1.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey.
Xiao-Chao LUO ; Jia-Li LIU ; Ming-Hong YAO ; Ye-Meng CHEN ; Arthur Yin FAN ; Fan-Rong LIANG ; Ji-Ping ZHAO ; Ling ZHAO ; Xu ZHOU ; Xiao-Ying ZHONG ; Jia-Hui YANG ; Bo LI ; Ying ZHANG ; Xin SUN ; Ling LI
Journal of Integrative Medicine 2025;23(6):630-640
BACKGROUND:
The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment.
OBJECTIVE:
This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects.
SEARCH STRATEGY:
PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022.
INCLUSION CRITERIA:
RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment.
DATA EXTRACTION AND ANALYSIS:
The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES.
RESULTS:
This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs.
CONCLUSION
The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods*
;
Humans
;
Randomized Controlled Trials as Topic
;
Placebo Effect
;
Placebos
;
Treatment Outcome
4.Efficacy and mechanisms of an Angelica sinensis Cistanche Fiber Compound for constipation relief
Yang LIU ; Ya-li SHI ; Yan-ping WU ; Xiang LUO ; Lei LIANG ; Rong-rong HE
Acta Pharmaceutica Sinica 2024;59(5):1238-1244
Constipation is a prevalent ailment which might significantly impact the quality of people's life and rise some associated deseases risks. In this study, a chronic constipation mouse model was established using loperamide hydrochloride. Mice were gavaged an
5.Analysis of the efficacy and safety of percutaneous microwave ablation in the treatment of hepatocellular carcinoma in patients over 60 years old with comorbidities
Liting HE ; Ting LUO ; Qiaowei DU ; Zhen WANG ; Qian CAI ; Jie YU ; Ping LIANG
Chinese Journal of Ultrasonography 2024;33(3):201-208
Objective:To explore the survival prognosis of hepatocellular carcinoma patients over 60 years old with comorbidities treated with microwave ablation.Methods:A retrospective analysis of 267 patients with hepatocellular carcinoma aged 60 years or older admitted to the PLA General Hospital from April 2012 to September 2022 were analyzed, including 179 patients with preoperative comorbidities and 88 patients without comorbidities. The overall survival (OS) and progression-free survival (PFS) of the two groups were compared by the Log-rank test, and the Cox proportional hazards regression model was used to evaluate ablation-related risk factors.Results:A total of 267 patients were included (comorbidity group, n=179; no comorbidity group, n=88). There were no statistical differences in OS and PFS between the two groups (all P>0.05). Multivariate Cox regression analysis showed that comorbidities were not risk factors that affected the survival prognosis (OS and PFS) of patients with hepatocellular carcinoma after microwave ablation ( P>0.05). Total bilirubin (hazard ratio 0.356, 95% CI=0.174-0.731, P=0.005) was a risk factor affecting OS; tumor number (hazard ratio 0.538, 95% CI=0.365-0.793, P=0.002) and international coagulation normalized ratio (hazard ratio 1.022, 95% CI=1.001-1.043, P=0.040) were risk factors affecting PFS. Subgroup analysis showed that patients with a maximum diameter of >3 cm and female patients, the OS of the comorbidity group was significantly lower than that of the non-comorbidity group( P<0.05). Conclusions:Microwave ablation therapy remains an effective treatment modality in hepatocellular carcinoma patients over 60 years of age with comorbidities, and its survival prognosis is not inferior to patients with hepatocellular carcinoma without comorbidities.
