1.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.Dimethyl fumarate modulates M1/M2 macrophage polarization to ameliorate periodontal destruction by increasing TUFM-mediated mitophagy.
Liang CHEN ; Pengxiao HU ; Xinhua HONG ; Bin LI ; Yifan PING ; ShuoMin CHEN ; Tianle JIANG ; Haofu JIANG ; Yixin MAO ; Yang CHEN ; Zhongchen SONG ; Zhou YE ; Xiaoyu SUN ; Shufan ZHAO ; Shengbin HUANG
International Journal of Oral Science 2025;17(1):32-32
Periodontitis is a common oral disease characterized by progressive alveolar bone resorption and inflammation of the periodontal tissues. Dimethyl fumarate (DMF) has been used in the treatment of various immune-inflammatory diseases due to its excellent anti-inflammatory and antioxidant functions. Here, we investigated for the first time the therapeutic effect of DMF on periodontitis. In vivo studies showed that DMF significantly inhibited periodontal destruction, enhanced mitophagy, and decreased the M1/M2 macrophage ratio. In vitro studies showed that DMF inhibited macrophage polarization toward M1 macrophages and promoted polarization toward M2 macrophages, with improved mitochondrial function, inhibited oxidative stress, and increased mitophagy in RAW 264.7 cells. Furthermore, DMF increased intracellular mitochondrial Tu translation elongation factor (TUFM) levels to maintain mitochondrial homeostasis, promoted mitophagy, and modulated macrophage polarization, whereas TUFM knockdown decreased the protective effect of DMF. Finally, mechanistic studies showed that DMF increased intracellular TUFM levels by protecting TUFM from degradation via the ubiquitin-proteasomal degradation pathway. Our results demonstrate for the first time that DMF protects mitochondrial function and inhibits oxidative stress through TUFM-mediated mitophagy in macrophages, resulting in a shift in the balance of macrophage polarization, thereby attenuating periodontitis. Importantly, this study provides new insights into the prevention of periodontitis.
Dimethyl Fumarate/pharmacology*
;
Mitophagy/drug effects*
;
Animals
;
Mice
;
Macrophages/metabolism*
;
Periodontitis/prevention & control*
;
RAW 264.7 Cells
;
Oxidative Stress/drug effects*
;
Peptide Elongation Factor Tu/metabolism*
;
Mice, Inbred C57BL
;
Male
;
Mitochondria/drug effects*
4.Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey.
Xiao-Chao LUO ; Jia-Li LIU ; Ming-Hong YAO ; Ye-Meng CHEN ; Arthur Yin FAN ; Fan-Rong LIANG ; Ji-Ping ZHAO ; Ling ZHAO ; Xu ZHOU ; Xiao-Ying ZHONG ; Jia-Hui YANG ; Bo LI ; Ying ZHANG ; Xin SUN ; Ling LI
Journal of Integrative Medicine 2025;23(6):630-640
BACKGROUND:
The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment.
OBJECTIVE:
This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects.
SEARCH STRATEGY:
PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022.
INCLUSION CRITERIA:
RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment.
DATA EXTRACTION AND ANALYSIS:
The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES.
RESULTS:
This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs.
