1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Analysis and evaluation of platelet bank establishment strategy from the perspective of donor loss
Zheng LIU ; Yamin SUN ; Xin PENG ; Yiqing KANG ; Ziqing WANG ; Jintong ZHU ; Juan DU ; Jianbin LI
Chinese Journal of Blood Transfusion 2025;38(2):238-243
[Objective] To analyze the loss rate of platelet donors and evaluate the strategies for establishing a platelet donor bank. [Methods] A total of 1 443 donors who joined the HLA and HPA gene donor bank for platelets in Henan Province from 2018 to 2020 were included in this study. Data on the total number of apheresis platelet donations, annual donation frequency, age at enrollment, donation habits (including the number of platelets donated per session and whether they had previously donated whole blood), and enrollment location were collected from the platelet donor information management system. Donor loss was determined based on the date of their last donation. The loss rates of different groups under various conditions were compared to assess the enrollment strategies. [Results] By the time the platelet bank was officially operational in 2022, 421 donors had been lost, resulting in an loss rate of 29% (421/1 443). By the end of 2023, the overall cumulative loss rate reached 52% (746/1 443). The loss rate was lower than the overall level in groups meeting any of the following conditions: total apheresis platelet donations exceeding 50, annual donation frequency of 10 or more, age at enrollment of 40 years or older, donation of more than a single therapeutic dose per session, or a history of whole blood donation two or more times. Additionally, loss rates varied across different enrollment locations, with higher enrollment numbers generally associated with higher loss rates. [Conclusion] Through a comprehensive analysis of donor loss, our center has adjusted its strategies for establishing the donor pool. These findings also provide valuable insights for other blood collection and supply institutions in building platelet donor banks.
3.Mechanism of Mingshi Prescription in Regulating Opn4-dopamine Axis to Inhibit Endoplasmic Reticulum Stress and Delay Myopia Progression
Baohua LI ; Zefeng KANG ; Lulu WANG ; Xin YAN ; Jianquan WANG ; Xinyue HOU ; Bobiao NING ; Shanshan YE ; Mengyu LIU ; Yipeng SHI ; Danyu LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(18):58-67
ObjectiveTo investigate the mechanism by which Mingshi prescription regulates the retinal melanopsin-dopamine (Opn4-DA) axis in myopic mice to inhibit endoplasmic reticulum (ER) stress in the retina and sclera, thereby delaying axial elongation associated with myopia. MethodsSixty 4-week-old male SPF-grade C57BL/6J mice were randomly divided into a normal group, a form-deprived myopia group (FDM group), an intrinsically photosensitive retinal ganglion cells ablation group (ipRGCs group), a Mingshi Prescription group (MSF group, 5.2 g·kg-1), and an ipRGCs + MSF group (5.2 g·kg-1). Except for the normal group, all other groups underwent FDM modeling. Additionally, the ipRGCs and ipRGCs + MSF groups received retinal ipRGC ablation. Three weeks after modeling, the MSF and ipRGCs + MSF groups were administered Mingshi prescription via continuous gavage for six weeks. After refraction and axial length were measured in all mice, eyeballs were collected along with retinal and scleral tissues. Pathological and morphological changes in the retina, choroid, and sclera were observed using periodic acid-Schiff (PAS) staining. Western blot was employed to detect the relative protein expression levels of dopamine D1 receptor (DRD1), C/EBP homologous protein (CHOP), and glucose-regulated protein 78 (GRP78) in the retina, and CHOP and GRP78 in the sclera. Real-time PCR was used to detect the relative mRNA expression of Opn4, CHOP, and GRP78 in the retina, and CHOP and GRP78 in the sclera. Immunofluorescence staining (IF) was performed to detect the expression of Opn4 and DRD1 in retinal tissues. ResultsCompared with the normal group, the FDM group showed a significant myopic shift in refraction (P<0.05) and a significant increase in axial length (P<0.05). The retinal layers were thinner, the number of ganglion cells was reduced, and collagen fibers in the sclera were loosely arranged with evident gaps. Opn4 and DRD1 protein and mRNA expression in the retina were significantly decreased (P<0.05), while CHOP and GRP78 protein and mRNA expression in both retinal and scleral tissues were significantly increased (P<0.05). Compared with the FDM group, the ipRGCs group exhibited further increases in myopic refraction and axial length (P<0.05), more pronounced thinning and looseness in the retinal, choroidal, and scleral layers, lower expression of Opn4 and DRD1 protein and mRNA in the retina (P<0.05), and higher expression of CHOP and GRP78 protein and mRNA in the retina and sclera (P<0.05). Compared with the FDM group, the MSF group showed significantly reduced refractive error and axial length (P<0.05), with improved cellular number, arrangement, and thickness in ocular tissues, increased Opn4 and DRD1 protein and mRNA expression in the retina (P<0.05), and reduced CHOP and GRP78 protein and mRNA expression in both retina and sclera (P<0.05). Similarly, the ipRGCs + MSF group showed significant improvements in terms of the above items compared with the ipRGCs group (P<0.05). ConclusionMingshi Prescription delays myopic axial elongation and refractive progression by regulating the Opn4-DA axis in the retina of myopic mice, thereby inhibiting ER stress in the retina and sclera. This intervention promotes Qi and blood nourishment of the eyes, softens the fascia, and restores ocular rhythm.
