1.Inverse distance weight interpolation method for missing data of PM2.5 spatiotemporal series
Yurou LIANG ; Hongling WU ; Weipeng WANG ; Feng CHENG ; Ping DUAN
Journal of Environmental and Occupational Medicine 2025;42(2):171-178
Background Fine particulate matter (PM2.5) monitoring stations may generate missing data for a certain period of time due to various factors. This data loss will adversely affect air quality assessment and pollution control decision-making. Objective To propose an inverse distance weighted (IDW) spatiotemporal interpolation method based on particle swarm optimization (PSO) to interpolate and fill missing PM2.5 spatiotemporal sequence data and increase interpolation accuracy. Methods An interpolation experiment was designed into two parts. The first part used hourly PM2.5 observational data from four moments on January 1, 2017 in the Yangtze River Delta region. The second part employed daily PM2.5 observational data from the first 10 d of January 2017 in the Beijing-Tianjin-Hebei region. Interpolation accuracy was evaluated using four metrics: root mean square error (RMSE), mean absolute error (MAE), mean absolute percentage error (MAPE), and mean relative error (MRE). Results IDW spatiotemporal interpolation method optimized with PSO significantly improved the accuracy of filling missing PM2.5 spatiotemporal sequence data. In the hourly-scale experiment conducted in the Yangtze River Delta region, compared to a distance index of 2, the accuracy metrics RMSE, MAE, MAPE, and MRE generated by the proposed method improved on average by 0.17 μg·m−3, 0.27 μg·m−3, 0.17%, and 0.01%, respectively. The PM2.5 spatial field maps generated for four moments based on this method clearly illustrated the spatiotemporal distribution characteristics of hourly PM2.5 concentrations in the Yangtze River Delta region. In the daily-scale experiment conducted in the Beijing-Tianjin-Hebei region, the PSO-optimized distance index outperformed the traditional method, with interpolation accuracy improvements of approximately 0.215 μg·m−3, 0.283 μg·m−3, 0.174%, and 0.014%, respectively. Furthermore, the seasonal PM2.5 spatial field maps generated by this method revealed the spatiotemporal distribution characteristics of PM2.5 concentrations in the Beijing-Tianjin-Hebei region across different seasons, further validating the effectiveness and applicability of this method. Conclusion The IDW spatiotemporal interpolation method optimized with PSO is highly accurate and reliable for interpolating the missing data in the Yangtze River Delta region and the Beijing-Tianjin-Hebei region, providing valuable insights for air pollution control and public health protection.
2.Identification of chemical components and determination of vitexin in the raw powder of Tongluo Shenggu capsule
Gelin WU ; Ruixin FAN ; Chuling LIANG ; Leng XING ; Yongjian XIE ; Ping GONG ; Peng ZHOU ; BO LI
Journal of China Pharmaceutical University 2025;56(2):166-175
The present study employed UPLC-MS/MS to analyze and identify compounds in the raw powder of Tongluo Shenggu capsules. An HPLC method for the determination of vitexin content was established. The analysis of this drug was performed on a 30 ℃ thermostatic Acquity UPLC® BEH C18 (2.1 mm×100 mm,1.7 μm) column, with the mobile phase comprising 0.2% formic acid-methanol flowing at 0.3 mL /min in a gradient elution manner. Mass spectrometry was detected by ESI sources in both positive and negative ion modes for qualitative identification of chemical constituents. 12 flavonoid and 3 stilbenes compounds in the raw powder of Tongluo Shenggu capsules were successfully identified. Additionally, an HPLC method for the determination of vitexin content was established using a XBridge C18 column (4.6 mm × 250 mm, 5 µm) with a mobile phase of 0.05% glacial acetic acid in methanol for gradient elution, at a column temperature of 30 °C, a flow rate of 1.0 mL/min, and an injection volume of 20 μL. The method demonstrated good linearity in the concentration range of 10 µg/mL to 40 µg/mL (R=1.000) with an average recovery rate of 96.7%. The establishment of these methods provides a scientific basis for the quality control and development of the raw powder of Tongluo Shenggu capsules.
3.Chinese expert consensus on integrated case management by a multidisciplinary team in CAR-T cell therapy for lymphoma.
