1.Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury (version 2025)
Aijun XU ; Shuixia LI ; Bo CHEN ; Mengyuan YE ; Lejiao LANG ; Ning NING ; Lin ZHANG ; Changqing LIU ; Zhonglan CHEN ; Weihu MA ; Weishi LI ; Xiaoning WANG ; Dongmei BIAN ; Jiancheng ZENG ; Xin WANG ; Yuan GAO ; Yaping CHEN ; Jiali CHEN ; Yun HAN ; Xiuting LI ; Yang ZHOU ; Xiaojing SU ; Qiong ZHANG ; Tianwen HUANG ; Ping ZHANG ; Hua LIN ; Xingling XIAO ; Ruifeng XU ; Fanghui DONG ; Bing HAN ; Luo FAN ; Yanling PEI ; Suyun LI ; Xiaoju TAN ; Rongchen GUO ; Yefang ZOU ; Xiaoyun HAN ; Junqin DING ; Yi WANG ; Shuhua DENG ; Jinli GUO ; Yinhua LIANG ; Yuan CEN ; Xiaoqin LIU ; Junru CHEN ; Haiyang YU ; Lunlan LI ; Ying REN ; Yunxia LI ; Jianli LU ; Ying YING ; Lan WEI ; Yin WANG ; Qinhong XU ; Yanqin ZHANG ; Yang LYU ; Shijun ZHANG ; Sui WENJIE ; Sanlian HU ; Shuhong YANG ; Guoqing LI ; Jingjing AN ; Baorong HE ; Leling FENG
Chinese Journal of Trauma 2025;41(6):530-541
Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.
2.Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey.
Xiao-Chao LUO ; Jia-Li LIU ; Ming-Hong YAO ; Ye-Meng CHEN ; Arthur Yin FAN ; Fan-Rong LIANG ; Ji-Ping ZHAO ; Ling ZHAO ; Xu ZHOU ; Xiao-Ying ZHONG ; Jia-Hui YANG ; Bo LI ; Ying ZHANG ; Xin SUN ; Ling LI
Journal of Integrative Medicine 2025;23(6):630-640
BACKGROUND:
The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment.
OBJECTIVE:
This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects.
SEARCH STRATEGY:
PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022.
INCLUSION CRITERIA:
RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment.
DATA EXTRACTION AND ANALYSIS:
The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES.
RESULTS:
This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs.
CONCLUSION
The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods*
;
Humans
;
Randomized Controlled Trials as Topic
;
Placebo Effect
;
Placebos
;
Treatment Outcome
3.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Comparison of efficacy and safety of crisaborole ointment 2% versus pimecrolimus cream 1% in the treatment of mild to moderate atopic dermatitis in children: a multicenter, randomized, controlled clinical trial
Xing XIAO ; Shan WANG ; Huan YANG ; Hong SHU ; Yanping GUO ; Jinping CHEN ; Yao LU ; Qinfeng LI ; Yuan LIANG ; Mutong ZHAO ; Xiaoyan LUO ; Limin MIAO ; Rui XU ; Xuemei LI ; Sha LAI ; Jianhong LI ; Zhen LUO ; Lu YU ; Lu XING ; Meitan WANG ; Xiaoli LI ; Haitao XU ; Ping LI ; Hua WANG ; Lin MA
Chinese Journal of Dermatology 2025;58(5):425-430
Objective:To compare the efficacy and safety of crisaborole ointment 2% versus pimecrolimus cream 1% in the treatment of mild to moderate atopic dermatitis in children aged 2 years or older.Methods:A multicenter, randomized, open-label, controlled clinical trial was conducted. A total of 120 pediatric patients aged 2 - 17 years with mild to moderate atopic dermatitis were enrolled from departments of dermatology of 8 hospitals in China between March 2022 and February 2023. The participants were randomly assigned in a 1∶1 ratio to the crisaborole group and the pimecrolimus group, and received the treatment with crisaborole ointment 2% and pimecrolimus cream 1% respectively, twice a day for 4 weeks. Visits were scheduled at baseline/on day 1, as well as on days 8, 15, and 29. The primary efficacy outcome was the percentage of patients achieving the Investigator's Static Global Assessment (ISGA) success (defined as clear [0] or almost clear [1] on the ISGA scale, combined with ≥ 2‐grade improvement from baseline) on day 29. The secondary efficacy outcomes included changes in the Eczema Area and Severity Index (EASI) total scores from baseline to day 29, percentages of patients achieving ISGA improvement (defined as clear [0] or almost clear [1] on the ISGA scale), as well as changes in the Peak Pruritus Numerical Rating Scale (NRS) scores, Dermatology Life Quality Index (DLQI) /Infants' Dermatology Life Quality Index (IDLQI) /Children's Dermatology Life Quality Index (CDLQI) scores, and in the Dermatitis Family Impact (DFI) scores. Drug safety was evaluated according to the incidence of adverse events. Categorical data were compared using the chi-square test. Since measurement data did not follow a normal distribution, the rank sum test was used for comparisons of measurement data between groups.Results:A total of 106 children with mild to moderate atopic dermatitis were included in the per-protocol analysis set, with 52 in the crisaborole group (26 males and 26 females) and 54 in the pimecrolimus group (27 males and 27 females). There were no significant differences in age, disease duration, ISGA and EASI scores at baseline between the two groups (all P > 0.05). On day 29, 22 patients (42.31%) in the crisaborole group and 25 (46.30%) in the pimecrolimus group achieved ISGA success, with no significant difference between the two groups ( χ2 = 0.17, P = 0.68) ; 35 patients (67.31%) in the crisaborole group and 45 (83.33%) in the pimecrolimus group achieved ISGA improvement, also with no significant difference between the two groups ( χ2 = 3.68, P = 0.06) ; additionally, there were no significant differences in the EASI, pruritus NRS, DLQI/IDLQI/CDLQI, or DFI scores between the two groups (all P > 0.05). Adverse reactions to the two topical agents were mainly local reactions such as mild to moderate pain, itching, or worsening of itching, and no obvious systemic adverse reactions occurred. The incidence of drug-related adverse reactions was 46.15% (24 cases) in the crisaborole group and 37.04% (20 cases) in the pimecrolimus group, with no significant difference between the two groups ( χ2 = 0.91, P = 0.34) . Conclusion:The efficacy of crisaborole ointment 2% was comparable to that of pimecrolimus cream 1% in the treatment of mild to moderate atopic dermatitis in children aged ≥ 2 years, and it yielded early and rapid improvement in the quality of life of patients and their families, with good safety and tolerability profiles.
6.Establishment of a database for liver cancer ablation and its clinical research value
Yanchun LUO ; Manlin LANG ; Ping LIANG ; Jie YU
Chinese Journal of Hepatology 2025;33(7):709-714
The liver cancer ablation specialized disease database is an important tool for interventional practitioners to collect data and conduct scientific research for patients. This article will exemplify the application of a database for liver cancer ablation based on the establishment of a standardized structured disease database so as to elaborate its application in clinical and scientific research. The goal is to improve the management level of ablation data through the construction of specialized disease databases, providing a reference for clinical doctors and researchers in building ablation databases, and promoting the application of specialized disease databases in clinical research.
