This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Background: Visual impairment is increasingly prevalent, underscoring the need for effective prevention strategies. This study investigated the association between cardiovascular health and visual impairment using three progressively developed metrics: Life’s Simple 7 (LS7), a cardiovascular health score developed by the American Heart Association based on 7 components, including physical activity, smoking status, body mass index (BMI), diet, blood glucose, blood pressure, and total cholesterol; Life’s Essential 8(LE8), which adds sleep health as an additional component; and Life’s Crucial 9 (LC9), which further incorporates mental health. We aimed to evaluate whether these expanded metrics provide additional explanatory value and to inform future public health strategies. Objective: To investigate the associations among LS7, LE8, and LC9 cardiovascular health scores and visual impairment in National Health and Nutrition Examination Survey 2013 to 2018, assess the added value of sleep and mental health components, and identify key contributing subcomponents using regression and machine learning methods. Methods: We analyzed data from 9891 participants in the 2013 to 2018 National Health and Nutrition Examination Survey. Multivariable logistic regression, restricted cubic spline modeling, and subgroup analyses were conducted to evaluate the association between cardiovascular health and visual impairment. Machine learning methods, including Random Forest and SHapley Additive exPlanations, a model interpretation approach used to assess feature importance, were applied. The Boruta algorithm, a feature selection method, was used to identify key subcomponents of cardiovascular health. Results: Participants with visual impairment were older, had lower poverty-to-income ratios, and exhibited lower cardiovascular health scores (LS7, LE8, and LC9). Higher cardiovascular health scores were negatively associated with visual impairment. Each one standard deviation increase in LS7, LE8, and LC9 was associated with approximately 8%, 2%, and 3% lower odds of visual impairment, respectively. LS7 showed the strongest negative association, whereas LE8 and LC9 emerged as the most important predictors in the machine learning models. Key subcomponents such as blood glucose, blood pressure, and BMI, as well as mental health status, were strongly associated with visual impairment. Conclusion: Higher cardiovascular health scores were negatively associated with visual impairment. LS7 demonstrated the strongest statistical association, whereas LE8 and LC9 were the most influential features in the machine learning models. Blood glucose, blood pressure, BMI, and mental health status were important correlates of visual impairment. From the perspective of the “prevention and treatment of diseases” in traditional Chinese medicine and the holistic concept, the aforementioned research findings confirm that severe visual impairment is indeed an external manifestation of overall health imbalance (such as organ dysfunction and Qi deficiency and blood stasis). The prevention strategy lies in comprehensively adjusting lifestyle, emotional factors, and metabolic indicators (corresponding to the key factors in the study) to restore the body’s internal balance and achieve prevention before disease arises.