Sanfang TU ; Ping LI ; Heng MEI ; Yang LIU ; Yongxian HU ; Peng LIU ; Dehui ZOU ; Ting NIU ; Kailin XU ; Li WANG ; Jianmin YANG ; Mingfeng ZHAO ; Xiaojun HUANG ; Jianxiang WANG ; Yu HU ; Weili ZHAO ; Depei WU ; Jun MA ; Wenbin QIAN ; Weidong HAN ; Yuhua LI ; Aibin LIANG
Chinese Medical Journal 2025;138(16):1894-1896
4.Correlation of IGF2 levels with sperm quality, inflammation, and DNA damage in infertile patients.
Jing-Gen WU ; Cai-Ping ZHOU ; Wei-Wei GUI ; Zhong-Yan LIANG ; Feng-Bin ZHANG ; Ying-Ge FU ; Rui LI ; Fang WU ; Xi-Hua LIN
Asian Journal of Andrology 2025;27(2):204-210
Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans
;
Male
;
Insulin-Like Growth Factor II/metabolism*
;
Infertility, Male/genetics*
;
DNA Damage
;
Adult
;
Inflammation/metabolism*
;
Spermatozoa/metabolism*
;
Semen Analysis
;
Semen/metabolism*
;
Tumor Necrosis Factor-alpha/metabolism*
;
Histones/metabolism*
;
Interleukin-1beta/metabolism*
5.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
6.Dural arteriovenous fistula in a neonate presenting with respiratory distress.
Yue DU ; Jing-Hua ZHANG ; Jun-Liang LI ; Zhou-Ping WANG ; Mei-Gui WU
Chinese Journal of Contemporary Pediatrics 2025;27(4):500-504
The patient, a 20-day-old male, was admitted due to respiratory distress that had persisted for 20 days after birth. The main clinical manifestations included gradually worsening respiratory distress and edema. The patient received treatment including mechanical ventilation and diuretics. Echocardiography indicated cardiomegaly, pulmonary hypertension, and heart failure. A comprehensive systemic examination revealed a significant blowing vascular murmur upon auscultation over the anterior fontanelle and bilateral temporal regions. Further imaging studies including cranial magnetic resonance imaging, magnetic resonance angiography, and magnetic resonance venography showed marked dilation of the superior sagittal sinus, transverse sinus, and sigmoid sinus, leading to a definitive diagnosis of dural arteriovenous fistula. After a multidisciplinary consultation, the patient underwent cerebral angiography and partial embolization of the left parietal arteriovenous fistula. Postoperatively, the patient was treated with positive inotropes, diuretics, and fluid restriction. Ultimately, the patient was weaned off the ventilator and discharged in improved condition. This article reports a case of neonatal dural arteriovenous fistula presenting with respiratory distress and discusses the multidisciplinary approach to managing this condition, which aids in early disease recognition and guides clinical decision-making.
Humans
;
Male
;
Infant, Newborn
;
Central Nervous System Vascular Malformations/diagnosis*
;
Respiratory Distress Syndrome, Newborn/etiology*
;
Embolization, Therapeutic
7.Nonsurgical Treatment of Chronic Subdural Hematoma Patients with Chinese Medicine: Case Report Series.
Kang-Ning LI ; Wei-Ming LIU ; Ying-Zhi HOU ; Run-Fa TIAN ; Shuo ZHANG ; Liang WU ; Long XU ; Jia-Ji QIU ; Yan-Ping TONG ; Tao YANG ; Yong-Ping FAN
Chinese journal of integrative medicine 2025;31(10):937-941
8.Psychological stress-activated NR3C1/NUPR1 axis promotes ovarian tumor metastasis.
Bin LIU ; Wen-Zhe DENG ; Wen-Hua HU ; Rong-Xi LU ; Qing-Yu ZHANG ; Chen-Feng GAO ; Xiao-Jie HUANG ; Wei-Guo LIAO ; Jin GAO ; Yang LIU ; Hiroshi KURIHARA ; Yi-Fang LI ; Xu-Hui ZHANG ; Yan-Ping WU ; Lei LIANG ; Rong-Rong HE
Acta Pharmaceutica Sinica B 2025;15(6):3149-3162
Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.
9.Does Prenatal SARS-CoV-2 Infection Exacerbate Postpartum Lower Urinary Tract Symptoms? A Multicenter Retrospective Cohort Study.
Yu Han LYU ; Min LI ; Hui Qing YAO ; Tian Zi GAI ; Lin LIANG ; Su PAN ; Ping Ping LI ; Ya Xin LIANG ; Yue YU ; Xiao Mei WU ; Min LI
Biomedical and Environmental Sciences 2025;38(9):1095-1104
OBJECTIVE:
Coronavirus disease 2019 (COVID-19) can result in fatigue and post-exertional malaise; however, whether severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection exacerbates lower urinary tract symptoms (LUTS) is unclear. This study investigated the association between prenatal SARS-CoV-2 infection and postpartum LUTS.