7.Analysis of factors influencing frequent episodes in children with moderate-to-severe atopic dermatitis: a national multicenter cross-sectional study
Jing TIAN ; Yifeng GUO ; Xiaoyan LUO ; Yuan LIANG ; Ping LI ; Jinping CHEN ; Yao LU ; Jianping TANG ; Yunsheng LIANG ; Ying GAO ; Qiufang QIAN ; Hong SHU ; Hongxiang CHEN ; Pingshen FAN ; Xiuping HAN ; Hua QIAN ; Qinfeng LI ; Ming LI ; Shengchun WANG ; Ying LIU ; Hua WANG ; Lin MA
Chinese Journal of Dermatology 2025;58(10):943-951
Objective:To investigate factors influencing frequent episodes (≥ 4 episodes within 1 year) in children with moderate-to-severe atopic dermatitis (AD) in China.Methods:A national multicenter cross-sectional study was conducted. Patients under the age of 18 years diagnosed with moderate-to-severe AD were enrolled at dermatology clinics in 18 medical institutions across 12 provinces and municipalities in China between June 12 and August 8, 2023. At the time of the visit, their guardians completed a structured questionnaire covering demographic characteristics, clinical features of AD, personal and family history, factors associated with frequent episodes of moderate-to-severe AD, compliance with treatment, and disease awareness. Statistical analyses included t tests, one-way analysis of variance, rank-sum tests, and chi-square tests, with multiple-response analysis applied for multiple-choice questions. Results:A total of 965 valid questionnaires were collected, and 965 children with moderate-to-severe AD were included. Among them, there were 531 males and 434 females, 678 (70.3%) were aged 2 - < 12 years, 837 (86.7%) were from urban areas, the age at onset was 2.47 ± 3.03 years, and the median frequency of AD episodes in the past year was 4 times. These children were divided into 2 groups based on the median episode frequency: < 4-episode group (439 cases, 45.5%) and ≥ 4-episode group (526 cases, 54.5%). Compared with the < 4-episode group, children in the ≥ 4-episode group showed younger ages at onset (2.22 ± 2.98 years vs. 2.76 ± 3.06 years, P = 0.006) and higher proportions of patients with comorbid allergic diseases in both the children themselves (82.9% [436/526] vs. 69.7% [306/439], χ2 = 23.42, P < 0.001) and their relatives (66.0% [347/526] vs. 57.4% [252/439], χ2 = 7.46, P = 0.006). Children in the ≥ 4- episode group also had higher monthly usage of moisturizers (150 [30, 300] g vs. 60 [6, 200] g) and daily frequency of moisturizer use, greater disease awareness, but more severe fear of medication use (all P < 0.05). The region and the human development index level were both significantly associated with the episode frequency (both P < 0.001), with the highest proportion of children from South China in the ≥ 4- episode group (36.3%, 191/526). Children in the ≥ 4-episode group also had a longer duration of topical glucocorticoid use than those in the < 4-episode group ( Z = -2.21, P = 0.027). External triggers associated with AD episodes mainly included heat exposure (50.36%, 486/965), hot water bathing (40.73%, 393/965), seafood (23.52%, 227/965), and dust mites (33.37%, 322/965) . Conclusion:In children with moderate-to-severe AD in China, factors influencing frequent episodes may include residence in southern or economically developed regions, earlier age at onset, having a personal or family history of allergic diseases, and fear of medication use.
8.Comparison of efficacy and safety of crisaborole ointment 2% versus pimecrolimus cream 1% in the treatment of mild to moderate atopic dermatitis in children: a multicenter, randomized, controlled clinical trial
