AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

Based on the pharmacokinetics theory, this study investigated the pharmacokinetic characteristics of albiflorin, paeoniflorin, wogonoside, and wogonin in normal and febrile rats and summarized absorption and elimination rules of Dayuanyin in them to provide reference for further development and clinical application of Dayuanyin. Blood samples were taken from the fundus venous plexus of normal and model rats after intragastric administration of Dayuanyin at different time points. The concentration of each substance in blood was determined by ultra performance liquid chromatography-triple quadrupole mass spectrometry(UPLC-MS/MS) technique at different time points. DAS 2.0, a piece of pharmacokinetics software, was used to calculate the pharmacokinetic parameters of each component. The results show that the 4 components had good linear relationship in their respective ranges, and the results of methodological investigation met the requirements. The pharmacokinetic parameters of C_(max), T_(max), t_(1/2), AUC_(0-t), AUC_(0-∞), and MRT_(0-t) were calculated by the DAS 2.0 non-compartmental model. Compared with those in the normal group, C_(max) and AUC_(0-t) of the 4 components in the model group were significantly increased. There were significant differences in the pharmacokinetic characteristics between the normal and model groups, suggesting that the absorption and elimination of Dayuanyin may be affected by the changes of internal environment of the body in different physiological states.
Animals ; Rats ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Rats, Sprague-Dawley ; Fever/metabolism* ; Tandem Mass Spectrometry ; Chromatography, High Pressure Liquid ; Glucosides/pharmacokinetics* ; Monoterpenes

Based on the ultra performance liquid chromatography-quadrupole Exactive Orbitrap mass spectrometry(UPLC-Q-Exactive Orbitrap-MS) technology, combined with related literature, databases, and reference material information, this study qualitatively analyzed the components of Dayuanyin in the tissue of rats after gavage and employed molecular docking technology to predict the rationality of the mechanism behind the antipyretic effect of the in vivo components in Dayuanyin. A total of 21, 26, 20, 21, 14, and 31 prototype components and 3, 16, 3, 7, 5, and 24 metabolites were identified from the heart, liver, spleen, lung, kidney, and hypothalamus of the rats, respectively, and the binding ability of key components and targets was further verified by molecular docking. The results showed that all components had good binding ability with targets. The established UPLC-Q-Exactive Orbitrap-MS could effectively and quickly identify the Dayuanyin components distributed in tissue and preliminarily identify their metabolites. Many components were identified in the hypothalamus, which suggested that the components delivered to the brain should be focused on in the study on Dayuanyin in the treatment of febrile diseases. The molecular docking technology was used to predict the rationality of the mechanism behind its antipyretic effect, which lays the foundation for the clarification of the material basis and action mechanism of Dayuanyin, the development of new preparations, and the prediction of quality markers.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Molecular Docking Simulation ; Male ; Antipyretics/metabolism* ; Rats, Sprague-Dawley ; Tissue Distribution ; Mass Spectrometry ; Chromatography, High Pressure Liquid ; Hypothalamus/metabolism*

The study investigated the intrinsic changes in material basis of Angelicae Sinensis Radix during wine processing by headspace-gas chromatography-ion mobility spectrometry(HS-GC-IMS), headspace-solid phase microextraction-gas chromatography-mass spectrometry(HS-SPME-GC-MS), and ultra-high performance liquid chromatography-quadrupole-orbitrap mass spectrometry(UPLC-Q-Orbitrap-MS) combined with chemometrics. HS-GC-IMS fingerprints of Angelicae Sinensis Radix before and after wine processing were established to analyze the variation trends of volatile components and characterize volatile small-molecule substances before and after processing. Principal component analysis(PCA) and orthogonal partial least squares-discriminant analysis(OPLS-DA) were employed for differentiation and difference analysis. A total of 89 volatile components in Angelicae Sinensis Radix were identified by HS-GC-IMS, including 14 unsaturated hydrocarbons, 16 aldehydes, 13 ketones, 9 alcohols, 16 esters, 6 organic acids, and 15 other compounds. HS-SPME-GC-MS detected 118 volatile components, comprising 42 unsaturated hydrocarbons, 11 aromatic compounds, 30 alcohols, 8 alkanes, 6 organic acids, 4 ketones, 7 aldehydes, 5 esters, and 5 other volatile compounds. UPLC-Q-Orbitrap-MS identified 76 non-volatile compounds. PCA revealed distinct clusters of raw and wine-processed Angelicae Sinensis Radix samples across the three detection methods. Both PCA and OPLS-DA effectively discriminated between the two groups, and 145 compounds(VIP>1) were identified as critical markers for evaluating processing quality, including 4-methyl-3-penten-2-one, ethyl 2-methylpentanoate, and 2,4-dimethyl-1,3-dioxolane detected by HS-GC-IMS, angelic acid, β-pinene, and germacrene B detected by HS-SPME-GC-MS, and L-tryptophan, licoricone, and angenomalin detected by UPLC-Q-Orbitrap-MS. In conclusion, the integration of the three detection methods with chemometrics elucidates the differences in the chemical material basis between raw and wine-processed Angelicae Sinensis Radix, providing a scientific foundation for understanding the processing mechanisms and clinical applications of wine-processed Angelicae Sinensis Radix.
Wine/analysis* ; Gas Chromatography-Mass Spectrometry/methods* ; Chromatography, High Pressure Liquid/methods* ; Angelica sinensis/chemistry* ; Solid Phase Microextraction/methods* ; Drugs, Chinese Herbal/isolation & purification* ; Chemometrics ; Volatile Organic Compounds/chemistry* ; Principal Component Analysis ; Ion Mobility Spectrometry/methods*

