1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.Expert Consensus on Clinical Diseases Responding Specifically to Traditional Chinese Medicine:Fibromyalgia Syndrome
Juan JIAO ; Jinyang TANG ; Xiujuan HOU ; Mengtao LI ; Dongfeng LIANG ; Yuhua WANG ; Weixia JING ; Guangtao LI ; Qin ZHANG ; Yongfeng ZHANG ; Guangyu LI ; Qian WANG ; Yang YANG ; Jin HUO ; Mei MO ; Jihua GUO ; Xiaoxiao ZHANG ; Quan JIANG
Chinese Journal of Experimental Traditional Medical Formulae 2024;30(1):216-222
Fibromyalgia syndrome (FMS) is a refractory, chronic non-articular rheumatic disease characterized by widespread pain throughout the body, for which there are no satisfactory therapeutic drugs or options. There are rich Chinese medical therapies, and some non-drug therapies, such as acupuncture, Tai Chi, and Ba-Duan-Jin, have shown satisfactory efficacy and safety and definite advantages of simultaneously adjusting mind and body. FMS is taken as a disease responding specifically to traditional Chinese medicine (TCM) by the National Administration of Traditional Chinese Medicine in 2018. In order to clarify the research progress in FMS and the clinical advantages of TCM/integrated Chinese and Western medicine, the China Academy of Chinese Medicine organized a seminar for nearly 20 experts in Chinese and Western medicine, including rheumatology, psychology, acupuncture and moxibustion, and encephalopathy, with the topic of difficulties in clinical diagnosis and treatment of FMS and advantages of TCM and Western medicine. The recommendations were reached on the difficulties in early diagnosis and solutions of FMS, mitigation of common non-specific symptoms, preferential analgesic therapy, TCM pathogenesis and treatment advantages, and direction of treatment with integrated Chinese and Western medicine. FMS is currently facing the triple dilemma of low early correct diagnosis, poor patient participation, and unsatisfactory benefit from pure Western medicine treatment. To solve the above problems, this paper suggests that rheumatologists should serve as the main diagnostic force of this disease, and they should improve patient participation in treatment decision-making, implement exercise therapy, and fully utilize the holistic and multidimensional features of TCM, which is effective in alleviating pain, improving mood, and decreasing adverse events. In addition, it is suggested that FMS treatment should rely on both TCM and Western medicine and adopt multidisciplinary joint treatment, which is expected to improve the standard of diagnosis and treatment of FMS in China.
3.Localization and anatomical measurement of lateral compression Ⅱscrew guide needle insertion point for pelvic fracture
Yong-Zheng CHEN ; Zhen-Hua HU ; Shao-Juan LI ; Xia-Cun LIANG ; Li-Kang HOU ; Shu-Liang ZHU ; Xin-Ying BAI ; Jin-Jian HE ; De-Meng YANG ; Zhi-Guo CHEN
Acta Anatomica Sinica 2024;55(6):728-733
Objective To measure the distance between the lateral compression Ⅱ(LC-Ⅱ)screw guide needle and the surrounding important structures around the anterior inferior iliac spine in pelvic fractures and to locate the needle point,so as to provide anatomical reference for clinical nail placement.Methods Totally 40 adult gross specimens of embalming were implanted with LC-Ⅱ screw guide needle under the surveillance of C-arm machine,and the specimens were dissected.The shortest distance between the insertion point and the lateral femoral cutaneous nerve,femoral nerve,femoral artery,femoral vein,anterior superior iliac spine and inguinal ligament was measured.The triangle was constructed between the insertion point,anterior superior iliac spine and inguinal ligament,and the exact location of the entry point was calculated.Results The average distance between the insertion point of the male needle and the femoral vein was(50.67±7.29)mm>the anterior superior iliac spine(43.83±7.58)mm>the femoral artery(38.35±6.63)mm>the femoral nerve(31.17±1.67)mm=the inguinal ligament(28.69±6.59)mm>the lateral femoral cutaneous nerve(7.98±3.81)mm.The mean distance between the insertion point of the female needle and the anterior superior iliac spine was(45.28±7.07)mm=femoral vein(43.72±6.89)mm>femoral artery(33.76±6.33)mm>femoral nerve(25.66±6.46)mm=inguinal ligament(23.22±5.00)mm>lateral femoral cutaneous nerve(8.97±4.76)mm.The projection distance of the entry point was 31.77 mm for men and 38.41 mm for women.The Angle b was 42.81°for men and 31.71° for women.Conclusion The lateral femoral cutaneous nerve is most vulnerable to injury when LC-Ⅱ screw is inserted,and the risk of injury has nothing to do with sex.The insertion point positioning method a and b made LC-Ⅱ screw placement quickly,safely and accurately,and reduced fluoroscopy time and frequency.
