CHU ; Minggui LIN ; Wei SHA ; Lingli ZHANG
China Pharmacy 2023;34(4):391-396
OBJECTIVE To evaluate the effectiveness, safety, economy, innovation, suitability and accessibility of recombinant Mycobacterium tuberculosis fusion protein (EC), and to provide evidence for selecting skin detection methods for tuberculosis infection diagnosis and auxiliary diagnosis of tuberculosis. METHODS The effectiveness and safety of EC compared with purified protein derivative of tuberculin (TB-PPD) were analyzed by the method of systematic review. Cost minimization analysis, cost-effectiveness analysis and cost-utility analysis were used to evaluate the short-term economy of EC compared with TB-PPD, and cost-utility analysis was used to evaluate the long-term economy. The evaluation dimensions of innovation, suitability and accessibility were determined by systematic review and improved Delphi expert consultation, and the comprehensive score of EC and TB-PPD in each dimension were calculated by the weight of each indicator. RESULTS The scores of effectiveness, safety, economy, innovation and suitability of EC were all higher than those of TB-PPD. The affordability scores of the two drugs were consistent, while the availability score of EC was lower than those of TB-PPD. After considering dimensions and index weight, the scores of effectiveness, safety, economy, innovation, suitability, accessibility and the comprehensive score of EC were all higher than those of TB-PPD. CONCLUSIONS Compared with TB-PPD, EC performs better in all dimensions of effectiveness, safety, economy, innovation, suitability and accessibility. However, it is worth noting that EC should further improve its availability in the dimension of accessibility.
7.Exploration of pharmaceutical service model in multidisciplinary diagnosis and treatment of rare diseases in children
Liang HUANG ; Qiqiong WANG ; Li CHEN ; Dan YU ; Jin WU ; Yunzhu LIN ; Linan ZENG ; Zhijun JIA ; Guo CHENG ; Lingli ZHANG
China Pharmacy 2023;34(8):1000-1004
OBJECTIVE To explore the pharmaceutical service model in multidisciplinary diagnosis and treatment (MDT) of rare diseases in children. METHODS Clinical pharmacists of West China Second University Hospital (hereinafter referred to as “our hospital”) participated in the process of MDT of children’s rare diseases. Clinical pharmacists took part in the entire diagnosis and treatment process of children and established the MDT pharmaceutical service model of children’s rare diseases by formulating drug treatment plans based on evidence-based practice, improving the accessibility of drugs, pharmaceutical monitoring and drug treatment management. RESULTS From January 2021 to April 2022, clinical pharmacists of our hospital had participated in a total of 39 cases of rare diseases MDT in children, including 21 hospitalized children with rare diseases and 18 outpatient com children with rare diseases, involving a total of 23 rare diseases. Clinical pharmacists completed 45 pharmaceutical zhanglingli@scu.edu.cn rounds and 26 pharmaceutical consultations for rare diseases inpatients, 25 outpatients’ MDT and 5 pharmaceutical outpatient service for outpatients with rare diseases, 38 medication educations for inpatients and outpatients with rare diseases and 25 follow-up services for out-of-hospital patients. There were 24 cases (61.54%) of off-label drug use, involving 13 rare diseases and 16 therapeutic drugs, among which off-label drug use registration of 11 drugs had been completed or was in progress. The temporary purchase evaluations of 3 drugs had been completed; 268 cases of medical insurance drug and high-value drug prescription had been reviewed. CONCLUSIONS Our hospital have primarily established a loop pharmaceutical service model of MDT for children with rare diseases, which covers inpatients and outpatients. The model improves the availability and standardization of clinical application of therapeutic drugs, and diagnosis and treatment level for children with rare diseases in our hospital.
8.Death and life loss of malignant tumors in Xicheng District from 2014 to 2021
CHU Linan ; DONG Yi ; LI Zhu ; ZHANG Yan ; ZHU Danhong
Journal of Preventive Medicine 2023;35(5):410-414
Objective:
To investigate the mortality and life loss of malignant tumors among residents in Xicheng District, Beijing from 2014 to 2021, so as to provide the evidence for formulating the control strategy for malignant tumors.
Methods:
Data pertaining to dead cases of malignant tumors in Xicheng District from 2014 to 2021 were collected from Beijing Integrated and Analysis Platform for Health and Disease Prevention Monitoring Information Resources. The crude mortality, standardized mortality, years of potential life lost (YPLL), years of potential life lost rate (YPLLR), rate of standardized years of potential life lost (SYPLLR), average years of life lost (AYLL) and annual percent change (APC) of malignant tumors were measured to analyze the trends in mortality of malignant tumors and life loss.