6.Curative effect of percutaneous microwave ablation therapy on hepatocellular carcinoma survival: a 15-year real-world study
Yanchun LUO ; Manlin LANG ; Wenjia CAI ; Zhiyu HAN ; Fangyi LIU ; Zhigang CHENG ; Xiaoling YU ; Jianping DOU ; Xin LI ; Shuilian TAN ; Xuejuan DONG ; Ping LIANG ; Jie YU
Chinese Journal of Hepatology 2024;32(4):332-339
Objective:To evaluate the long-term efficacy of percutaneous microwave ablation (MWA) therapy for hepatocellular carcinoma.Methods:2054 cases with Barcelona Clinic Liver Cancer (BCLC) stage 0~B at the Fifth Medical Center of the Chinese People's Liberation Army General Hospital from January 2006 to September 2020 were retrospectively collected. All patients were followed up for at least 2 years. The primary endpoint of overall survival and secondary endpoints (tumor-related survival, disease-free survival, and postoperative complications) of patients treated with ultrasound-guided percutaneous MWA were analyzed. Kaplan-Meier method was used for stratified survival rate analysis. Fine-and-Gray competing risk model was used to analyze overall survival.Results:A total of 5 503 HCC nodules [mean tumor diameter (2.6±1.6) cm] underwent 3 908 MWAs between January 2006 and September 2020, with a median follow-up time of 45.6 (24.0 -79.2) months.The technical effectiveness rate of 5 375 tumor nodules was 97.5%. The overall survival rates at 5, 10, and 15-years were 61.6%, 38.8%, and 27.0%, respectively. The tumor-specific survival rates were 67.1%, 47.2%, and 37.7%, respectively. The free tumor survival rates were 25.8%, 15.7%, and 9.9%, respectively. The incidence rate of severe complications was 2.8% (108/3 908). Further analysis showed that the technical effectiveness and survival rate over the passing three time periods from January 2006-2010, 2011-2015, and 2016-September 2020 were significantly increased, with P ?0.001, especially for liver cancer 3.1~5.0 cm ( P ?0.001). Conclusion:Microwave ablation therapy is a safe and effective method for BCLC stage 0-B, with significantly enhanced technical efficacy and survival rate over time.
7.Interventional effect of bone marrow mesenchymal stem cell transplantation with different doses of X-ray irradiation induced hepatic injury in mice
Yue LIANG ; Lan LUO ; Tianyu CHENG ; Gaofeng CHEN ; Wei LIU ; Yongping MU ; Jiamei CHEN ; Ping LIU
Chinese Journal of Hepatology 2024;32(11):1019-1027
Objective:To investigate the interventional effect of bone marrow mesenchymal stem cell (BMMSC) transplantation with different doses of X-ray irradiation induced hepatic injury in mice.Methods:Eighteen female C57BL/6J mice were randomly divided into 0, 2, and 3 Gy irradiation groups and 0, 2, and 3 Gy transplantation groups. The irradiation group was used as the control and injected with an equal volume of culture medium. The mice in the transplantation group were irradiated with different doses of X-ray irradiation, and BMMSCs were intravenously infused into the bone marrow. The mice were sacrificed for sampling at the end of the 21st day. Mice body weight changes were recorded daily. The changes in the content of peripheral blood lymphocytes, red blood cells, platelets, and hemoglobin were detected by an automatic blood tester. The morphological changes in mice liver tissues were observed by hematoxylin-eosin staining. The serum activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were detected by a biochemical analyzer. The reduced glutathione contents in liver tissue were detected by the microplate method. The malondialdehyde content in liver tissue was detected by thiobarbituric acid. The content of total superoxide dismutase (T-SOD) in liver tissue was detected by the hydroxylamine method. The expression of the F4/80 protein in liver tissue was detected by the immunohistochemistry method. The protein expression of nuclear transcription factor erythroid 2 related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) in liver tissue was determined by the western blotting method. The mRNA expression of NLRP3, IL-6, and Nrf2 in liver tissue was detected by a real-time quantitative polymerase chain reaction. The multiple-group comparisons were analyzed by factorial analysis of variance. The inter-group comparisons were analyzed by the LSD method for statistical analysis.Results:The contents of peripheral blood lymphocytes, erythrocytes, platelets, and hemoglobin were significantly decreased in the 3 Gy irradiation group than the 0 Gy irradiation group ( P<0.05), while the activities of serum ALT and AST were significantly increased ( P<0.05). The malondialdehyde content, F4/80 protein expression level, nucleotide-binding domain and leucine-rich repeats, nucleotide oligomerization domain-like receptor family, pyrin domain containing 3 (NLRP3), and interleukin 6 mRNA expression levels were significantly increased in liver tissue, while the contents of T-SOD and glutathione, Nrf2 and HO-1 protein expression levels, and Nrf2 mRNA expression level in liver tissue were significantly decreased ( P<0.05). The contents of peripheral blood lymphocytes, red blood cells, platelets, and hemoglobin were significantly increased in the 3 Gy transplantation group than the 3 Gy irradiation group ( P<0.05), while the activities of serum ALT and AST were significantly decreased ( P<0.05). The malondialdehyde content, F4/80 protein expression level, NLRP3 and interleukin-6 mRNA expression levels in liver tissue were significantly decreased ( P<0.05), while the content of T-SOD and glutathione, Nrf2 and HO-1 protein expression levels, and Nrf2 mRNA expression level in liver tissue were significantly increased ( P<0.05). Conclusion:X-ray irradiation at a dose of 3 Gy can induce liver oxidative damage in mice. BMMSC transplantation can improve X-ray irradiation-induced liver oxidative damage in mice, and its mechanism of action may be related to the regulation of the Nrf2/HO-1 pathway.
