ObjectiveTo explore the vascular endothelial injury in male mice caused by exposure to polystyrene microplastics （PS-MPs） and the intervention effect of luteolin on vascular remodeling. Additionally， to investigate the mechanism through the oxidative system and metabolomics. MethodsThirty-two C57BL/6 mice （6-8 weeks old） were randomly divided into the saline group （saline group）， the 0.1 mg/kg PS-MPs exposure group （0.1PS-MPs group）， the 1 mg/kg PS-MPs exposure group （1PS-MPs group）， and the 1 mg/kg PS-MPs + luteolin treatment group （1PS-MPs + Lut group）， with 8 mice in each group. After 8 weeks of intervention， the body weight， blood pressure， aortic organ coefficient， and aortic histopathological changes of mice in each group were detected； the total cholesterol （TC）， triglyceride （TG）， and high-density lipoprotein cholesterol （HDL-C） lipid metabolism-related indicators in the aorta of mice were detected； the reactive oxygen species （ROS）， glutathione （GSH）， and malondialdehyde （MDA） oxidative stress-related indicators were detected； the endothelin （ET-1）， nitric oxide （NO）， vascular endothelial growth factor A （VEGF-A）， vascular cell adhesion molecule-1 （VCAM-1/CD106）， and intercellular adhesion molecule-1 （ICAM-1/CD54） endothelial function-related indicators and serum metabolomics were detected. ResultsCompared to the saline group， exposure to PS-MPs resulted in pathological thickening of the mouse aorta， increased aortic organ coefficient， and elevated blood pressure. Lipid metabolism-related indicators， including TC and TG， were elevated， while HDL-C was reduced， indicating lipid metabolism disorder in mice. Oxidative stress markers such as ROS and MDA increased， whereas GSH decreased， demonstrating oxidative damage. Vascular endothelial inflammation and injury markers， including ET-1， VEGF-A， VCAM-1， and ICAM-1， were upregulated， while the vasodilatory substance NO was downregulated， confirming endothelial injury. Furthermore， serum metabolomics results revealed that PS-MPs exposure induced endothelial damage by disrupting metabolic pathways such as the citrate cycle. Compared to the PS-MPs group， luteolin significantly reversed these effects， attenuating oxidative stress and lipid metabolism disorders， and effectively repairing endothelial injury. ConclusionPS-MPs induce vascular toxicity through oxidative stress and lipid metabolism. Luteolin effectively alleviates endothelial damage and vascular remodeling.

Background Fine particulate matter (PM_2.5) monitoring stations may generate missing data for a certain period of time due to various factors. This data loss will adversely affect air quality assessment and pollution control decision-making. Objective To propose an inverse distance weighted (IDW) spatiotemporal interpolation method based on particle swarm optimization (PSO) to interpolate and fill missing PM_2.5 spatiotemporal sequence data and increase interpolation accuracy. Methods An interpolation experiment was designed into two parts. The first part used hourly PM_2.5 observational data from four moments on January 1, 2017 in the Yangtze River Delta region. The second part employed daily PM_2.5 observational data from the first 10 d of January 2017 in the Beijing-Tianjin-Hebei region. Interpolation accuracy was evaluated using four metrics: root mean square error (RMSE), mean absolute error (MAE), mean absolute percentage error (MAPE), and mean relative error (MRE). Results IDW spatiotemporal interpolation method optimized with PSO significantly improved the accuracy of filling missing PM_2.5 spatiotemporal sequence data. In the hourly-scale experiment conducted in the Yangtze River Delta region, compared to a distance index of 2, the accuracy metrics RMSE, MAE, MAPE, and MRE generated by the proposed method improved on average by 0.17 μg·m⁻³, 0.27 μg·m⁻³, 0.17%, and 0.01%, respectively. The PM_2.5 spatial field maps generated for four moments based on this method clearly illustrated the spatiotemporal distribution characteristics of hourly PM_2.5 concentrations in the Yangtze River Delta region. In the daily-scale experiment conducted in the Beijing-Tianjin-Hebei region, the PSO-optimized distance index outperformed the traditional method, with interpolation accuracy improvements of approximately 0.215 μg·m⁻³, 0.283 μg·m⁻³, 0.174%, and 0.014%, respectively. Furthermore, the seasonal PM_2.5 spatial field maps generated by this method revealed the spatiotemporal distribution characteristics of PM_2.5 concentrations in the Beijing-Tianjin-Hebei region across different seasons, further validating the effectiveness and applicability of this method. Conclusion The IDW spatiotemporal interpolation method optimized with PSO is highly accurate and reliable for interpolating the missing data in the Yangtze River Delta region and the Beijing-Tianjin-Hebei region, providing valuable insights for air pollution control and public health protection.