OBJECTIVE: To investigate the protective effects of stir-fried Semen Armeniacae Amarum (SAA) against aristolochic acid I (AAI)-induced nephrotoxicity and DNA adducts and elucidate the underlying mechanism involved for ensuring the safe use of Asari Radix et Rhizoma. METHODS: In vitro, HEK293T cells overexpressing Flag-tagged multidrug resistance-associated protein 3 (MRP3) were constructed by Lentiviral transduction, and inhibitory effect of top 10 common pairs of medicinal herbs with Asari Radix et Rhizoma in clinic on MRP3 activity was verified using a self-constructed fluorescence screening system. The mRNA, protein expressions, and enzyme activity levels of NAD(P)H quinone dehydrogenase 1 (NQO1) and cytochrome P450 1A2 (CYP1A2) were measured in differentiated HepaRG cells. Hepatocyte toxicity after inhibition of AAI metabolite transport was detected using cell counting kit-8 assay. In vivo, C57BL/6 mice were randomly divided into 5 groups according to a random number table, including: control (1% sodium bicarbonate), AAI (10 mg/kg), stir-fried SAA (1.75 g/kg) and AAI + stir-fried SAA (1.75 and 8.75 g/kg) groups, 6 mice in each group. After 7 days of continuous gavage administration, liver and kidney damages were assessed, and the protein expressions and enzyme activity of liver metabolic enzymes NQO1 and CYP1A2 were determined simultaneously. RESULTS: In vivo, combination of 1.75 g/kg SAA and 10 mg/kg AAI suppressed AAI-induced nephrotoxicity and reduced dA-ALI formation by 26.7%, and these detoxification effects in a dose-dependent manner (P<0.01). Mechanistically, SAA inhibited MRP3 transport in vitro, downregulated NQO1 expression in vivo, increased CYP1A2 expression and enzymatic activity in vitro and in vivo, respectively (P<0.05 or P<0.01). Notably, SAA also reduced AAI-induced hepatotoxicity throughout the detoxification process, as indicated by a 41.3% reduction in the number of liver adducts (P<0.01). CONCLUSIONS Stir-fried SAA is a novel drug candidate for the suppression of AAI-induced liver and kidney damages. The protective mechanism may be closely related to the regulation of transporters and metabolic enzymes.
Aristolochic Acids/toxicity* ; Animals ; Humans ; NAD(P)H Dehydrogenase (Quinone)/genetics* ; HEK293 Cells ; Kidney/pathology* ; Cytochrome P-450 CYP1A2/genetics* ; Mice, Inbred C57BL ; DNA Adducts/drug effects* ; Male ; Kidney Diseases/drug therapy* ; Drugs, Chinese Herbal/therapeutic use* ; Mice ; Prunus armeniaca ; Plant Extracts

AIM To evaluate the quality of Gegen Formula Granules.METHODS Linear calibration with two reference substances(LCTRS)was adopted in the predicting of retention time with puerarin and daidzein as internal standards.UPLC characteristic chromatograms were established.The contents of 3'-hydroxy puerarin,puerarin(internal standard),3'-methoxy puerarin,puerarin 6"-O-xyloside,puerarin apioside and daidzin were determined by quantitative determination analysis multi-components by a single marker(QAMS),after which their transfer rates were calculated.RESULTS Compared with relative retention time method,LCTRS demonstrated higher positional accuracy for characteristic peaks and wider application range for columns.There were 9 characteristic peaks in the characteristic chromatograms for 14 batches of formula granules and 15 batches of standard decoctions with the similarities of more than 0.95.The contents and transfer rates of various constituents in formula granules and standard decoctions were basically consistent.CONCLUSION The chemical constituents in formula granules and their standard decoctions of Puerariae lobatae Radix display good consistency,reliable preparation process is observable in the former.