Xing XIAO ; Shan WANG ; Huan YANG ; Hong SHU ; Yanping GUO ; Jinping CHEN ; Yao LU ; Qinfeng LI ; Yuan LIANG ; Mutong ZHAO ; Xiaoyan LUO ; Limin MIAO ; Rui XU ; Xuemei LI ; Sha LAI ; Jianhong LI ; Zhen LUO ; Lu YU ; Lu XING ; Meitan WANG ; Xiaoli LI ; Haitao XU ; Ping LI ; Hua WANG ; Lin MA
Chinese Journal of Dermatology 2025;58(5):425-430
Objective:To compare the efficacy and safety of crisaborole ointment 2% versus pimecrolimus cream 1% in the treatment of mild to moderate atopic dermatitis in children aged 2 years or older.Methods:A multicenter, randomized, open-label, controlled clinical trial was conducted. A total of 120 pediatric patients aged 2 - 17 years with mild to moderate atopic dermatitis were enrolled from departments of dermatology of 8 hospitals in China between March 2022 and February 2023. The participants were randomly assigned in a 1∶1 ratio to the crisaborole group and the pimecrolimus group, and received the treatment with crisaborole ointment 2% and pimecrolimus cream 1% respectively, twice a day for 4 weeks. Visits were scheduled at baseline/on day 1, as well as on days 8, 15, and 29. The primary efficacy outcome was the percentage of patients achieving the Investigator's Static Global Assessment (ISGA) success (defined as clear [0] or almost clear [1] on the ISGA scale, combined with ≥ 2‐grade improvement from baseline) on day 29. The secondary efficacy outcomes included changes in the Eczema Area and Severity Index (EASI) total scores from baseline to day 29, percentages of patients achieving ISGA improvement (defined as clear [0] or almost clear [1] on the ISGA scale), as well as changes in the Peak Pruritus Numerical Rating Scale (NRS) scores, Dermatology Life Quality Index (DLQI) /Infants' Dermatology Life Quality Index (IDLQI) /Children's Dermatology Life Quality Index (CDLQI) scores, and in the Dermatitis Family Impact (DFI) scores. Drug safety was evaluated according to the incidence of adverse events. Categorical data were compared using the chi-square test. Since measurement data did not follow a normal distribution, the rank sum test was used for comparisons of measurement data between groups.Results:A total of 106 children with mild to moderate atopic dermatitis were included in the per-protocol analysis set, with 52 in the crisaborole group (26 males and 26 females) and 54 in the pimecrolimus group (27 males and 27 females). There were no significant differences in age, disease duration, ISGA and EASI scores at baseline between the two groups (all P > 0.05). On day 29, 22 patients (42.31%) in the crisaborole group and 25 (46.30%) in the pimecrolimus group achieved ISGA success, with no significant difference between the two groups ( χ2 = 0.17, P = 0.68) ; 35 patients (67.31%) in the crisaborole group and 45 (83.33%) in the pimecrolimus group achieved ISGA improvement, also with no significant difference between the two groups ( χ2 = 3.68, P = 0.06) ; additionally, there were no significant differences in the EASI, pruritus NRS, DLQI/IDLQI/CDLQI, or DFI scores between the two groups (all P > 0.05). Adverse reactions to the two topical agents were mainly local reactions such as mild to moderate pain, itching, or worsening of itching, and no obvious systemic adverse reactions occurred. The incidence of drug-related adverse reactions was 46.15% (24 cases) in the crisaborole group and 37.04% (20 cases) in the pimecrolimus group, with no significant difference between the two groups ( χ2 = 0.91, P = 0.34) . Conclusion:The efficacy of crisaborole ointment 2% was comparable to that of pimecrolimus cream 1% in the treatment of mild to moderate atopic dermatitis in children aged ≥ 2 years, and it yielded early and rapid improvement in the quality of life of patients and their families, with good safety and tolerability profiles.