METHODS:
A multicenter, retrospective cohort study was conducted at two tertiary hospitals in China from November 1, 2022, to November 1, 2023. Participants were classified into infected and uninfected groups based on SARS-CoV-2 antigen results. LUTS prevalence and severity were assessed using self-reported symptoms and the Incontinence Impact Questionnaire-Short Form (IIQ-7). Pelvic floor muscle activity was measured using electromyography following the Glazer protocol. Group comparisons were performed to evaluate the association of SARS-CoV-2 infection with LUTS and electromyography parameters, with stratified analyses conducted using SPSS version 26.0.
RESULTS:
Among 3,652 participants (681 infected, 2,971 uninfected), no significant differences in LUTS prevalence or IIQ-7 scores were observed. However, SARS-CoV-2 infection was an independent factor influencing the electromyographic activity of the pelvic floor muscles (mean tonic contraction amplitudes), regardless of delivery mode ( P = 0.001).
CONCLUSION
Prenatal SARS-CoV-2 infection was not significantly associated with an increased risk of postpartum LUTS but independently altered pelvic floor muscle electromyographic activity, suggesting potential neuromuscular effects.
Humans
;
Female
;
COVID-19/epidemiology*
;
Retrospective Studies
;
Adult
;
Pregnancy
;
Lower Urinary Tract Symptoms/virology*
;
Postpartum Period
;
Pregnancy Complications, Infectious/virology*
;
China/epidemiology*
;
Electromyography
;
SARS-CoV-2/physiology*
;
Pelvic Floor/physiopathology*
;
Prevalence
10.Stability study of umbilical cord mesenchymal stem cells formulation in large-scale production
Wang-long CHU ; Tong-jing LI ; Yan SHANGGUAN ; Fang-tao HE ; Jian-fu WU ; Xiu-ping ZENG ; Tao GUO ; Qing-fang WANG ; Fen ZHANG ; Zhen-zhong ZHONG ; Xiao LIANG ; Jun-yuan HU ; Mu-yun LIU
Acta Pharmaceutica Sinica 2024;59(3):743-750
Umbilical cord mesenchymal stem cells (UC-MSCs) have been widely used in regenerative medicine, but there is limited research on the stability of UC-MSCs formulation during production. This study aims to assess the stability of the cell stock solution and intermediate product throughout the production process, as well as the final product following reconstitution, in order to offer guidance for the manufacturing process and serve as a reference for formulation reconstitution methods. Three batches of cell formulation were produced and stored under low temperature (2-8 ℃) and room temperature (20-26 ℃) during cell stock solution and intermediate product stages. The storage time intervals for cell stock solution were 0, 2, 4, and 6 h, while for intermediate products, the intervals were 0, 1, 2, and 3 h. The evaluation items included visual inspection, viable cell concentration, cell viability, cell surface markers, lymphocyte proliferation inhibition rate, and sterility. Additionally, dilution and culture stability studies were performed after reconstitution of the cell product. The reconstitution diluents included 0.9% sodium chloride injection, 0.9% sodium chloride injection + 1% human serum albumin, and 0.9% sodium chloride injection + 2% human serum albumin, with dilution ratios of 10-fold and 40-fold. The storage time intervals after dilution were 0, 1, 2, 3, and 4 h. The reconstitution culture media included DMEM medium, DMEM + 2% platelet lysate, 0.9% sodium chloride injection, and 0.9% sodium chloride injection + 1% human serum albumin, and the culture duration was 24 h. The evaluation items were viable cell concentration and cell viability. The results showed that the cell stock solution remained stable for up to 6 h under both low temperature (2-8 ℃) and room temperature (20-26 ℃) conditions, while the intermediate product remained stable for up to 3 h under the same conditions. After formulation reconstitution, using sodium chloride injection diluted with 1% or 2% human serum albumin maintained a viability of over 80% within 4 h. It was observed that different dilution factors had an impact on cell viability. After formulation reconstitution, cultivation in medium with 2% platelet lysate resulted in a cell viability of over 80% after 24 h. In conclusion, the stability of cell stock solution within 6 h and intermediate product within 3 h meets the requirements. The addition of 1% or 2% human serum albumin in the reconstitution diluent can better protect the post-reconstitution cell viability.

Result Analysis
Print
Save
E-mail