8.Co-infection of Chlamydia pneumoniae and SARS-CoV-2 and its effect on the secretion of inflammatory cytokines
Jia-Yan LI ; Li-Ping YUAN ; Qing-Kai LUO ; Ye-Fei LEI ; Yuan LI ; Feng-Hua ZHANG ; Li-Xiu PENG ; Yu-Qi OUYANG ; Shi-Xing TANG ; Hong-Liang CHEN
Chinese Journal of Infection Control 2024;23(11):1391-1397
Objective To explore characteristics of co-infection of Chlamydia pneumoniae(Cpn)and severe acute respiratory syndrome coronavirus 2(SARS-CoV-2),and identify their effect on SARS-CoV-2-induced inflammatory response.Methods Patients with coronavirus disease 2019(COVID-19)who received treatment in a hospital in Chenzhou City from December 20,2022 to February 20,2023 were selected.According to the severity of COVID-19,severe and critical cases were classified as the severe symptom group,while mild and moderate cases were classified as the mild symptom group.Meanwhile,according to the age of patients(≥18 years old as adults,<18 years old as juveniles),they were divided into the adult severe symptom group,adult mild symptom group,juvenile severe symptom group,and juvenile mild symptom group.Propensity score was adopted to match age,gender,and under-lying diseases of patients in severe symptom and mild symptom group in a 1∶1 ratio.Bronchoalveolar lavage fluid(BALF),throat swabs,and serum specimens of patients were collected.Cpn IgG/IgM antibody was detected by enzyme-linked immunosorbent assay(ELISA),levels of 12 common cytokines(including interleukin-8[IL-8])in BALF were detected by flow cytometry,differences among groups were compared.Results A total of 102 patients were included,with 61 severe and critical(severe symptom)patients,as well as 41 mild and moderate(mild symp-tom)patients.There were 71 patients aged ≥18 years and 31 juvenile patients aged<18 years.There were 39 pa-tients in the adult severe symptom group and 32 in the adult mild symptom group,and 30 pairs were successfully matched through propensity score analysis.There were 22 patients in the juvenile severe symptom group and 9 in the juvenile mild symptom group,and 8 pairs were successfully matched through propensity score analysis.Among COVID-19 patients,the positive rates of Cpn IgG and IgM were 36.27%(n=37)and 8.82%(n=9),respective-ly,with 1 case positive for both Cpn IgG and IgM.The level of interferon(IFN)-α in serum specimens from adult patients with severe symptom combined with positive Cpn IgG was higher than that of IgG negative patients(P=0.037).There was no statistically significant difference in the levels of other cytokines in BALF and serum speci-mens between the two groups of patients(all P>0.05).The levels of IL-8 and IL-17 in serum specimens of patients with positive Cpn IgG in the adult mild symptom group were both higher than those in Cpn IgG negative patients(both P<0.05).The levels of IL-8 in both BALF and serum specimens from Cpn IgM positivity patients in the ju-venile mild symptom group were higher than those from patients with negative Cpn IgM(both P<0.05).Logistic regression analysis results showed that Cpn IgG and IgM positivity were not risk factors for the development of se-vere COVID-19.Conclusion Combined Cpn infection is not a risk factor for the development of severe symptom in COVID-19 patients,and Cpn infection has limited impact on the secretion of inflammatory factors caused by SARS-CoV-2.