AIM To investigate the effects of Yiqi Juanbi Formula on chondrocyte pyroptosis in rat models of collagen-induced arthritis(CIA).METHODS Fifty rats were subcutaneously injected at the tail base with an emulsion containing equal volumes of bovine type Ⅱ collagen and incomplete Freund's adjuvant(IFA)to establish the CIA models.These rats were then randomly assigned to the model group,the methotrexate group(0.35 mg/kg),and the low-dose,medium-dose,and high-dose Yiqi Juanbi Formula groups(9.4,18.7,37.4 g/kg),in contrast to the ten intact rats serving in the normal control group.Following four weeks of intragastric administration,the rats had their general conditions observed;their joint swelling and arthritis indices measured;their ankle joint pathology assessed by HE staining;their serum levels of IL-1β,IL-18 and TNF-ɑ detected by ELISA;their mRNA expressions of NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ in ankle cartilage quantified by RT-qPCR;their protein expressions of NF-κB,NLRP3 and Caspase-1 in ankle cartilage analyzed by Western blot;and their NLRP3 and GSDMD positive expressions in ankle cartilage examined by immunohistochemistry.RESULTS Compared to the control group,the model group showed significantly increased joint swelling and arthritis indices(P＜0.01);elevated serum levels of IL-1 β,IL-18 and TNF-ɑ(P＜0.01);pathological changes including cartilage surface defects,reduced cell count,altered cellular morphology,irregular cell arrangement,and significant inflammatory cell infiltration in synovial tissue;upregulated mRNA expressions of NF-κB,NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ(P＜0.01)and increased protein expressions of NF-κB,NLRP3 and Caspase-1(P＜0.01)in ankle cartilage;enhanced positive expressions of NLRP3 and GSDMD in ankle cartilage(P＜0.01).Compared to the model group,the groups intervened with methotrexate or medium-or high-dose Yiqi Juanbi Formula exhibited reduced joint swelling and arthritis indices(P＜0.01);alleviated pathological damage in ankle joints;decreased serum levels of IL-1β,IL-18 and TNF-ɑ(P＜0.01);downregulated mRNA expressions of NF-κB,NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ(P＜0.05,P＜0.01),and reduced protein expressions of NF-κB,NLRP3 and Caspase-1(P＜0.05,P＜0.01)in ankle cartilage;and diminished positive expressions of NLRP3 and GSDMD in ankle cartilage(P＜0.01).CONCLUSION Yiqi Juanbi Formula alleviates inflammation in CIA rats,potentially by inhibiting the activation of the NF-κB/NLRP3/Caspase-1 signaling pathway,thereby suppressing chondrocyte pyroptosis.

AIM To evaluate the quality of Gegen Formula Granules.METHODS Linear calibration with two reference substances(LCTRS)was adopted in the predicting of retention time with puerarin and daidzein as internal standards.UPLC characteristic chromatograms were established.The contents of 3'-hydroxy puerarin,puerarin(internal standard),3'-methoxy puerarin,puerarin 6"-O-xyloside,puerarin apioside and daidzin were determined by quantitative determination analysis multi-components by a single marker(QAMS),after which their transfer rates were calculated.RESULTS Compared with relative retention time method,LCTRS demonstrated higher positional accuracy for characteristic peaks and wider application range for columns.There were 9 characteristic peaks in the characteristic chromatograms for 14 batches of formula granules and 15 batches of standard decoctions with the similarities of more than 0.95.The contents and transfer rates of various constituents in formula granules and standard decoctions were basically consistent.CONCLUSION The chemical constituents in formula granules and their standard decoctions of Puerariae lobatae Radix display good consistency,reliable preparation process is observable in the former.

Arsenic is a semi-metal,and lipid-soluble arsenic compounds are one of the widespread forms in the environment and food chain,but there is a lack of standards for lipid-soluble arsenic compounds,which is one of the bottlenecks in the current analytical detection and toxicological studies of organic arsenic.In this study,four saturated arsenic-containing hydrocarbons,AsHC 318,AsHC 332,AsHC 346,and AsHC 374(The number is relative molecular mass),were successfully synthesized in three steps by using dimethylarsinic acid,potassium iodide,sodium hydroxide,and four brominated alkanes(1-Bromotetradecane,1-bromopentadecane,1-bromohexadecane,and 1-bromooctadecane)as raw materials.The structures of these four saturated arsenic-containing hydrocarbons were characterized by proton nuclear magnetic resonance(1H NMR)spectroscopy,13C nuclear magnetic resonance(13C NMR)spectroscopy,and high-resolution mass spectrometry(HR-MS).The yields of the method were 8%-10%,and the synthesized compounds could be used in subsequent toxicity evaluation experiments to assess the toxic effects and mechanisms of action of arsenic-containing hydrocarbons.This study provided an effective method for synthesis of arsenic-containing hydrocarbons,enriching the synthesis methods of arsenic-containing hydrocarbons,and provided raw materials for the subsequent toxicological studies of arsenic-containing hydrocarbons.