9.Analysis of factors influencing frequent episodes in children with moderate-to-severe atopic dermatitis: a national multicenter cross-sectional study
Jing TIAN ; Yifeng GUO ; Xiaoyan LUO ; Yuan LIANG ; Ping LI ; Jinping CHEN ; Yao LU ; Jianping TANG ; Yunsheng LIANG ; Ying GAO ; Qiufang QIAN ; Hong SHU ; Hongxiang CHEN ; Pingshen FAN ; Xiuping HAN ; Hua QIAN ; Qinfeng LI ; Ming LI ; Shengchun WANG ; Ying LIU ; Hua WANG ; Lin MA
Chinese Journal of Dermatology 2025;58(10):943-951
Objective:To investigate factors influencing frequent episodes (≥ 4 episodes within 1 year) in children with moderate-to-severe atopic dermatitis (AD) in China.Methods:A national multicenter cross-sectional study was conducted. Patients under the age of 18 years diagnosed with moderate-to-severe AD were enrolled at dermatology clinics in 18 medical institutions across 12 provinces and municipalities in China between June 12 and August 8, 2023. At the time of the visit, their guardians completed a structured questionnaire covering demographic characteristics, clinical features of AD, personal and family history, factors associated with frequent episodes of moderate-to-severe AD, compliance with treatment, and disease awareness. Statistical analyses included t tests, one-way analysis of variance, rank-sum tests, and chi-square tests, with multiple-response analysis applied for multiple-choice questions. Results:A total of 965 valid questionnaires were collected, and 965 children with moderate-to-severe AD were included. Among them, there were 531 males and 434 females, 678 (70.3%) were aged 2 - < 12 years, 837 (86.7%) were from urban areas, the age at onset was 2.47 ± 3.03 years, and the median frequency of AD episodes in the past year was 4 times. These children were divided into 2 groups based on the median episode frequency: < 4-episode group (439 cases, 45.5%) and ≥ 4-episode group (526 cases, 54.5%). Compared with the < 4-episode group, children in the ≥ 4-episode group showed younger ages at onset (2.22 ± 2.98 years vs. 2.76 ± 3.06 years, P = 0.006) and higher proportions of patients with comorbid allergic diseases in both the children themselves (82.9% [436/526] vs. 69.7% [306/439], χ2 = 23.42, P < 0.001) and their relatives (66.0% [347/526] vs. 57.4% [252/439], χ2 = 7.46, P = 0.006). Children in the ≥ 4- episode group also had higher monthly usage of moisturizers (150 [30, 300] g vs. 60 [6, 200] g) and daily frequency of moisturizer use, greater disease awareness, but more severe fear of medication use (all P < 0.05). The region and the human development index level were both significantly associated with the episode frequency (both P < 0.001), with the highest proportion of children from South China in the ≥ 4- episode group (36.3%, 191/526). Children in the ≥ 4-episode group also had a longer duration of topical glucocorticoid use than those in the < 4-episode group ( Z = -2.21, P = 0.027). External triggers associated with AD episodes mainly included heat exposure (50.36%, 486/965), hot water bathing (40.73%, 393/965), seafood (23.52%, 227/965), and dust mites (33.37%, 322/965) . Conclusion:In children with moderate-to-severe AD in China, factors influencing frequent episodes may include residence in southern or economically developed regions, earlier age at onset, having a personal or family history of allergic diseases, and fear of medication use.
10.Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury (version 2025)
Aijun XU ; Shuixia LI ; Bo CHEN ; Mengyuan YE ; Lejiao LANG ; Ning NING ; Lin ZHANG ; Changqing LIU ; Zhonglan CHEN ; Weihu MA ; Weishi LI ; Xiaoning WANG ; Dongmei BIAN ; Jiancheng ZENG ; Xin WANG ; Yuan GAO ; Yaping CHEN ; Jiali CHEN ; Yun HAN ; Xiuting LI ; Yang ZHOU ; Xiaojing SU ; Qiong ZHANG ; Tianwen HUANG ; Ping ZHANG ; Hua LIN ; Xingling XIAO ; Ruifeng XU ; Fanghui DONG ; Bing HAN ; Luo FAN ; Yanling PEI ; Suyun LI ; Xiaoju TAN ; Rongchen GUO ; Yefang ZOU ; Xiaoyun HAN ; Junqin DING ; Yi WANG ; Shuhua DENG ; Jinli GUO ; Yinhua LIANG ; Yuan CEN ; Xiaoqin LIU ; Junru CHEN ; Haiyang YU ; Lunlan LI ; Ying REN ; Yunxia LI ; Jianli LU ; Ying YING ; Lan WEI ; Yin WANG ; Qinhong XU ; Yanqin ZHANG ; Yang LYU ; Shijun ZHANG ; Sui WENJIE ; Sanlian HU ; Shuhong YANG ; Guoqing LI ; Jingjing AN ; Baorong HE ; Leling FENG
Chinese Journal of Trauma 2025;41(6):530-541
Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.

Result Analysis
Print
Save
E-mail