AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThe present study aimed to investigate alterations in white matter microstructure and spontaneous neural activity in male college smokers, and to further explore their associations with nicotine dependence. Given that adolescence and early adulthood represent critical periods for brain maturation, particularly for white matter development, understanding the neural correlates of smoking behavior during this stage is of substantial importance for both neuroscience and public health. MethodsA total of 115 male undergraduate students were initially recruited for this study. After quality control and exclusion procedures, 52 male college smokers and 42 demographically matched healthy non-smokers were included in the final analysis. All participants underwent multimodal magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI) and resting-state functional MRI (rs-fMRI). White matter fiber tracts were reconstructed using the automated fiber quantification (AFQ) method, which enables precise identification and quantification of major fiber bundles. Eighteen major white matter tracts were segmented for each participant. Along the core trajectory of each tract, 100 equidistant nodes were sampled. Fractional anisotropy (FA) was calculated at each node to assess white matter microstructural integrity, while amplitude of low-frequency fluctuation (ALFF) was computed to evaluate spontaneous neural activity within white matter tracts. Between-group differences in FA and ALFF were assessed using two-sample t-tests, with appropriate corrections applied for multiple comparisons. Furthermore, Pearson correlation analyses were conducted to examine the relationships between imaging-derived metrics (FA and ALFF values in regions showing significant group differences) and nicotine dependence severity, as measured by the Fagerström test for nicotine dependence (FTND). ResultsCompared with healthy non-smokers, male college smokers exhibited significantly increased FA values in several white matter tracts, including the left thalamic radiation, right corticospinal tract, forceps major of the corpus callosum, left uncinate fasciculus, and right arcuate fasciculus. These findings suggest altered microstructural organization or increased directional coherence within these pathways. In addition, smokers demonstrated significantly elevated ALFF values in the forceps major, right uncinate fasciculus, and left arcuate fasciculus, indicating enhanced spontaneous neural activity in these white matter regions. Correlation analyses revealed that FA values in the left thalamic radiation and right corticospinal tract were negatively correlated with FTND scores, suggesting that higher levels of nicotine dependence were associated with reduced microstructural integrity or altered fiber organization in these regions. In contrast, ALFF values in the forceps major and right uncinate fasciculus were positively correlated with FTND scores, indicating that greater nicotine dependence was associated with increased spontaneous neural activity in specific white matter pathways. ConclusionThe present study provides evidence that male college smokers exhibit distinct alterations in both white matter microstructure and functional activity. These abnormalities are not uniformly distributed but rather localized to specific fiber tracts implicated in sensorimotor processing, interhemispheric communication, and higher-order cognitive and emotional regulation. Importantly, the observed associations between imaging metrics and nicotine dependence severity suggest that these structural and functional alterations may reflect neurobiological mechanisms underlying addiction. The combination of AFQ-based tract profiling and multimodal MRI offers a sensitive approach for detecting subtle changes along white matter pathways, highlighting its potential utility in identifying neuroimaging biomarkers of nicotine dependence. Overall, these findings indicate that smoking during early adulthood may disrupt ongoing white matter maturation, potentially leading to long-term consequences for brain function. This study provides novel insights into the neural basis of nicotine dependence and underscores the importance of early intervention and prevention strategies targeting young smokers.

To address the growing challenge of an increasing number of elderly lung cancer patients amidst China's aging population and to fill the gap in quality control standards for surgical treatment in this special population, this study aimed to develop a standardized surgical evaluation system for elderly lung cancer patients tailored to China's national conditions. The system was established through a literature review, integrated the pathophysiological characteristics of elderly patients, and was constructed following review, feedback, and revision by experts from multiple thoracic surgery centers. Employing a 100-point scoring system, it comprises three primary domains: physical infrastructure and geriatric adaptability foundational conditions (10 points); management level and perioperative care models (20 points); and technical proficiency and clinical outcomes (70 points). The system places a strong emphasis on geriatric adaptability, proposing specific, quantifiable indicators for age-friendly facility modifications, control of elderly-specific complications, multidisciplinary collaboration, and standardized perioperative management. It provides a convenient and measurable assessment tool for quality control in the surgical treatment of elderly lung cancer in China, which is expected to promote the standardization and homogenization of diagnosis and treatment.

