AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThe present study aimed to investigate alterations in white matter microstructure and spontaneous neural activity in male college smokers, and to further explore their associations with nicotine dependence. Given that adolescence and early adulthood represent critical periods for brain maturation, particularly for white matter development, understanding the neural correlates of smoking behavior during this stage is of substantial importance for both neuroscience and public health. MethodsA total of 115 male undergraduate students were initially recruited for this study. After quality control and exclusion procedures, 52 male college smokers and 42 demographically matched healthy non-smokers were included in the final analysis. All participants underwent multimodal magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI) and resting-state functional MRI (rs-fMRI). White matter fiber tracts were reconstructed using the automated fiber quantification (AFQ) method, which enables precise identification and quantification of major fiber bundles. Eighteen major white matter tracts were segmented for each participant. Along the core trajectory of each tract, 100 equidistant nodes were sampled. Fractional anisotropy (FA) was calculated at each node to assess white matter microstructural integrity, while amplitude of low-frequency fluctuation (ALFF) was computed to evaluate spontaneous neural activity within white matter tracts. Between-group differences in FA and ALFF were assessed using two-sample t-tests, with appropriate corrections applied for multiple comparisons. Furthermore, Pearson correlation analyses were conducted to examine the relationships between imaging-derived metrics (FA and ALFF values in regions showing significant group differences) and nicotine dependence severity, as measured by the Fagerström test for nicotine dependence (FTND). ResultsCompared with healthy non-smokers, male college smokers exhibited significantly increased FA values in several white matter tracts, including the left thalamic radiation, right corticospinal tract, forceps major of the corpus callosum, left uncinate fasciculus, and right arcuate fasciculus. These findings suggest altered microstructural organization or increased directional coherence within these pathways. In addition, smokers demonstrated significantly elevated ALFF values in the forceps major, right uncinate fasciculus, and left arcuate fasciculus, indicating enhanced spontaneous neural activity in these white matter regions. Correlation analyses revealed that FA values in the left thalamic radiation and right corticospinal tract were negatively correlated with FTND scores, suggesting that higher levels of nicotine dependence were associated with reduced microstructural integrity or altered fiber organization in these regions. In contrast, ALFF values in the forceps major and right uncinate fasciculus were positively correlated with FTND scores, indicating that greater nicotine dependence was associated with increased spontaneous neural activity in specific white matter pathways. ConclusionThe present study provides evidence that male college smokers exhibit distinct alterations in both white matter microstructure and functional activity. These abnormalities are not uniformly distributed but rather localized to specific fiber tracts implicated in sensorimotor processing, interhemispheric communication, and higher-order cognitive and emotional regulation. Importantly, the observed associations between imaging metrics and nicotine dependence severity suggest that these structural and functional alterations may reflect neurobiological mechanisms underlying addiction. The combination of AFQ-based tract profiling and multimodal MRI offers a sensitive approach for detecting subtle changes along white matter pathways, highlighting its potential utility in identifying neuroimaging biomarkers of nicotine dependence. Overall, these findings indicate that smoking during early adulthood may disrupt ongoing white matter maturation, potentially leading to long-term consequences for brain function. This study provides novel insights into the neural basis of nicotine dependence and underscores the importance of early intervention and prevention strategies targeting young smokers.

To address the growing challenge of an increasing number of elderly lung cancer patients amidst China's aging population and to fill the gap in quality control standards for surgical treatment in this special population, this study aimed to develop a standardized surgical evaluation system for elderly lung cancer patients tailored to China's national conditions. The system was established through a literature review, integrated the pathophysiological characteristics of elderly patients, and was constructed following review, feedback, and revision by experts from multiple thoracic surgery centers. Employing a 100-point scoring system, it comprises three primary domains: physical infrastructure and geriatric adaptability foundational conditions (10 points); management level and perioperative care models (20 points); and technical proficiency and clinical outcomes (70 points). The system places a strong emphasis on geriatric adaptability, proposing specific, quantifiable indicators for age-friendly facility modifications, control of elderly-specific complications, multidisciplinary collaboration, and standardized perioperative management. It provides a convenient and measurable assessment tool for quality control in the surgical treatment of elderly lung cancer in China, which is expected to promote the standardization and homogenization of diagnosis and treatment.

Objective To investigate the etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate (HoLEP) for benign prostatic hyperplasia (BPH), so as to improve the therapeutic efficacy. Methods A retrospective analysis was conducted on 1361 BPH patients who received HoLEP at our hospital during Mar. 2018 and Mar. 2025. All patients underwent ultrasound, computed tomography (CT), urethral probing or radiography, cystourethroscopy, and urodynamic testing. The causes, treatments and prognosis of dysuria after operation were summarized. Results ninety-eight patients (7.2%) experienced dysuria within 3 months after surgery, and all patients received initial urethral dilation. Among the 62 cases with urethral stricture, 28 were treated with urethral dilation (average of 8 sessions), 16 underwent external urethral incision, 8 underwent anterior urethroplasty, and 10 underwent transurethral plasma incision for urethral stricture. Of the 12 cases with residual prostate tissue, 5 underwent urethral plasma prostatectomy and 7 received medication. All of the 12 cases with bladder neck contracture underwent transurethral plasma incision of the bladder neck and local drug injection. Five cases with intravesical blood clots underwent urethral blood clot irrigation, 2 of which developed active bleeding and then underwent electrocoagulation. Four cases with detrusor dysfunction had catheters re-indwelled for one week followed by medication. Two cases with stone and one case with tissue fragment impacted in the urethra underwent urethral holmium lithotripsy and cystoscopic removal. All patients underwent reoperation successfully and experienced complete resolution or significant improvement of urinary difficulties. Conclusion A certain proportion of patients experience dysuria after HoLEP, with diverse etiologies. The combination of prevention and treatment can reduce the incidence of dysuria.

