AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Metabonomics and proteomics were employed to investigate the mechanism of Yuzhi Zhixue Granules in treating polycystic ovary syndrome with insulin resistance(PCOS-IR). The disease model was established by feeding a high-fat diet and gavage of letrozole solution and it was then treated with different doses of Yuzhi Zhixue Granules. The therapeutic effect of Yuzhi Zhixue Granules was evaluated based on the body mass, homeostasis model assessment of insulin resistance and insulin sensitivity index, serum levels of adipokines, and histopathological changes of rats. Metabolomics and proteomics were employed to find the action pathways of Yuzhi Zhixue Granules. The results showed that Yuzhi Zhixue Granules reduced the body mass, improved the insulin sensitivity and aromatase activity, improved the levels of leptin, adiponectin and other adipokines, and alleviated insulin resistance, histopathological changes, and metabolic disorders in PCOS-IR rats. Metabolomics results revealed 14 metabolites with altered levels in the ovarian tissue, which were closely related to glutathione metabolism and pyruvate metabolism. Proteomics results showed that the therapeutic effect of Yuzhi Zhixue Granules was mainly related to the adipokine, adenosine 5'-monophosphate(AMP)-activated protein kinase(AMPK), phosphatidylinositol 3-kinase/protein kinase B(PI3K/Akt), forkhead box protein O(FoxO), and mechanistic target of rapamycin(mTOR) signaling pathways. Western blot results showed that compared with the model group, Yuzhi Zhixue Granules treatment decreased the p-AMPK/AMPK and p-FoxO1/FoxO1 levels, increased the p-mTOR/mTOR level, and up-regulated the expression level of recombinant glucose transporter 4(GLUT4). Yuzhi Zhixue Granules can balance amino acid metabolism and pyruvate metabolism by regulating the AMPK/mTOR/FoxO/GLUT pathway to maintain the homeostasis of the ovarian environment and alleviate insulin resistance, thus treating PCOS-IR.
Animals ; Female ; Insulin Resistance ; Polycystic Ovary Syndrome/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Metabolomics ; Proteomics ; Rats, Sprague-Dawley ; Humans ; Ovary/metabolism* ; Signal Transduction/drug effects*

Sepsis is a systemic inflammatory response caused by severe infection or trauma, and is one of the common causes of acute lung injury(ALI) and acute respiratory distress syndrome(ARDS). Sepsis-acute lung injury(SALI) is a critical clinical condition with high morbidity and mortality. Its pathogenesis is complex and not yet fully understood, and there is currently a lack of targeted and effective treatment options. Pyroptosis, a novel form of programmed cell death, plays a key role in the pathological process of SALI by activating inflammasomes and releasing inflammatory factors, making it a potential therapeutic target. In recent years, the role of traditional Chinese medicine(TCM) in regulating signaling pathways related to pyroptosis through multi-components and multi-targets has attracted increasing attention. TCM may intervene in pyroptosis by inhibiting the activation of NLRP3 inflammasomes and regulating the expression of Caspase family proteins, thus alleviating inflammatory damage in lung tissues. This paper systematically reviews the molecular regulatory network of pyroptosis in SALI and explores the potential mechanisms and research progress on TCM intervention in cellular pyroptosis. The aim is to provide new ideas and theoretical support for basic research and clinical treatment strategies of TCM in SALI.
Pyroptosis/drug effects* ; Humans ; Sepsis/genetics* ; Acute Lung Injury/physiopathology* ; Animals ; Drugs, Chinese Herbal/therapeutic use* ; Medicine, Chinese Traditional ; Inflammasomes/metabolism* ; NLR Family, Pyrin Domain-Containing 3 Protein/genetics*