Objective To investigate the etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate (HoLEP) for benign prostatic hyperplasia (BPH), so as to improve the therapeutic efficacy. Methods A retrospective analysis was conducted on 1361 BPH patients who received HoLEP at our hospital during Mar. 2018 and Mar. 2025. All patients underwent ultrasound, computed tomography (CT), urethral probing or radiography, cystourethroscopy, and urodynamic testing. The causes, treatments and prognosis of dysuria after operation were summarized. Results ninety-eight patients (7.2%) experienced dysuria within 3 months after surgery, and all patients received initial urethral dilation. Among the 62 cases with urethral stricture, 28 were treated with urethral dilation (average of 8 sessions), 16 underwent external urethral incision, 8 underwent anterior urethroplasty, and 10 underwent transurethral plasma incision for urethral stricture. Of the 12 cases with residual prostate tissue, 5 underwent urethral plasma prostatectomy and 7 received medication. All of the 12 cases with bladder neck contracture underwent transurethral plasma incision of the bladder neck and local drug injection. Five cases with intravesical blood clots underwent urethral blood clot irrigation, 2 of which developed active bleeding and then underwent electrocoagulation. Four cases with detrusor dysfunction had catheters re-indwelled for one week followed by medication. Two cases with stone and one case with tissue fragment impacted in the urethra underwent urethral holmium lithotripsy and cystoscopic removal. All patients underwent reoperation successfully and experienced complete resolution or significant improvement of urinary difficulties. Conclusion A certain proportion of patients experience dysuria after HoLEP, with diverse etiologies. The combination of prevention and treatment can reduce the incidence of dysuria.

To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.

Sepsis is a systemic inflammatory response triggered by infection and often leads to acute kidney injury(AKI).The pathogenesis of sepsis-associated AKI is complex,involving multiple factors such as renal ischemia,inflammation and oxidative stress.In recent years,pyroptosis,a pro-inflammatory form of programmed cell death,has gradually attracted the attention of researchers.Pyroptosis is activated by inflammasomes(e.g.,the NOD-like receptor pyrin domain-related protein 3 inflammasome,NLRP3 inflammasome),accompanied by Gas-dermin D(GSDMD)-mediated formation of cell membrane pores and release of cellular contents,which leads to exacerbation of local and systemic inflammatory responses.The mechanism of pyroptosis in sepsis-associated AKI has not been fully elucidated,but AKI is directly involved in the process of renal functional impairment by indu-cing the death of renal tubular epithelial cells and exacerbating the local inflammatory response.Blockade of key molecules in the pyroptosis pathway,such as GSDMD or NLRP3 inflammasome,can significantly alleviate renal injury,suggesting that the pyroptosis pathway may be a potential therapeutic target for sepsis-associated AKI.This review summarizes the recent research progress on pyroptosis in sepsis-associated AKI,and discuss its cen-tral role in the pathogenesis,particularly focusing on the inflammasome and GSDMD pathways.Additionally,this paper analyzes the potential of focal death inhibition as a therapeutic strategy and proposes future research direc-tions with the expectation of providing references for the treatment of sepsis-related AKI.