4.Pharmacokinetics study of Dayuanyin in normal and febrile rats.
Yu-Jie HOU ; Kang-Ning XIAO ; Jian-Yun BI ; Xin-Jun ZHANG ; Xin-Rui LI ; Yu-Qing WANG ; Ming SU ; Xin-Ru SUN ; Hui ZHANG ; Bo-Yang WANG ; Li-Jie WANG ; Shan-Xin LIU
China Journal of Chinese Materia Medica 2025;50(2):527-533
Based on the pharmacokinetics theory, this study investigated the pharmacokinetic characteristics of albiflorin, paeoniflorin, wogonoside, and wogonin in normal and febrile rats and summarized absorption and elimination rules of Dayuanyin in them to provide reference for further development and clinical application of Dayuanyin. Blood samples were taken from the fundus venous plexus of normal and model rats after intragastric administration of Dayuanyin at different time points. The concentration of each substance in blood was determined by ultra performance liquid chromatography-triple quadrupole mass spectrometry(UPLC-MS/MS) technique at different time points. DAS 2.0, a piece of pharmacokinetics software, was used to calculate the pharmacokinetic parameters of each component. The results show that the 4 components had good linear relationship in their respective ranges, and the results of methodological investigation met the requirements. The pharmacokinetic parameters of C_(max), T_(max), t_(1/2), AUC_(0-t), AUC_(0-∞), and MRT_(0-t) were calculated by the DAS 2.0 non-compartmental model. Compared with those in the normal group, C_(max) and AUC_(0-t) of the 4 components in the model group were significantly increased. There were significant differences in the pharmacokinetic characteristics between the normal and model groups, suggesting that the absorption and elimination of Dayuanyin may be affected by the changes of internal environment of the body in different physiological states.
Animals
;
Rats
;
Drugs, Chinese Herbal/administration & dosage*
;
Male
;
Rats, Sprague-Dawley
;
Fever/metabolism*
;
Tandem Mass Spectrometry
;
Chromatography, High Pressure Liquid
;
Glucosides/pharmacokinetics*
;
Monoterpenes
5.Identification of tissue distribution components and mechanism of antipyretic effect of famous classical formula Dayuanyin.
Yu-Jie HOU ; Kang-Ning XIAO ; Jian-Yun BI ; Xin-Rui LI ; Ming SU ; Li-Jie WANG ; Yu-Qing WANG ; Dan-Dan SUN ; Hui ZHANG ; Xin-Jun ZHANG ; Shan-Xin LIU
China Journal of Chinese Materia Medica 2025;50(10):2810-2824
Based on the ultra performance liquid chromatography-quadrupole Exactive Orbitrap mass spectrometry(UPLC-Q-Exactive Orbitrap-MS) technology, combined with related literature, databases, and reference material information, this study qualitatively analyzed the components of Dayuanyin in the tissue of rats after gavage and employed molecular docking technology to predict the rationality of the mechanism behind the antipyretic effect of the in vivo components in Dayuanyin. A total of 21, 26, 20, 21, 14, and 31 prototype components and 3, 16, 3, 7, 5, and 24 metabolites were identified from the heart, liver, spleen, lung, kidney, and hypothalamus of the rats, respectively, and the binding ability of key components and targets was further verified by molecular docking. The results showed that all components had good binding ability with targets. The established UPLC-Q-Exactive Orbitrap-MS could effectively and quickly identify the Dayuanyin components distributed in tissue and preliminarily identify their metabolites. Many components were identified in the hypothalamus, which suggested that the components delivered to the brain should be focused on in the study on Dayuanyin in the treatment of febrile diseases. The molecular docking technology was used to predict the rationality of the mechanism behind its antipyretic effect, which lays the foundation for the clarification of the material basis and action mechanism of Dayuanyin, the development of new preparations, and the prediction of quality markers.