OBJECTIVE: This study examines utilizes the advantages of machine learning algorithms to discern key determinants in prognosticate postoperative circulatory complications (PCCs) for older patients. METHODS: This secondary analysis of data from a randomized controlled trial involved 1,720 elderly participants in five tertiary hospitals in Beijing, China. Participants aged 60-90 years undergoing major non-cardiac surgery under general anesthesia. The primary outcome metric of the study was the occurrence of PCCs, according to the European Society of Cardiology and the European Society of Anaesthesiology diagnostic criteria. The analysis metrics contained 67 candidate variables, including baseline characteristics, laboratory tests, and scale assessments. RESULTS: Our feature selection process identified key variables that significantly impact patient outcomes, including the duration of ICU stay, surgery, and anesthesia; APACHE-II score; intraoperative average heart rate and blood loss; cumulative opioid use during surgery; patient age; VAS-Move-Median score on the 1st to 3rd day; Charlson comorbidity score; volumes of intraoperative plasma, crystalloid, and colloid fluids; cumulative red blood cell transfusion during surgery; and endotracheal intubation duration. Notably, our Random Forest model demonstrated exceptional performance with an accuracy of 0.9872. CONCLUSION We have developed and validated an algorithm for predicting PCCs in elderly patients by identifying key risk factors.
Aged ; Aged, 80 and over ; Female ; Humans ; Male ; Middle Aged ; Cardiovascular Diseases/etiology* ; Machine Learning ; Postoperative Complications/etiology* ; Risk Factors ; Randomized Controlled Trials as Topic ; Secondary Data Analysis

AIM To investigate the effects of Yiqi Juanbi Formula on chondrocyte pyroptosis in rat models of collagen-induced arthritis(CIA).METHODS Fifty rats were subcutaneously injected at the tail base with an emulsion containing equal volumes of bovine type Ⅱ collagen and incomplete Freund's adjuvant(IFA)to establish the CIA models.These rats were then randomly assigned to the model group,the methotrexate group(0.35 mg/kg),and the low-dose,medium-dose,and high-dose Yiqi Juanbi Formula groups(9.4,18.7,37.4 g/kg),in contrast to the ten intact rats serving in the normal control group.Following four weeks of intragastric administration,the rats had their general conditions observed;their joint swelling and arthritis indices measured;their ankle joint pathology assessed by HE staining;their serum levels of IL-1β,IL-18 and TNF-ɑ detected by ELISA;their mRNA expressions of NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ in ankle cartilage quantified by RT-qPCR;their protein expressions of NF-κB,NLRP3 and Caspase-1 in ankle cartilage analyzed by Western blot;and their NLRP3 and GSDMD positive expressions in ankle cartilage examined by immunohistochemistry.RESULTS Compared to the control group,the model group showed significantly increased joint swelling and arthritis indices(P＜0.01);elevated serum levels of IL-1 β,IL-18 and TNF-ɑ(P＜0.01);pathological changes including cartilage surface defects,reduced cell count,altered cellular morphology,irregular cell arrangement,and significant inflammatory cell infiltration in synovial tissue;upregulated mRNA expressions of NF-κB,NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ(P＜0.01)and increased protein expressions of NF-κB,NLRP3 and Caspase-1(P＜0.01)in ankle cartilage;enhanced positive expressions of NLRP3 and GSDMD in ankle cartilage(P＜0.01).Compared to the model group,the groups intervened with methotrexate or medium-or high-dose Yiqi Juanbi Formula exhibited reduced joint swelling and arthritis indices(P＜0.01);alleviated pathological damage in ankle joints;decreased serum levels of IL-1β,IL-18 and TNF-ɑ(P＜0.01);downregulated mRNA expressions of NF-κB,NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ(P＜0.05,P＜0.01),and reduced protein expressions of NF-κB,NLRP3 and Caspase-1(P＜0.05,P＜0.01)in ankle cartilage;and diminished positive expressions of NLRP3 and GSDMD in ankle cartilage(P＜0.01).CONCLUSION Yiqi Juanbi Formula alleviates inflammation in CIA rats,potentially by inhibiting the activation of the NF-κB/NLRP3/Caspase-1 signaling pathway,thereby suppressing chondrocyte pyroptosis.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.