4.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.
5.Toxic Epidermal Necrolysis Induced by Sintilimab: A Case Report
Ya-lei LYE ; Bin SHAN ; Chen-hong JIA ; Jiang LIU ; Juan HOU ; Wen-li DU ; Rui FENG ; Ping LIANG
Annals of Dermatology 2023;35(Suppl1):S100-S102
Sintilimab is an anti-programmed cell death receptor-1 antibody. The phase III clinical trial ORIENT-12 confirmed the safety of sintilimab combined with pemetrexed/platinum in the treatment of advanced squamous non-small cell lung cancer. Skin reactions are the most commonly reported adverse events of immune checkpoint inhibitors and are rarely severe.We describe a case of toxic epidermal necrolysis related to sintilimab in an elderly oncologic patient. 3 weeks after immunotherapy, the patient developed an extensive rash and diffuse itching, rapidly evolving into macules, blisters, bullae and erosions. Causal evaluation was performed based on the algorithm of drug causality for epidermal necrolysis and national Food and Drug Administration qualitative analysis. The patient responded to high-dose glucocorticosteroid and supportive therapy, alongside with local wound care. If immune checkpoint inhibitors need to be extrapolated clinically, strictly following evidence-based research, promptly detecting and treating adverse reactions is crucial.
6.Genomic, transcriptomic, and epigenomic analysis of a medicinal snake, Bungarus multicinctus, to provides insights into the origin of Elapidae neurotoxins.
Jiang XU ; Shuai GUO ; Xianmei YIN ; Mingqian LI ; He SU ; Xuejiao LIAO ; Qiushi LI ; Liang LE ; Shiyu CHEN ; Baosheng LIAO ; Haoyu HU ; Juan LEI ; Yingjie ZHU ; Xiaohui QIU ; Lu LUO ; Jun CHEN ; Ruiyang CHENG ; Zhenzhan CHANG ; Han ZHANG ; Nicholas Chieh WU ; Yiming GUO ; Dianyun HOU ; Jin PEI ; Jihai GAO ; Yan HUA ; Zhihai HUANG ; Shilin CHEN
Acta Pharmaceutica Sinica B 2023;13(5):2234-2249
The many-banded krait, Bungarus multicinctus, has been recorded as the animal resource of JinQianBaiHuaShe in the Chinese Pharmacopoeia. Characterization of its venoms classified chief phyla of modern animal neurotoxins. However, the evolutionary origin and diversification of its neurotoxins as well as biosynthesis of its active compounds remain largely unknown due to the lack of its high-quality genome. Here, we present the 1.58 Gbp genome of B. multicinctus assembled into 18 chromosomes with contig/scaffold N50 of 7.53 Mbp/149.8 Mbp. Major bungarotoxin-coding genes were clustered within genome by family and found to be associated with ancient local duplications. The truncation of glycosylphosphatidylinositol anchor in the 3'-terminal of a LY6E paralog released modern three-finger toxins (3FTxs) from membrane tethering before the Colubroidea divergence. Subsequent expansion and mutations diversified and recruited these 3FTxs. After the cobra/krait divergence, the modern unit-B of β-bungarotoxin emerged with an extra cysteine residue. A subsequent point substitution in unit-A enabled the β-bungarotoxin covalent linkage. The B. multicinctus gene expression, chromatin topological organization, and histone modification characteristics were featured by transcriptome, proteome, chromatin conformation capture sequencing, and ChIP-seq. The results highlighted that venom production was under a sophisticated regulation. Our findings provide new insights into snake neurotoxin research, meanwhile will facilitate antivenom development, toxin-driven drug discovery and the quality control of JinQianBaiHuaShe.