The recombinant human thyroid-stimulating hormone (rhTSH) can be used for differentiated thyroid cancer (DTC) preparation before ¹³¹I therapy, and follow-up. Since its approval by the American Food and Drug Administration (FDA) in 1998, rhTSH has been clinically used in European countries, the United States, and other countries for nearly 30 years. In April 2024, China’s first independently developed rhTSH agent was approved. Based on clinical experience and evidence from domestic and international studies, an expert consensus on the application of rhTSH has been developed following thorough consultations among experts. The consensus offers evidence-based recommendations to guide the appropriate use of rhTSH in clinical practice.

AIM To explore the relieving effect of Er Miao Wan on atopic dermatitis in mice.METHODS In vivo experiment:BALB/c mice were randomly divided into normal group,model group,dexamethasone group(2 mg/kg)and high,medium and low dose groups of Er Miao Wan(4.68,2.34 and 1.17 g/kg).The mouse model of atopic dermatitis was established by repeatedly smearing DNCB solution,and the model was given orally for 21 days.The skin lesion condition on the back of mice,ear swelling degree,and the weight difference between ear lobes were observed and recorded.HE staining was used to observe the histopathological changes in the skin lesion tissues of mice.Toluidine blue(TB)staining was used to observe the infiltration of mast cells in skin lesions.The expression of macrophage marker F4/80 in skin lesions was detected by IHC.The serum levels of TSLP,IL-4,IL-5 and total IgE were detected by ELISA.In vitro experiment:RAW264.7 cells in logarithmic growth period were given 400,200 and 100 μg/mL Er Miao Wan for intervention.Cell proliferation was detected by CCK-8 method.NO level in cell supernatant was detected by Griess method.TNF-α,IL-1 β and IL-6 levels in cell supernatant were detected by ELISA method.The expressions of proteins related to the MAPK/NF-κB signaling pathway in cells was detected by Western blot.RESULTS In vivo experiment:Compared with the model group,the scores of back skin lesions,the swelling degree of right ear and the weight difference between left and right ear pieces in the high-dose group of Er Miao Wan decreased(P＜0.05,P＜0.01),the thickness of skin lesions decreased,the infiltration of mast cells and macrophages decreased(P＜0.05,P＜0.01),and the inflammatory factors TSLP,IL-4,IL-5 and total IgE levels in serum decreased(P＜0.05,P＜0.01),and the expression of F4/80 in the skin lesions decreased(P＜0.01).In vitro experiment:Compared with the model group,the levels of NO,TNF-α,IL-1 β and IL-6 in Er Miao Wan 400 and 200 μg/mL groups decreased(P＜0.05,P＜0.01),and the phosphorylation levels of P38,JNK and P65 proteins decreased(P＜0.05,P＜0.01).CONCLUSION Er Miao Wan can alleviate skin lesion inflammation in DNCB-induced atopic dermatitis mice,and its mechanism may be related to inhibiting the activation of MAPK/NF-κB signaling pathway of macrophage,reducing macrophage infiltration and reducing Th2 cytokines.

Objective To evaluate the predictive value of neutrophil/high-density lipoprotein cholesterol ratio(NHR)combined with monocyte/lymphocyte ratio(MLR)for early rebleeding after endoscopic treatment in patients with cirrhosis complicated by acute esophagogastric variceal bleeding(AEVB).Methods A total of 228 patients with cirrhosis complicated by AEVB were included in this study.According to the occurrence of early rebleeding,patients were divided into the rebleeding group(96 cases)and the non-rebleeding group(132 cases).General information and laboratory indicators of both groups were collected,and the End-Stage Liver Disease(MELD)score,Child-Turcotte-Pugh(CTP)score,Fibrosis-4(FIB-4)index,NHR,and MLR were calculated.Logistic regression analysis was used to identify the risk factors for early rebleeding in patients with cirrhosis complicated by AEVB.A nomogram model based on NHR and MLR was constructed to predict the risk of early rebleeding.The predictive performance and goodness of fit of the model were evaluated using receiver operating characteristic(ROC)curve,Hosmer-Lemeshow test,Net Reclassification Index(NRI)and Integrated Discrimination Improvement(IDI).Results Compared with the non-rebleeding group,systolic blood pressure,platelet count(PLT),albumin/globulin ratio(A/G)and low-density lipoprotein cholesterol(LDL-C)were decreased in the rebleeding group,while total bile acids(TBA),aspartate aminotransferase(AST),alanine aminotransferase(ALT),total bilirubin(TBIL),activated partial thromboplastin time(APTT),thrombin time(TT),international normalized ratio(INR),Fibrosis-4(FIB-4),NHR,MLR,MELD score and CTP score were increased(P＜0.05).NHR was positively correlated with AST,TBIL and INR(P＜0.05).MLR was negatively correlated with PLT,and positively correlated with AST,TBIL and FIB-4(P＜0.05).Logistic regression analysis results showed that prolonged TT,elevated NHR and MLR were independent risk factors for early rebleeding in patients with cirrhosis complicated by AEVB.The nomogram model based on NHR and MLR to predict early rebleeding had an area under the curve of 0.810(95%CI:0.754-0.866).The Hosmer-Lemeshow test suggested that the model fit well.IDI and NRI analyse showed that the combination of NHR and MLR had better predictive value for the early rebleeding than that of MELD score and CTP score.Conclusion NHR and MLR are effective indicators for predicting early rebleeding after endoscopic treatment in patients with cirrhosis complicated by AEVB.They are helpful in the early identification of high-risk patients and provide a reference for clinical intervention.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