Results:
A total of 23 202 residents died from malignant tumors in Xicheng District from 2014 to 2021, and the crude and standardized mortality rates of malignant tumors were 198.09/105 and 101.46/105, respectively. The standardized mortality of malignant tumors was 117.36/105 among men and 85.97/105 among women. The standard mortality of malignant tumors appeared a tendency towards a decline among all cases (APC=-1.515%, t=-4.289, P=0.005) and women (APC=-1.629%, t=-3.046, P=0.023), and the crude mortality of malignant tumors appeared a tendency towards a rise with age (χ2trend=49.324, P<0.001). The five most deadly malignant tumors included lung cancer, colorectal cancer, liver cancer, stomach cancer and pancreatic cancer, and lung cancer, liver cancer and colorectal cancer were the three malignant tumors with the three highest life loss, with YPLL of 18 054 person-years, 9 446 person-years and 8 179 person-years, respectively. Leukemia had the highest AYLL (15.95 years per person).
Conclusions
The standardized mortality of malignant tumors appeared a tendency towards a decline among residents in Xicheng District from 2014 to 2021, and men and the elderly people were at high risk of malignant tumors. Lung cancer, colorectal cancer and liver cancer were leading causes of death, leukemia was the major cause of life loss.
9.Current status and influencing factors of thirst in patients after pancreaticoduodenectomy
Yanni LEI ; Caocao WANG ; Sujuan SANG ; Linan LI ; Yanshuang CHENG
Chinese Journal of Modern Nursing 2023;29(16):2191-2196
Objective:To explore the incidence of thirst in patients undergoing pancreaticoduodenectomy and analyze its influencing factors.Methods:From March to October 2022, 155 patients with pancreaticoduodenectomy admitted to the First Medical Center of the Chinese People's Liberation Army General Hospital were selected as the study subject by convenience sampling. The patients were surveyed using the self-made general information questionnaire, Thirst Numerical Rate Scale, oral mucosal misture score, Self-Rating Anxiety Scale, and Self-Rating Depression Scale to understand the incidence of thirst and analyze influencing factors.Results:A total of 153 valid questionnaires were collected, with a valid response rate of 98.71%. Among them, 124 patients (81.05%) experienced postoperative thirst. Univariate analysis showed that there were statistical differences in the incidence of thirst among patients with different ages, fasting time, smoking history, drinking history, hypertension history, diabetes history, anxiety and depression ( P<0.05). Logistic regression analysis showed that age, hypertension history, diabetes history, anxiety and depression were the main influencing factors for thirst in patients undergoing pancreaticoduodenectomy ( P<0.05) . Conclusions:Thirst is common in patients after pancreaticoduodenectomy. Age, hypertension history, diabetes history, anxiety and depression are the influencing factors of thirst in patients after pancreaticoduodenectomy. Medical and nursing staff should provide targeted interventions for thirst prevention and treatment based on relevant factors.
10.Value of ultrasound combined with pathological parameters in predicting axillary lymph node metastasis in breast cancer
Tian SANG ; Xuegang REN ; Ye WANG ; Yuwen CAO ; Qiaoli LI ; Linan SHI ; Wenxiao LI ; Jun LI
Chinese Journal of Ultrasonography 2022;31(8):691-697
Objective:To evaluate the value of conventional ultrasound, shear wave elastic parameters and immunohistochemistry in predicting axillary lymph node metastasis of breast cancer.Methods:The ultrasonographic features and pathological results of 172 masses in 152 breast cancer patients who underwent surgery in the First Affiliated Hospital of Shihezi University Medical College from May to October 2020 were analyzed retrospectively. The patients were divided into metastatic group and non-metastatic group according to the status of axillary lymph nodes. The conventional ultrasound characteristics, shear wave velocity (SWV) and immunohistochemical indexes (ER, PR, HER-2, Ki-67) of 2 groups of breast cancer masses were analyzed. Finally, the parameters with statistically significant difference between groups were selected and the Logistic regression model was established.Results:There were significant differences in the aspect ratio, calcification, SWVmean and HER-2 expression between metastatic group and non-metastatic group (all P<0.05). A prediction model was constructed with aspect ratio >1, calcification, high SWVmean and HER-2(+ ). The area under receiver operating characteristic curve (AUC) of the subjects was 0.891, which was larger than the single parameter (all P<0.05), and was in good agreement with pathological results (Kappa=0.731). Conclusions:The joint prediction model can be used to predict the status of lymph nodes, and the axillary lymph node metastasis is more likely to occur in breast cancer with the aspect ratio >1, calcification, high SWVmean and HER-2(+ ).


Result Analysis
Print
Save
E-mail