CONCLUSION
The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods*
;
Humans
;
Randomized Controlled Trials as Topic
;
Placebo Effect
;
Placebos
;
Treatment Outcome
5.Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury (version 2025)
Aijun XU ; Shuixia LI ; Bo CHEN ; Mengyuan YE ; Lejiao LANG ; Ning NING ; Lin ZHANG ; Changqing LIU ; Zhonglan CHEN ; Weihu MA ; Weishi LI ; Xiaoning WANG ; Dongmei BIAN ; Jiancheng ZENG ; Xin WANG ; Yuan GAO ; Yaping CHEN ; Jiali CHEN ; Yun HAN ; Xiuting LI ; Yang ZHOU ; Xiaojing SU ; Qiong ZHANG ; Tianwen HUANG ; Ping ZHANG ; Hua LIN ; Xingling XIAO ; Ruifeng XU ; Fanghui DONG ; Bing HAN ; Luo FAN ; Yanling PEI ; Suyun LI ; Xiaoju TAN ; Rongchen GUO ; Yefang ZOU ; Xiaoyun HAN ; Junqin DING ; Yi WANG ; Shuhua DENG ; Jinli GUO ; Yinhua LIANG ; Yuan CEN ; Xiaoqin LIU ; Junru CHEN ; Haiyang YU ; Lunlan LI ; Ying REN ; Yunxia LI ; Jianli LU ; Ying YING ; Lan WEI ; Yin WANG ; Qinhong XU ; Yanqin ZHANG ; Yang LYU ; Shijun ZHANG ; Sui WENJIE ; Sanlian HU ; Shuhong YANG ; Guoqing LI ; Jingjing AN ; Baorong HE ; Leling FENG
Chinese Journal of Trauma 2025;41(6):530-541
Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.
6.Discriminant analysis of finger length ratios in Muay Thai athletes
Zhi-Dong LIANG ; Yan YE ; Hui-Yu CHEN ; Ping WANG ; Yan-Dan REN
Acta Anatomica Sinica 2025;56(5):594-600
Objective To develop the application technology of finger length ratios in the selection of Muay Thai athletes,and to provide practical guidance for improving the competitive level of Muay Thai.Methods By using the method of snowball sampling and simple random sampling,413 subjects were selected in Bangkok,Thailand,including 84 male Muay Thai professional players,62 female Muay Thai professional players,137 ordinary male college students and 130 female college students.The finger length of the subjects was measured and their finger length ratios was calculated.SPSS 20.0 statistical software was used for discriminant analysis.Results The 2D∶3D,2D∶4D,2D∶5D,3D∶4D and 3D∶5D of male Muay Thai professional players were significantly lower than that in the general male Thai population,and the 2D∶4D,3D∶4D and 3D∶5D of female Muay Thai players were significantly lower than that in the general female Thai population,and the above differences were statistically significant(P<0.05).Discriminant functions developed using both the full model and stepwise method were statistically significant,demonstrating high accuracy and stability.The correct discrimination rates were higher in the male population than that in the female population.When distinguishing between Muay Thai professional fighters and the general Thai population,the optimal 2D∶4D threshold for males is 0.951,and for females,it was 0.960.Conclusion The discriminant model of Muay Thai professional players and ordinary people based on the ratios of finger length can provide important reference for the selection of Muay Thai athletes.
7.Guideline for Adult Weight Management in China