Animals
;
Drugs, Chinese Herbal/administration & dosage*
;
Rats
;
Molecular Docking Simulation
;
Male
;
Antipyretics/metabolism*
;
Rats, Sprague-Dawley
;
Tissue Distribution
;
Mass Spectrometry
;
Chromatography, High Pressure Liquid
;
Hypothalamus/metabolism*
6.Comparison on chemical components of Angelicae Sinensis Radix before and after wine processing by HS-GC-IMS, HS-SPME-GC-MS, and UPLC-Q-Orbitrap-MS combined with chemometrics.
Xue-Hao SUN ; Jia-Xuan CHEN ; Jia-Xin YIN ; Xiao HAN ; Zhi-Ying DOU ; Zheng LI ; Li-Ping KANG ; He-Shui YU
China Journal of Chinese Materia Medica 2025;50(14):3909-3917
The study investigated the intrinsic changes in material basis of Angelicae Sinensis Radix during wine processing by headspace-gas chromatography-ion mobility spectrometry(HS-GC-IMS), headspace-solid phase microextraction-gas chromatography-mass spectrometry(HS-SPME-GC-MS), and ultra-high performance liquid chromatography-quadrupole-orbitrap mass spectrometry(UPLC-Q-Orbitrap-MS) combined with chemometrics. HS-GC-IMS fingerprints of Angelicae Sinensis Radix before and after wine processing were established to analyze the variation trends of volatile components and characterize volatile small-molecule substances before and after processing. Principal component analysis(PCA) and orthogonal partial least squares-discriminant analysis(OPLS-DA) were employed for differentiation and difference analysis. A total of 89 volatile components in Angelicae Sinensis Radix were identified by HS-GC-IMS, including 14 unsaturated hydrocarbons, 16 aldehydes, 13 ketones, 9 alcohols, 16 esters, 6 organic acids, and 15 other compounds. HS-SPME-GC-MS detected 118 volatile components, comprising 42 unsaturated hydrocarbons, 11 aromatic compounds, 30 alcohols, 8 alkanes, 6 organic acids, 4 ketones, 7 aldehydes, 5 esters, and 5 other volatile compounds. UPLC-Q-Orbitrap-MS identified 76 non-volatile compounds. PCA revealed distinct clusters of raw and wine-processed Angelicae Sinensis Radix samples across the three detection methods. Both PCA and OPLS-DA effectively discriminated between the two groups, and 145 compounds(VIP>1) were identified as critical markers for evaluating processing quality, including 4-methyl-3-penten-2-one, ethyl 2-methylpentanoate, and 2,4-dimethyl-1,3-dioxolane detected by HS-GC-IMS, angelic acid, β-pinene, and germacrene B detected by HS-SPME-GC-MS, and L-tryptophan, licoricone, and angenomalin detected by UPLC-Q-Orbitrap-MS. In conclusion, the integration of the three detection methods with chemometrics elucidates the differences in the chemical material basis between raw and wine-processed Angelicae Sinensis Radix, providing a scientific foundation for understanding the processing mechanisms and clinical applications of wine-processed Angelicae Sinensis Radix.