ObjectiveTo investigate the mechanism by which Mingshi prescription regulates the retinal melanopsin-dopamine （Opn4-DA） axis in myopic mice to inhibit endoplasmic reticulum （ER） stress in the retina and sclera， thereby delaying axial elongation associated with myopia. MethodsSixty 4-week-old male SPF-grade C57BL/6J mice were randomly divided into a normal group， a form-deprived myopia group （FDM group）， an intrinsically photosensitive retinal ganglion cells ablation group （ipRGCs group）， a Mingshi Prescription group （MSF group， 5.2 g·kg^-1）， and an ipRGCs + MSF group （5.2 g·kg^-1）. Except for the normal group， all other groups underwent FDM modeling. Additionally， the ipRGCs and ipRGCs + MSF groups received retinal ipRGC ablation. Three weeks after modeling， the MSF and ipRGCs + MSF groups were administered Mingshi prescription via continuous gavage for six weeks. After refraction and axial length were measured in all mice， eyeballs were collected along with retinal and scleral tissues. Pathological and morphological changes in the retina， choroid， and sclera were observed using periodic acid-Schiff （PAS） staining. Western blot was employed to detect the relative protein expression levels of dopamine D1 receptor （DRD1）， C/EBP homologous protein （CHOP）， and glucose-regulated protein 78 （GRP78） in the retina， and CHOP and GRP78 in the sclera. Real-time PCR was used to detect the relative mRNA expression of Opn4， CHOP， and GRP78 in the retina， and CHOP and GRP78 in the sclera. Immunofluorescence staining （IF） was performed to detect the expression of Opn4 and DRD1 in retinal tissues. ResultsCompared with the normal group， the FDM group showed a significant myopic shift in refraction （P<0.05） and a significant increase in axial length （P<0.05）. The retinal layers were thinner， the number of ganglion cells was reduced， and collagen fibers in the sclera were loosely arranged with evident gaps. Opn4 and DRD1 protein and mRNA expression in the retina were significantly decreased （P<0.05）， while CHOP and GRP78 protein and mRNA expression in both retinal and scleral tissues were significantly increased （P<0.05）. Compared with the FDM group， the ipRGCs group exhibited further increases in myopic refraction and axial length （P<0.05）， more pronounced thinning and looseness in the retinal， choroidal， and scleral layers， lower expression of Opn4 and DRD1 protein and mRNA in the retina （P<0.05）， and higher expression of CHOP and GRP78 protein and mRNA in the retina and sclera （P<0.05）. Compared with the FDM group， the MSF group showed significantly reduced refractive error and axial length （P<0.05）， with improved cellular number， arrangement， and thickness in ocular tissues， increased Opn4 and DRD1 protein and mRNA expression in the retina （P<0.05）， and reduced CHOP and GRP78 protein and mRNA expression in both retina and sclera （P<0.05）. Similarly， the ipRGCs + MSF group showed significant improvements in terms of the above items compared with the ipRGCs group （P<0.05）. ConclusionMingshi Prescription delays myopic axial elongation and refractive progression by regulating the Opn4-DA axis in the retina of myopic mice， thereby inhibiting ER stress in the retina and sclera. This intervention promotes Qi and blood nourishment of the eyes， softens the fascia， and restores ocular rhythm.

B lymphocytes (B cells) play a complex and paradoxical role in tumorigenesis. They can recognize tumor-associated antigens, present these antigens to T cells, and produce antibodies that directly target and eliminate tumor cells. This makes B cells a potentially powerful ally in combating cancer. However, B cells also exhibit immunosuppressive functions, secreting cytokines like IL-10 or generating tumor-promoting antibodies that dampen the anti-tumor immune response, and some tumor cells have even been shown to exploit B cells to promote their growth and metastasis. This dual nature of B cells presents both opportunities and challenges for tumor immunotherapy. In this review, we summarize the mechanisms underlying the multifaceted functions of B cells and their current applications in cancer immunotherapy. Furthermore, we also explore the key issues and future directions in this field, emphasizing the need for further research to fully harness the anti-tumor potential of B cells in the fight against cancer.
Humans ; B-Lymphocytes/immunology* ; Neoplasms/therapy* ; Carcinogenesis/immunology* ; Immunotherapy/methods* ; Animals