OBJECTIVE: Several epidemiological observational studies have related particulate matter (PM) exposure to Inflammatory bowel disease (IBD), but many confounding factors make it difficult to draw causal links from observational studies. The objective of this study was to explore the causal association between PM _2.5 exposure, its absorbance, and IBD. METHODS: We assessed the association of PM _2.5 and PM _2.5 absorbance with the two primary forms of IBD (Crohn's disease [CD] and ulcerative colitis [UC]) using Mendelian randomization (MR) to explore the causal relationship. We conducted two-sample MR analyses with aggregated data from the UK Biobank genome-wide association study. Single-nucleotide polymorphisms linked with PM _2.5 concentrations or their absorbance were used as instrumental variables (IVs). We used inverse variance weighting (IVW) as the primary analytical approach and four other standard methods as supplementary analyses for quality control. RESULTS: The results of MR demonstrated that PM _2.5 had an adverse influence on UC risk (odds ratio [ OR] = 1.010; 95% confidence interval [ CI] = 1.001-1.019, P = 0.020). Meanwhile, the results of IVW showed that PM _2.5 absorbance was also causally associated with UC ( OR = 1.012; 95% CI = 1.004-1.019, P = 0.002). We observed no causal relationship between PM _2.5, PM _2.5 absorbance, and CD. The results of sensitivity analysis indicated the absence of heterogeneity or pleiotropy, ensuring the reliability of MR results. CONCLUSION Based on two-sample MR analyses, there are potential positive causal relationships between PM _2.5, PM _2.5 absorbance, and UC.
Humans ; Mendelian Randomization Analysis ; Particulate Matter/analysis* ; Polymorphism, Single Nucleotide ; Inflammatory Bowel Diseases/genetics* ; Air Pollutants/analysis* ; Crohn Disease/genetics* ; Colitis, Ulcerative/genetics* ; Genome-Wide Association Study ; Risk Factors ; Environmental Exposure

OBJECTIVE: To investigate chronic hepatitis C virus (HCV) infection's effect on gestational liver function, pregnancy and delivery complications, and neonatal development. METHODS: A total of 157 HCV antibody-positive (anti-HCV[+]) and HCV RNA(+) patients (Group C) and 121 anti-HCV(+) and HCV RNA(-) patients (Group B) were included as study participants, while 142 anti-HCV(-) and HCV RNA(-) patients (Group A) were the control group. Data on biochemical indices during pregnancy, pregnancy complications, delivery-related information, and neonatal complications were also collected. RESULTS: Elevated alanine aminotransferase (ALT) rates in Group C during early, middle, and late pregnancy were 59.87%, 43.95%, and 42.04%, respectively-significantly higher than Groups B (26.45%, 15.70%, 10.74%) and A (23.94%, 19.01%, 6.34%) ( P < 0.05). Median ALT levels in Group C were significantly higher than in Groups A and B at all pregnancy stages ( P < 0.05). No significant differences were found in neonatal malformation rates across groups ( P > 0.05). However, neonatal jaundice incidence was significantly greater in Group C (75.16%) compared to Groups A (42.25%) and B (57.02%) ( χ ² = 33.552, P < 0.001). HCV RNA positivity during pregnancy was an independent risk factor for neonatal jaundice ( OR = 2.111, 95% CI 1.242-3.588, P = 0.006). CONCLUSIONS Chronic HCV infection can affect the liver function of pregnant women, but does not increase the pregnancy or delivery complication risks. HCV RNA(+) is an independent risk factor for neonatal jaundice.
Humans ; Female ; Pregnancy ; Adult ; Pregnancy Complications, Infectious/epidemiology* ; Retrospective Studies ; Pregnancy Outcome ; Infant, Newborn ; Viremia/virology* ; Hepatitis C ; Hepacivirus/physiology* ; Hepatitis C, Chronic/virology* ; Young Adult ; Alanine Transaminase/blood*