Wine/analysis*
;
Gas Chromatography-Mass Spectrometry/methods*
;
Chromatography, High Pressure Liquid/methods*
;
Angelica sinensis/chemistry*
;
Solid Phase Microextraction/methods*
;
Drugs, Chinese Herbal/isolation & purification*
;
Chemometrics
;
Volatile Organic Compounds/chemistry*
;
Principal Component Analysis
;
Ion Mobility Spectrometry/methods*
7.Stir-fried Semen Armeniacae Amarum Suppresses Aristolochic Acid I-Induced Nephrotoxicity and DNA Adducts.
Cheng-Xian LI ; Xiao-He XIAO ; Xin-Yu LI ; Da-Ke XIAO ; Yin-Kang WANG ; Xian-Ling WANG ; Ping ZHANG ; Yu-Rong LI ; Ming NIU ; Zhao-Fang BAI
Chinese journal of integrative medicine 2025;31(2):142-152
OBJECTIVE:
To investigate the protective effects of stir-fried Semen Armeniacae Amarum (SAA) against aristolochic acid I (AAI)-induced nephrotoxicity and DNA adducts and elucidate the underlying mechanism involved for ensuring the safe use of Asari Radix et Rhizoma.
METHODS:
In vitro, HEK293T cells overexpressing Flag-tagged multidrug resistance-associated protein 3 (MRP3) were constructed by Lentiviral transduction, and inhibitory effect of top 10 common pairs of medicinal herbs with Asari Radix et Rhizoma in clinic on MRP3 activity was verified using a self-constructed fluorescence screening system. The mRNA, protein expressions, and enzyme activity levels of NAD(P)H quinone dehydrogenase 1 (NQO1) and cytochrome P450 1A2 (CYP1A2) were measured in differentiated HepaRG cells. Hepatocyte toxicity after inhibition of AAI metabolite transport was detected using cell counting kit-8 assay. In vivo, C57BL/6 mice were randomly divided into 5 groups according to a random number table, including: control (1% sodium bicarbonate), AAI (10 mg/kg), stir-fried SAA (1.75 g/kg) and AAI + stir-fried SAA (1.75 and 8.75 g/kg) groups, 6 mice in each group. After 7 days of continuous gavage administration, liver and kidney damages were assessed, and the protein expressions and enzyme activity of liver metabolic enzymes NQO1 and CYP1A2 were determined simultaneously.
RESULTS:
In vivo, combination of 1.75 g/kg SAA and 10 mg/kg AAI suppressed AAI-induced nephrotoxicity and reduced dA-ALI formation by 26.7%, and these detoxification effects in a dose-dependent manner (P<0.01). Mechanistically, SAA inhibited MRP3 transport in vitro, downregulated NQO1 expression in vivo, increased CYP1A2 expression and enzymatic activity in vitro and in vivo, respectively (P<0.05 or P<0.01). Notably, SAA also reduced AAI-induced hepatotoxicity throughout the detoxification process, as indicated by a 41.3% reduction in the number of liver adducts (P<0.01).
CONCLUSIONS
Stir-fried SAA is a novel drug candidate for the suppression of AAI-induced liver and kidney damages. The protective mechanism may be closely related to the regulation of transporters and metabolic enzymes.
Aristolochic Acids/toxicity*
;
Animals
;
Humans
;
NAD(P)H Dehydrogenase (Quinone)/genetics*
;
HEK293 Cells
;
Kidney/pathology*
;
Cytochrome P-450 CYP1A2/genetics*
;
Mice, Inbred C57BL
;
DNA Adducts/drug effects*
;
Male
;
Kidney Diseases/drug therapy*
;
Drugs, Chinese Herbal/therapeutic use*
;
Mice
;
Prunus armeniaca
;
Plant Extracts
8.Multifaceted function of B cells in tumorigenesis.
Na KANG ; Qinghui DUAN ; Xin MIN ; Tong LI ; Yuxin LI ; Ji GAO ; Wanli LIU
Frontiers of Medicine 2025;19(2):297-317
B lymphocytes (B cells) play a complex and paradoxical role in tumorigenesis. They can recognize tumor-associated antigens, present these antigens to T cells, and produce antibodies that directly target and eliminate tumor cells. This makes B cells a potentially powerful ally in combating cancer. However, B cells also exhibit immunosuppressive functions, secreting cytokines like IL-10 or generating tumor-promoting antibodies that dampen the anti-tumor immune response, and some tumor cells have even been shown to exploit B cells to promote their growth and metastasis. This dual nature of B cells presents both opportunities and challenges for tumor immunotherapy. In this review, we summarize the mechanisms underlying the multifaceted functions of B cells and their current applications in cancer immunotherapy. Furthermore, we also explore the key issues and future directions in this field, emphasizing the need for further research to fully harness the anti-tumor potential of B cells in the fight against cancer.