9.Comparison on prognosis of hepatocellular carcinoma patients with hepatitis B and hepatitis C after microwave ablation
Luo WANG ; Jie YU ; Yanchun LUO ; Xiaoling YU ; Jing ZHANG ; Zhigang CHENG ; Zhiyu HAN ; Fangyi LIU ; Ping LIANG
Chinese Journal of Interventional Imaging and Therapy 2024;21(5):262-267
Objective To comparatively explore the prognosis of hepatocellular carcinoma(HCC)patients with hepatitis B(HB)and hepatitis C(HC)after microwave ablation(MWA).Methods Data of 159 HCC patients with HB(HB-HCC)and 159 HCC patients with HC(HC-HCC)who received MWA treatment were retrospectively collected.The oncologic outcomes were compared between groups,the causes of death were analyzed,and the risk factors of overall survival(OS)in HCC patients after MWA were observed.Results The OS rate in HC-HCC group was lower than that in HB-HCC group(P=0.045),while no significant difference of disease free survival rate(P=0.095)nor cancer specific survival rate(P=0.180)was found between groups.Compared with HB-HCC group,HC-HCC group had higher risk of death due to complications related to liver cirrhosis(HR=2.339,P=0.043).Child-Pugh class B(HR=3.082,P<0.001),hepatitis viral load>500 IU/ml(HR=1.654,P=0.006)and the maximum diameter of lesion≥3.0 cm(HR=1.541,P=0.017)were all independent risk factors of OS in HCC patients after MWA.Conclusion Compared with HB-HCC patients,HC-HCC patients had shorter OS after MWA.
10.Establishment of an indirect ELISA for detection of antibodies against Cysticercus pisiformis infection based on TPO18 protein
Zexiang WANG ; Yonglu LUO ; Ping XUE ; Liang CHE ; Yousen WANG ; Huitian GOU ; Xia-Olin SUN
Chinese Journal of Veterinary Science 2024;44(6):1213-1222
Cysticercosis,caused by the larval stage of the tapeworm Taenia pisiformis,known as Cysticercus pisiformis,is a parasitic ailment affecting lagomorphs,particularly domestic rabbits,posing a threat to the rabbit industry and the safety of rabbit meat products.This study aims to i-dentify the distribution of the TPO18 antigen in Cysticercus pisiformis and Taenia pisiformis and establish an indirect enzyme-linked immunosorbent assay(ELISA)for detecting antibodies against rabbit cysticercosis.The research involved the prokaryotic expression of the 18 kDa antigen of rabbit Cysticercus pisiformis and the isolation of soluble TPO18 protein post-purification.Immuni-zing rabbits with the TPO18 protein resulted in the production of polyclonal antibodies with a titer of up to 1∶51 200.Western blot analysis validated the antigenicity of the polyclonal antibodies a-gainst total proteins from rabbit Cysticercus pisiformis,Taenia pisiformis and the recombinant TPO18 protein.Immunohistochemistry revealed the distribution of the TPO18 antigen in rabbit Cysticercus pisiformis and Taenia pisiform is,indicating the effective reactivity of the polyclonal antibodies with total proteins from both parasites and the recombinant TPO18 protein.TPO18 an-tigen in rabbit Cysticercus pisiformis predominantly localized in the germinal layer and the paren-chyma,while in Taenia pisiformis,it was mainly present in the suckers,sucker peripheries,collec-ting duct upper cells,and parenchyma.An indirect ELISA based on the TPO18 antigen was devel-oped using the recombinant antigen,and its technical parameters were optimized.The optimized ELISA conditions included a serum dilution of 1∶100,antigen coating concentration of 5 mg/L,coating for 1 h at 37 ℃ followed by overnight incubation at 4 ℃,blocking with 1%BSA for 60 min at 37 ℃,serum reaction for 60 min,secondary antibody dilution at 1∶1 000,secondary antibody incubation for 60 min,substrate reacting for 15 min,with a cutoff value of 0.295.Sensitivity,speci-ficity,and repeatability tests of the ELISA demonstrated high sensitivity and specificity without cross-reactivity with positive sera of rabbit hemorrhagic disease virus,Hepatic coccidiosis,Eimer-ia stiedae,or Toxoplasma gondii.The intra-and inter-assay coefficients of variation were both less than 7%,indicating excellent repeatability.Application of this ELISA,compared to postmortem ex-amination,on 86 clinical serum samples showed a concordance rate of 97.7%.In conclusion,this study successfully established an indirect ELISA for detecting antibodies against rabbit Cysticercus pisiformis,presenting a novel monitoring approach for assessing rabbit infections with Cysticer-cus pisiformis.

Result Analysis
Print
Save
E-mail