Subtype classification of age-related macular degeneration (AMD) based on optical coherence tomography (OCT) images serves as an effective auxiliary tool for clinicians in diagnosing disease progression and formulating treatment plans. To improve the classification accuracy of AMD subtypes, this study proposes a keypoint-based, attention-enhanced residual network (KPA-ResNet). The proposed architecture adopts a 50-layer residual network (ResNet-50) as the backbone, preceded by a keypoint localization module based on heatmap regression to outline critical lesion regions. A two-dimensional relative self-attention mechanism is incorporated into convolutional layers to enhance the representation of key lesion areas. Furthermore, the network depth is appropriately increased and an improved residual module, ConvNeXt, is introduced to enable comprehensive extraction of high-dimensional features and enrich the detail of lesion boundary contours, ultimately achieving higher classification accuracy of AMD subtypes. Experimental results demonstrate that KPA-ResNet achieves significant improvements in overall classification accuracy compared with conventional convolutional neural networks. Specifically, for the wet AMD subtypes, the classification accuracies for inactive choroidal neovascularization (CNV) and active CNV reach 92.8% and 95.2%, respectively, representing substantial improvement over ResNet-50. These findings validate the superior performance of KPA-ResNet in AMD subtype classification tasks. This work provides a high-accuracy, generalizable network architecture for OCT-based AMD subtype classification and offers new insights into integrating attention mechanisms with convolutional neural networks in ophthalmic image analysis.
Tomography, Optical Coherence/methods* ; Humans ; Macular Degeneration/diagnostic imaging* ; Neural Networks, Computer

Instrument separation is a critical complication during root canal therapy, impacting treatment success and long-term tooth preservation. The etiology of instrument separation is multifactorial, involving the intricate anatomy of the root canal system, instrument-related factors, and instrumentation techniques. Instrument separation can hinder thorough cleaning, shaping, and obturation of the root canal, posing challenges to successful treatment outcomes. Although retrieval of separated instrument is often feasible, it carries risks including perforation, excessive removal of tooth structure and root fractures. Effective management of separated instruments requires a comprehensive understanding of the contributing factors, meticulous preoperative assessment, and precise evaluation of the retrieval difficulty. The application of appropriate retrieval techniques is essential to minimize complications and optimize clinical outcomes. The current manuscript provides a framework for understanding the causes, risk factors, and clinical management principles of instrument separation. By integrating effective strategies, endodontists can enhance decision-making, improve endodontic treatment success and ensure the preservation of natural dentition.
Humans ; Root Canal Therapy/adverse effects* ; Consensus ; Root Canal Preparation/adverse effects*

ObjectiveFor prepubertal and urgently treated malignant tumor patients, ovarian tissue cryopreservation and transplantation represent more appropriate fertility preservation methods. Current clinical practices often involve freezing ovarian tissue with high concentrations of cryoprotectants (CPAs) and thawing with water baths. These processes lead to varying degrees of toxicity and devitrification damage to ovarian tissue. Therefore, this paper proposes optimized methods for vitrification of ovarian tissues based on sodium alginate hydrogel encapsulation and magnetic induction nanowarming technology. MethodsFirstly, the study investigated the effects of sodium alginate concentration, the sequence of hydrogel encapsulation and CPAs loading on vitrification efficiency of encapsulated ovarian tissue. Additionally, the capability of sodium alginate hydrogel encapsulation to reduce the required concentration of CPAs was validated. Secondly, a platform combining water bath and magnetic induction nanowarming was established to rewarm ovarian tissue under various concentrations of magnetic nanoparticles and magnetic field strengths. The post-warming follicle survival rate, antioxidant capacity, and ovarian tissue integrity were evaluated to assess the efficacy of the method. ResultsThe study found that ovarian tissue encapsulated with 2% sodium alginate hydrogel exhibited the highest follicle survival rate after vitrification. The method of loading CPAs prior to encapsulation proved more suitable for ovarian tissue cryopreservation, effectively reducing the required concentration of CPAs by 50%. A combination of 8 g/L Fe₃O₄ nanoparticles and an alternating magnetic field of 300 Gs showed optimal warming effectiveness for ovarian tissue. Combining water bath rewarming with magnetic induction nanowarming yielded the highest follicle survival rate, enhanced antioxidant capacity, and preserved tissue morphology. ConclusionSodium alginate hydrogel encapsulation of ovarian tissue reduces the concentration of CPAs required during the freezing process. The combination of magnetic induction nanowarming with water bath provides an efficient method ovarian tissue rewarming. This study offers novel approaches to optimize ovarian tissues vitrification.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.