Humans
;
B-Lymphocytes/immunology*
;
Neoplasms/therapy*
;
Carcinogenesis/immunology*
;
Immunotherapy/methods*
;
Animals
9.Predicting Postoperative Circulatory Complications in Older Patients: A Machine Learning Approach.
Xiao Yun HU ; Wei Xuan SHENG ; Kang YU ; Jie Tai DUO ; Peng Fei LIU ; Ya Wei LI ; Dong Xin WANG ; Hui Hui MIAO
Biomedical and Environmental Sciences 2025;38(3):328-340
OBJECTIVE:
This study examines utilizes the advantages of machine learning algorithms to discern key determinants in prognosticate postoperative circulatory complications (PCCs) for older patients.
METHODS:
This secondary analysis of data from a randomized controlled trial involved 1,720 elderly participants in five tertiary hospitals in Beijing, China. Participants aged 60-90 years undergoing major non-cardiac surgery under general anesthesia. The primary outcome metric of the study was the occurrence of PCCs, according to the European Society of Cardiology and the European Society of Anaesthesiology diagnostic criteria. The analysis metrics contained 67 candidate variables, including baseline characteristics, laboratory tests, and scale assessments.
RESULTS:
Our feature selection process identified key variables that significantly impact patient outcomes, including the duration of ICU stay, surgery, and anesthesia; APACHE-II score; intraoperative average heart rate and blood loss; cumulative opioid use during surgery; patient age; VAS-Move-Median score on the 1st to 3rd day; Charlson comorbidity score; volumes of intraoperative plasma, crystalloid, and colloid fluids; cumulative red blood cell transfusion during surgery; and endotracheal intubation duration. Notably, our Random Forest model demonstrated exceptional performance with an accuracy of 0.9872.
CONCLUSION
We have developed and validated an algorithm for predicting PCCs in elderly patients by identifying key risk factors.
Aged
;
Aged, 80 and over
;
Female
;
Humans
;
Male
;
Middle Aged
;
Cardiovascular Diseases/etiology*
;
Machine Learning
;
Postoperative Complications/etiology*
;
Risk Factors
;
Randomized Controlled Trials as Topic
;
Secondary Data Analysis
10.Advances in Clinical Application of Gastric Contrast-Enhanced Ultrasound for Gastric Cancer.
Guan-Mo LIU ; Hua LIANG ; Yang GUI ; Jie LI ; Xin YE ; Wei-Ming KANG
Acta Academiae Medicinae Sinicae 2025;47(5):716-724
Gastric contrast-enhanced ultrasound includes oral contrast-enhanced ultrasound (OCUS) and double contrast-enhanced ultrasound (DCEUS),which can provide valuable clinical information about tumor morphology,vascular characteristics,and treatment responses.OCUS can clearly identify the gastric wall structure and the extent and depth of lesions by applying oral contrast agents.DCEUS,based on OCUS combined with venography,can display the anatomical and perfusion characteristics of lesions.In recent years,gastric contrast agents and imaging techniques have developed rapidly.However,the clinical application of gastric contrast-enhanced ultrasound is still in the developmental stage.This article reviews the clinical status of OCUS and DCEUS in the screening,diagnosis,staging,pathological typing,and treatment evaluation of gastric cancer.Studies have shown that gastric contrast-enhanced ultrasound has high sensitivity and specificity in the assessment of diagnosis and T-staging of gastric cancer.Furthermore,gastric contrast-enhanced ultrasound has the advantages of being cost-effective,convenient,non-invasive,free from radiation exposure,real-time,and easy to repeat.In the diagnosis and treatment of gastric cancer,it is expected to become one of the important imaging assessment tools.
Humans
;
Stomach Neoplasms/diagnostic imaging*
;
Contrast Media
;
Ultrasonography/methods*

Result Analysis
Print
Save
E-mail