This study was aimed at investigating the immunoregulatory function of Mycobacterium tuberculosis Rv3641c gene in modulating host type Ⅰ interferon responses.The shuttle plasmid pMV261 was used to construct Rv3641c overexpression recombinant Mycobacterium smegmatis,and the biological characteristics of the recombinant bacteria were analyzed to explore the effect of Rv3641c on the growth curve,colony morphology and stress resistance of Mycobacterium.Subsequently,RAW264.7 cells were infected with Rv3641c overexpressing Mycobacterium smegmatis,and the transcriptional expression of genes related to the inhibition of type I inter-feron pathway was determined by RT-PCR.The expression level of IFN-βprotein was determined by ELISA,and the intracellular sur-vival level was determined.As a result,the recombinant rMS::pMV261-Rv3641c was successfully constructed.The results of biologi-cal characteristics analysis showed that Rv3641c did not affect the growth of mycobacteria,but significantly changed the colony mor-phology of mycobacteria and improved its resistance to H2O2.The results of recombinant bacteria infection experiments showed that Rv3641c significantly down-regulated the transcription levels of IFN-α,IFN-βand downstream ISGs genes CXCL10,IFIT2 and IL-1β in host cells,and Rv3641c significantly down-regulated the transcription levels of IFN-α,IFN-βand downstream ISGs genes CXCL10,IFIT2 and IL-1βin host cells.The results of intracellular colonization experiments showed that the intracellular mycobacte-ria in the overexpression recombinant bacteria infection group were significantly higher than those in the empty vector group,indicat-ing that Rv3641c could promote the intracellular surviv al of mycobacteria.In summary,the Rv3641c gene of M.tuberculosis can inhibit the host type I interferon response and promote the intracellular survival of M.tuberculosis,which provides a new idea for further explor-ing the immune escape function of M.tuberculosis and the discovery of new targets for anti-tuberculosis drugs.

Aim To detect the non-coding RNA(ncRNA)expression profile of neuroglioma cells via whole transcriptome sequencing,establish the ceRNA network and reveal the molecular mechanism of ncRNA participating in the inhibition of neuroglioma cell prolif-eration by melatonin.Methods Neuroglioma cells were intervened with by 0,2,4,6 and 8 mmol·L-1 melatonin for 24,48 and 72 h,and the inhibitory effect of melatonin on cell proliferation was detected via CCK-8;after the intervention of 0 and 4 mmol·L-1 melatonin to U251 cells for 24 h,differentially ex-pressed miRNA(DEmiRNA),lncRNA(DElncRNA)and mRNA(DEmRNA)were detected through whole transcriptome sequencing,along with GO and KEGG enrichment analysis of DEmRNA;the ceRNA network was constructed,and the key gene expression of ceR-NA was verified through qRT-PCR.Results Melato-nin exerts a time-dose-dependent inhibitory effect on the proliferation of neuroglioma cells;a total of 5049 DEmRNA,635 DElncRNA and 146 DEmiRNA in 0 and 4 mmol·L-1 melatonin groups were screened out via whole transcriptome sequencing;DEmRNAs were mainly enriched in cancer-related signaling pathways,such as ferroptosis,mTOR signaling pathway,FoxO signaling pathway and cell cycle;the ceRNA network included 4 lncRNAs,3 miRNAs and 48 mRNAs.As verified through real-time PCR,the expressions of hsa-miR-129-5p,hsa-miR-362-5p,LINC00707 and SLC16A1-AS1 of U251 cells were consistent with the sequencing results,and the gene expression of U87 cells was basically consistent with the sequencing re-sults.Conclusions Melatonin affects cancer-related signaling pathways through the differential expression of ncRNA so as to inhibit the proliferation of U251 cells;the ceRNA network composed of LINC00707,SLC16A1-AS1,hsa-miR-129-5p and hsa-miR-362-5p may take a part in the molecular mechanism of melato-nin in inhibiting neuroglioma cell proliferation.

To explore the understanding of the target population regarding the Get Active Questionnaire for Pregnancy(GAQ-P)and the Companion Health Care Provider Consultation Form for Prenatal Physical Activity(cHCP-CF-PPA)in the Chinese context,and to verify the consistency of the Chinese version of the prenatal physical activity dual screening questionnaire with the original version in terms of language expression,27 pregnant women and 12 healthcare providers were selected from Obstetrics and Gynecology Hospital,Fudan University during Aug and Oct 2023,and were interviewed using purposive sampling.Two rounds of cognitive interviews were conducted.The first round revealed that some respondents experienced ambiguities in understanding the meanings of 5 items in the questionnaire.Following modifications,the second round indicated that the revised items were consistent in meaning with the original questionnaire.Cognitive interviews can facilitate the adaptation of the prenatal physical activity dual screening questionnaire to the Chinese cultural context,improve the understanding of the questionnaire items among the target population,and promote the localization of the screening tool.

To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.