Weiqing WANG ; Qin WAN ; Jianhua MA ; Guang WANG ; Yufan WANG ; Guixia WANG ; Yongquan SHI ; Tingjun YE ; Xiaoguang SHI ; Jian KUANG ; Bo FENG ; Xiuyan FENG ; Guang NING ; Yiming MU ; Hongyu KUANG ; Xiaoping XING ; Chunli PIAO ; Xingbo CHENG ; Zhifeng CHENG ; Yufang BI ; Yan BI ; Wenshan LYU ; Dalong ZHU ; Cuiyan ZHU ; Wei ZHU ; Fei HUA ; Fei XIANG ; Shuang YAN ; Zilin SUN ; Yadong SUN ; Liqin SUN ; Luying SUN ; Li YAN ; Yanbing LI ; Hong LI ; Shu LI ; Ling LI ; Yiming LI ; Chenzhong LI ; Hua YANG ; Jinkui YANG ; Ling YANG ; Ying YANG ; Tao YANG ; Xiao YANG ; Xinhua XIAO ; Dan WU ; Jinsong KUANG ; Lanjie HE ; Wei GU ; Jie SHEN ; Yongfeng SONG ; Qiao ZHANG ; Hong ZHANG ; Yuwei ZHANG ; Junqing ZHANG ; Xianfeng ZHANG ; Miao ZHANG ; Yifei ZHANG ; Yingli LU ; Hong CHEN ; Li CHEN ; Bing CHEN ; Shihong CHEN ; Guiyan CHEN ; Haibing CHEN ; Lei CHEN ; Yanyan CHEN ; Genben CHEN ; Yikun ZHOU ; Xianghai ZHOU ; Qiang ZHOU ; Jiaqiang ZHOU ; Hongting ZHENG ; Zhongyan SHAN ; Jiajun ZHAO ; Dong ZHAO ; Ji HU ; Jiang HU ; Xinguo HOU ; Bimin SHI ; Tianpei HONG ; Mingxia YUAN ; Weibo XIA ; Xuejiang GU ; Yong XU ; Shuguang PANG ; Tianshu GAO ; Zuhua GAO ; Xiaohui GUO ; Hongyi CAO ; Mingfeng CAO ; Xiaopei CAO ; Jing MA ; Bin LU ; Zhen LIANG ; Jun LIANG ; Min LONG ; Yongde PENG ; Jin LU ; Hongyun LU ; Yan LU ; Chunping ZENG ; Binhong WEN ; Xueyong LOU ; Qingbo GUAN ; Lin LIAO ; Xin LIAO ; Ping XIONG ; Yaoming XUE
Chinese Journal of Endocrinology and Metabolism 2025;41(11):891-907
Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.
8.Imaging guided percutaneous microwave ablation for unresectable pancreatic cancer:A multicenter retrospective study
Shuilian TAN ; Jie ZHOU ; Ping LIANG ; Xiaoling YU ; Xin YE ; Gang DONG ; Xiang JING ; Guanghui HUANG ; Zhen WANG ; Mengfan PENG ; Yan ZHOU ; Jie YU ; Zhiyu HAN ; Fangyi LIU ; Hongjian GAO ; Yubo ZHANG ; Zhigang CHENG
Chinese Journal of Medical Imaging Technology 2025;41(7):1109-1112
Objective To explore the feasibility and safety of ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer.Methods Totally 84 patients who underwent ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer were enrolled,and the technical success rate,complete ablation rate,complication rate,pain relief rate and survival time,etc.were observed.Results The median age of 84 cases was 61.5 years.Totally 86 tumors,including 44.19%(38/86)at the head/neck and 55.81%(48/86)at the body/tail of pancreas were detected,and a total of 85 ablation sessions were performed with the median ablation energy applied per tumor of 9.90(1.08,21.60)kJ and the complete ablation rate of 42.86%(36/84).The technical success rate was 100%(85/85).Thirty-nine complication events occurred in 25 cases,no ablation-related death.Among 34 patients underwent ablation mainly for pain symptoms,the pain score decreased from(6.22±1.12)points before treatment to(1.94±1.64)points after treatment(P<0.001).During 6.8(3.3,12.9)months' follow-up,the mean survival time was(8.5±6.7)months,and all 47 patients died due to tumor progression.Conclusion Ultrasound-guided percutaneous microwave ablation was safe and feasible for unresectable pancreatic cancer.