7.HIV self-testing and related factors in men who have sex with men in Shijiazhuang.
Pei Long LI ; Hou Lin TANG ; Dong Min LI ; Lin GE ; Juan YANG ; Yan Chao QIU ; Xiao Song LIU ; Liang LIANG ; Fan LYU
Chinese Journal of Epidemiology 2023;44(5):797-801
Objective: To understand HIV self-testing and related factors in men who have sex with men (MSM) in Shijiazhuang. Methods: From August to September 2020, convenient sampling was used to recruit MSM in Shijiazhuang. Online questionnaires were used to collect information about their demographic characteristics, sexual behaviors and HIV self-testing. logistic regression model was used to analyze the related factors associated with HIV self-testing. Results: In the 304 MSM respondents, 52.3% (159/304) had HIV self-testing in the past 6 months, and 95.0% (151/159) used fingertip blood HIV detection reagent. Self-purchase was the main way to obtain HIV testing reagents (45.9%, 73/159), followed by supply from MSM social organization (44.7%, 71/159). The reasons for having HIV self-testing were non-specific testing time (67.9%, 108/159) and privacy protection (62.9%,100/159), the reasons for having no HIV self-testing included inability of using (32.4%, 47/145), being unaware of HIV self-testing reagent (24.1%, 35/145), and worry about inaccurate self-testing results (19.3%, 28/145). Multivariate logistic regression analysis showed that being 18-29 years old (aOR=2.68, 95%CI: 1.20-5.94), obtaining free HIV self-testing kits in recent 6 months (aOR=8.61, 95%CI: 4.09-18.11) and making friends through Internet and social software (aOR=2.68, 95%CI: 1.48-4.88) were positive factors for having HIV self-testing. Conclusion: HIV self-testing is a more flexible and convenient way to detect HIV in MSM, and the promotion of HIV self-testing in MSM should be strengthened to further increase the HIV detection rate in this population.
Male
;
Humans
;
Adolescent
;
Young Adult
;
Adult
;
Homosexuality, Male
;
Self-Testing
;
Sexual and Gender Minorities
;
HIV Testing
;
Sexual Behavior
8.Implementation and revision of the Measures for the Management of Radiation Workers’ Occupational Health
Shiyue CUI ; Yinping SU ; Fengling ZHAO ; Zhiwei XING ; Li LIANG ; Juan YAN ; Yuanyuan ZHANG ; Bo WANG ; Jianxiang LIU ; Changsong HOU ; Erdong CHEN ; Jun DENG ; Quanfu SUN
Chinese Journal of Radiological Health 2023;32(3):335-340
Since the implementation of the Measures for the Management of Radiation Workers’ Occupational Health in November 2007, it has played an extremely important role in protecting the occupational health of radiation workers. There are more than 700 000 radiation workers in about 100 000 workplaces with potential radiation exposure, as well as a large number of miners exposed to high levels of radon. As the radiation health monitoring project suggests, measures of occupational health management such as personal dose monitoring and occupational health examination of radiation workers have been widely implemented and achieved good results in the protection of radiation workers. However, the risks of chromosomal aberration and specific turbidity of the eye lens of radiation workers have increased in high-risk positions such as interventional radiology, nuclear medicine, and industrial flaw detection. The control of high radon exposure in miners needs to be strengthened. It is necessary to adapt to the new situation in view of new challenges and actively promote the revision of the Measures for the Management of Radiation Workers’ Occupational Health, so as to further improve the occupational health management of radiation workers in China.