Objective To explore the change of nucleoplasm distribution of glucocorticoid receptor alpha(GRα)in peripheral blood of children with primary nephrotic syndrome(PNS)during the course of the disease,aiming at evaluating the correlation between nuclear transport abnormality and different GC responses.Methods A total of 45 children with PNS were enrolled as subjects in this prospective study,and divided into steroid-sensitive nephrotic syndrome(SSNS,n=36)and steroid-resistant nephrotic syndrome(SRNS,n=9)groups,according to their response to GC.The SSNS group was further subclassified into non-frequently relapsing nephrotic syndrome(NFRNS,n=21)and frequently relapsing nephrotic syndrome(FRNS,n=15)based on relapse frequency during 12-month follow-up.Peripheral blood samples were collected before GC treatment,6-week and 6-month after GC treatment.GRα nuclear localization was detected by immunofluorescence assay,and their correlations with clinical-laboratory indicators were analyzed.Results Before the GC treatment,the average fluorescence intensity showed no significantly difference among different groups(P＞0.05),the GRαin the three groups were localized mainly in cytoplasm,and the nucleocytoplasmic ratio showed no significantly difference among the three groups(P＞0.05).6-week after the GC treatment,the average fluorescence intensity showed no significantly difference among the three groups(P＞0.05),the GRα in SSNS group were localized mainly in nucleus,while those in SRNS group were localized mainly in cytoplasm.Furthermore,nucleocytoplasmic ratio in NFRNS group and SRNS group demonstrated significant differences,while those in NFRNS group and FRNS group showed no significant difference(P＞0.05).6-month after the GC treatment,the average fluorescence intensity in NFRNS group and FRNS group showed no significant difference(P＞0.05),GRα in the two groups were localized mainly in nucleus,and their nucleocytoplasmic ratio had significantly differences(P＜0.05).The GRα nucleocytoplasmic ratio in children with PNS was negatively correlated with 24-hour urine protein(24 h-UTP),TNF-α,while positively correlated with serum albumin(Alb).Conclusion There are differences in nuclear transport ability among PNS children of SRNS,NFRNS and FRNS groups,and these differences are correlated with the differency of GC responses.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

The patient, a 20-day-old male, was admitted due to respiratory distress that had persisted for 20 days after birth. The main clinical manifestations included gradually worsening respiratory distress and edema. The patient received treatment including mechanical ventilation and diuretics. Echocardiography indicated cardiomegaly, pulmonary hypertension, and heart failure. A comprehensive systemic examination revealed a significant blowing vascular murmur upon auscultation over the anterior fontanelle and bilateral temporal regions. Further imaging studies including cranial magnetic resonance imaging, magnetic resonance angiography, and magnetic resonance venography showed marked dilation of the superior sagittal sinus, transverse sinus, and sigmoid sinus, leading to a definitive diagnosis of dural arteriovenous fistula. After a multidisciplinary consultation, the patient underwent cerebral angiography and partial embolization of the left parietal arteriovenous fistula. Postoperatively, the patient was treated with positive inotropes, diuretics, and fluid restriction. Ultimately, the patient was weaned off the ventilator and discharged in improved condition. This article reports a case of neonatal dural arteriovenous fistula presenting with respiratory distress and discusses the multidisciplinary approach to managing this condition, which aids in early disease recognition and guides clinical decision-making.
Humans ; Male ; Infant, Newborn ; Central Nervous System Vascular Malformations/diagnosis* ; Respiratory Distress Syndrome, Newborn/etiology* ; Embolization, Therapeutic

Objective To explore the change of nucleoplasm distribution of glucocorticoid receptor alpha(GRα)in peripheral blood of children with primary nephrotic syndrome(PNS)during the course of the disease,aiming at evaluating the correlation between nuclear transport abnormality and different GC responses.Methods A total of 45 children with PNS were enrolled as subjects in this prospective study,and divided into steroid-sensitive nephrotic syndrome(SSNS,n=36)and steroid-resistant nephrotic syndrome(SRNS,n=9)groups,according to their response to GC.The SSNS group was further subclassified into non-frequently relapsing nephrotic syndrome(NFRNS,n=21)and frequently relapsing nephrotic syndrome(FRNS,n=15)based on relapse frequency during 12-month follow-up.Peripheral blood samples were collected before GC treatment,6-week and 6-month after GC treatment.GRα nuclear localization was detected by immunofluorescence assay,and their correlations with clinical-laboratory indicators were analyzed.Results Before the GC treatment,the average fluorescence intensity showed no significantly difference among different groups(P＞0.05),the GRαin the three groups were localized mainly in cytoplasm,and the nucleocytoplasmic ratio showed no significantly difference among the three groups(P＞0.05).6-week after the GC treatment,the average fluorescence intensity showed no significantly difference among the three groups(P＞0.05),the GRα in SSNS group were localized mainly in nucleus,while those in SRNS group were localized mainly in cytoplasm.Furthermore,nucleocytoplasmic ratio in NFRNS group and SRNS group demonstrated significant differences,while those in NFRNS group and FRNS group showed no significant difference(P＞0.05).6-month after the GC treatment,the average fluorescence intensity in NFRNS group and FRNS group showed no significant difference(P＞0.05),GRα in the two groups were localized mainly in nucleus,and their nucleocytoplasmic ratio had significantly differences(P＜0.05).The GRα nucleocytoplasmic ratio in children with PNS was negatively correlated with 24-hour urine protein(24 h-UTP),TNF-α,while positively correlated with serum albumin(Alb).Conclusion There are differences in nuclear transport ability among PNS children of SRNS,NFRNS and FRNS groups,and these differences are correlated with the differency of GC responses.