9.Mechanism of baicalin combined with heat stimulation in treating acute lymphoblastic leukemia based on network pharmacology and in vitro experimental verification
Zi-ru LIU ; Zhu-yun SUN ; Ping-liang GE ; Ran SHI ; Xiao-yun LIU ; Dong-xue YE ; Guo-ying ZHANG ; Rong RONG ; Yong YANG
Chinese Pharmacological Bulletin 2025;41(6):1167-1176
Aim To explore the mechanism of baicalin combined with heat stimulation in treating acute lym-phoblastic leukemia(ALL)based on network pharma-cology and in vitro experiments.Methods The CCK-8 assay was used to screen the suitable conditions for heat stimulation to interfere ALL cell lines Jurkat,CCRF-CEM,Hut-78 and a normal lymphocyte HMy2.CIR,and the effects of baicalin combined with heat stimulation on the proliferation of three ALL cell lines and a normal lymphocyte were tested.The key targets of baicalin combined with fever stimulation for the treatment of ALL were obtained based on network phar-macological analysis,and the potential mechanisms were predicted by gene ontology(GO)annotation and kyoto encyclopedia of genes and genomes(KEGG)en-richment.The expression levels of TNF-α,AKT1,TYMS and CASP3 mRNA in ALL cell lines Jurkat and CCRF-CEM were examined by RT-qPCR with baicalin alone and baicalin combined with heat stimulation.Results The optimal conditions for heat stimulation to intervene ALL cells were 41 ℃ for 24 h,and heat stimulation combined with baicalin synergistically inhibited the growth of ALL cell lines and effectively reduced the cy-totoxicity of baicalin.Based on the network pharmaco-logical analysis,55 intersecting targets of baicalin with ALL diseases and 77 intersecting targets of baicalin with fever were obtained.The results of GO annotation and KEGG enrichment suggested that baicalin com-bined with fever stimulation to intervene ALL might be associated with influencing intracellular reactive oxygen species metabolism,DNA transcription and apoptotic processes involved in cysteine enzymes.Apoptosis,TNF and IL-17 signaling pathways were the key pathways for baicalin combined with heat stimulation in treating ALL.Under heat stimulation at 41 ℃ using SDHA gene as housekeeping gene,in vitro experiments showed that baicalin significantly up-regulated the expression of TNF-α and CASP3,and down-regulated the expression of TYMS in ALL cells.Conclusions Based on net-work pharmacologic analyses and in vitro experiments,baicalin combined with heat stimulation can regulate TNF-α and CASP3 gene levels in ALL cells and de-stroy cellular structure to promote cell apoptosis,thus synergistically treating ALL.
10.Research on the Application of TaqMan-MGB Probe Method in Detecting MTHFR Gene Polymorphisms
Hong-xuan LIANG ; Liang-hui CHEN ; Xuan-yi ZHENG ; Qiong-lu HUANG ; Kang ZHANG ; Qiu-ping YE ; Ya-qun LIU
Progress in Modern Biomedicine 2025;25(16):2598-2607
Objective:To establish a TaqMan-MGB probe-based method for detecting the polymorphic loci C677T and A1298C of the MTHFR gene.Methods:Specific primers and TaqMan-MGB probes targeting the C677T and A1298C polymorphic loci of the MTHFR gene were designed and optimized based on the gene sequence information.A real-time quantitative PCR detection system was established.Gradient dilution experiments were conducted to determine the limit of detection,and reproducibility experiments were performed to evaluate detection consistency.Specificity was validated using wild-type and mutant plasmid templates.The method was applied to detect 56 clinical samples,and its accuracy and practicality were assessed through comparison with traditional Sanger sequencing.Results:The TaqMan-MGB probe method demonstrated high specificity for detecting the C677T and A1298C loci,with no cross-reactivity between wild-type and mutant probes,enabling accurate genotype differentiation.Sensitivity experiments revealed detection limits of 1.13 × 103 copies/μL for C677T and 8.39 × 101 copies/μL for A1298C.Reproducibility experiments showed coefficients of variation below 1%,indicating stable and reliable results.Among the 56 clinical samples,the overall detection rate for the C677T locus was 86.99%,and for the A1298C locus,it was 97.92%.The TaqMan-MGB method exhibited good concordance with Sanger sequencing results.Conclusion:The TaqMan-MGB method exhibits high specificity,sensitivity,and excellent reproducibility in detecting the polymorphic loci C677T and A1298C of the MTHFR gene,making it suitable for rapid detection in large-scale clinical samples.This method provides an effective molecular diagnostic tool for the early diagnosis and prevention of folate-related diseases.

Result Analysis
Print
Save
E-mail