9.Kang-Ai Injection Inhibits Gastric Cancer Cells Proliferation through IL-6/STAT3 Pathway.
Chun-Lei ZHENG ; Ke-Zuo HOU ; An-Qi WANG ; Wan-Xia FANG ; Shi-Tong YU ; Jin-E LIANG ; Hai-Yan QI ; Xiu-Juan QU ; Yun-Peng LIU ; Xiao-Fang CHE
Chinese journal of integrative medicine 2022;28(6):524-530
OBJECTIVE:
To explore the mechanisms underlying the proliferative inhibition of Chinese herbal medicine Kang-Ai injection (KAI) in gastric cancer cells.
METHODS:
Gastric cancer cell lines MGC803 and BGC823 were treated by 0, 0.3%, 1%, 3% and 10% KAI for 24, 48 and 72 h, respectively. The cell proliferation was evaluated by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay. The apoptosis and cell cycle were evaluated by flow cytometry. Interleukin (IL)-6 mRNA and protein expression levels were detected by quantitative real-time polymerase chain reaction (qRT-PCR) and enzyme-linked immune sorbent assay (ELISA), respectively. The protein expression levels of cyclin A, cyclin E, cyclin B1, cyclin D1, p21, retinoblastoma (RB), protein kinase B (AKT), extracellular regulated protein kinases (ERK), signal transducer and activator of transcription (STAT) 1 and STAT3 were detected by Western blot.
RESULTS:
KAI inhibited the proliferation of MGC803 and BGC823 gastric cancer cells in dose- and time-dependent manner. After treated with KAI for 48 h, the proportion of G1 phase was increased, expression level of cyclin D1 and phosphorylation-RB were down-regulated, whereas the expression of p21 was up-regulated (all P<0.01). Furthermore, 48-h treatment with KAI decreased the phosphorylation level of STAT3, inhibited the mRNA and protein expressions of IL-6 (all P<0.01). IL-6 at dose of 10 ng/mL significantly attenuated the proliferative effect of both 3% and 10% KAI, and recovered KAI-inhibited STAT3 phosphorylation and cyclin D1 expression level (all P<0.01).
CONCLUSION
KAI exerted an anti-proliferative function by inhibiting IL-6/STAT3 signaling pathway followed by the induction of G1 phase arrest in gastric cancer cells.
Apoptosis
;
Cell Line, Tumor
;
Cell Proliferation
;
Cyclin D1/pharmacology*
;
Humans
;
Interleukin-6/metabolism*
;
RNA, Messenger/metabolism*
;
STAT3 Transcription Factor/metabolism*
;
Stomach Neoplasms/genetics*
10. Interlaboratory method validation of slope ratio determination for anticoagulant activity of leeches
Yu-Chi HU ; Si-Ting XIAO ; Wen-Liang YANG ; Yu-Dong GUO ; Hua-Yu XU ; Hua GAO ; Yuan ZHANG ; Bo LI ; Li-Ming TANG ; Su-Hui ZHANG ; Jin-Hua PIAO ; Ting-Ting WANG ; Hong ZHANG ; Jing RUI ; Xiao-Dong HUA ; Juan HOU ; Tian-Jiao YANG
Chinese Pharmacological Bulletin 2022;38(11):1722-1729
Aim To investigate the slope ratio method for the determination of anticoagulant activity of leeches. Methods Three batches of leeches, four groups of Japanese medical vermiculite yinpian and fifteen groups of leech preparations were chosen, with contrast medicinal leeches herbs and Philippine cattle leech contrast medicinal materials, and different concentrations of leaching solutions were prepared in parallel. APTT value was determined after anticoagulant activity was determined by slope ratio method for the joint validation of laboratory, intermediate precision and accuracy between the linear range. Results The slope ratio method was accurate and accurate in the determination of anticoagulant activity of leeches, with linearity between 64% and 156% relative titer level. Conclusion Slope ratio method can be used to determine the anticoagulant activity of leeches.

Result Analysis
Print
Save
E-mail