AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTobacco-related diseases remain one of the leading preventable public health challenges worldwide and are among the primary causes of premature death. In recent years, accumulating evidence has supported the classification of nicotine addiction as a chronic brain disease, profoundly affecting both brain structure and function. Despite the urgency, effective diagnostic methods for smoking addiction remain lacking, posing significant challenges for early intervention and treatment. To address this issue and gain deeper insights into the neural mechanisms underlying nicotine dependence, this study proposes a novel graph neural network framework, termed TI-GNN. This model leverages functional magnetic resonance imaging (fMRI) data to identify complex and subtle abnormalities in brain connectivity patterns associated with smoking addiction. MethodsThe study utilizes fMRI data to construct functional connectivity matrices that represent interaction patterns among brain regions. These matrices are interpreted as graphs, where brain regions are nodes and the strength of functional connectivity between them serves as edges. The proposed TI-GNN model integrates a Transformer module to effectively capture global interactions across the entire brain network, enabling a comprehensive understanding of high-level connectivity patterns. Additionally, a spatial attention mechanism is employed to selectively focus on informative inter-regional connections while filtering out irrelevant or noisy features. This design enhances the model’s ability to learn meaningful neural representations crucial for classification tasks. A key innovation of TI-GNN lies in its built-in causal interpretation module, which aims to infer directional and potentially causal relationships among brain regions. This not only improves predictive performance but also enhances model interpretability—an essential attribute for clinical applications. The identification of causal links provides valuable insights into the neuropathological basis of addiction and contributes to the development of biologically plausible and trustworthy diagnostic tools. ResultsExperimental results demonstrate that the TI-GNN model achieves superior classification performance on the smoking addiction dataset, outperforming several state-of-the-art baseline models. Specifically, TI-GNN attains an accuracy of 0.91, an F1-score of 0.91, and a Matthews correlation coefficient (MCC) of 0.83, indicating strong robustness and reliability. Beyond performance metrics, TI-GNN identifies critical abnormal connectivity patterns in several brain regions implicated in addiction. Notably, it highlights dysregulations in the amygdala and the anterior cingulate cortex, consistent with prior clinical and neuroimaging findings. These regions are well known for their roles in emotional regulation, reward processing, and impulse control—functions that are frequently disrupted in nicotine dependence. ConclusionThe TI-GNN framework offers a powerful and interpretable tool for the objective diagnosis of smoking addiction. By integrating advanced graph learning techniques with causal inference capabilities, the model not only achieves high diagnostic accuracy but also elucidates the neurobiological underpinnings of addiction. The identification of specific abnormal brain networks and their causal interactions deepens our understanding of addiction pathophysiology and lays the groundwork for developing targeted intervention strategies and personalized treatment approaches in the future.

The purpose of the present study was to investigate the effects of resistance combined with aerobic chrono-exercise on the common carotid artery elasticity and hemodynamics. 24 healthy young men (21.96±0.43 years old) underwent a single acute resistance combined with aerobic exercise intervention at eight time periods (6, 8, 10, 12, 14, 16, 18, and 20 o'clock). The axial flow velocity and diameter waveforms of the common carotid artery were measured, and the hemodynamics were calculated using the classical hemodynamic theory before exercise, immediately after exercise, 10 min and 20 min after exercise. The results showed that during exercise recovery, systolic and mean pressures decreased more markedly after exercise at 8 o'clock (P < 0.05); At 20 min post-exercise, arterial stiffness index and pressure-strain elastic modulus after exercise at 6 o'clock were reduced compared with the resting state, but were significantly elevated after exercise at 20 o'clock (P < 0.05). Immediately after exercise, the pressure rise was higher after exercise at 6 o'clock and the mean wall shear stress was higher after exercise at 20 o'clock (P < 0.05). These results suggest that resistance combined with aerobic chrono-exercise produces different effects on common carotid artery hemodynamics in young men. A single acute session of resistance combined with aerobic exercise at 8 o'clock is more effective in lowering blood pressure. Exercise at 6 o'clock is beneficial to improve arterial elasticity but is not recommended for young male individuals with cardiovascular disease risks because of the excessive increase in blood pressure immediately after exercise. Exercise at 20 o'clock is more effective in improving wall shear stress but is accompanied by elevated arterial stiffness indices and pressure-strain elastic modulus. These results provide a scientific basis for healthy young men in choosing the time of exercise by exploring the common carotid artery elasticity and hemodynamic-related indices.
Humans ; Male ; Young Adult ; Exercise/physiology* ; Carotid Artery, Common/physiology* ; Hemodynamics/physiology* ; Vascular Stiffness/physiology* ; Elasticity ; Resistance Training ; Adult

Metabonomics and proteomics were employed to investigate the mechanism of Yuzhi Zhixue Granules in treating polycystic ovary syndrome with insulin resistance(PCOS-IR). The disease model was established by feeding a high-fat diet and gavage of letrozole solution and it was then treated with different doses of Yuzhi Zhixue Granules. The therapeutic effect of Yuzhi Zhixue Granules was evaluated based on the body mass, homeostasis model assessment of insulin resistance and insulin sensitivity index, serum levels of adipokines, and histopathological changes of rats. Metabolomics and proteomics were employed to find the action pathways of Yuzhi Zhixue Granules. The results showed that Yuzhi Zhixue Granules reduced the body mass, improved the insulin sensitivity and aromatase activity, improved the levels of leptin, adiponectin and other adipokines, and alleviated insulin resistance, histopathological changes, and metabolic disorders in PCOS-IR rats. Metabolomics results revealed 14 metabolites with altered levels in the ovarian tissue, which were closely related to glutathione metabolism and pyruvate metabolism. Proteomics results showed that the therapeutic effect of Yuzhi Zhixue Granules was mainly related to the adipokine, adenosine 5'-monophosphate(AMP)-activated protein kinase(AMPK), phosphatidylinositol 3-kinase/protein kinase B(PI3K/Akt), forkhead box protein O(FoxO), and mechanistic target of rapamycin(mTOR) signaling pathways. Western blot results showed that compared with the model group, Yuzhi Zhixue Granules treatment decreased the p-AMPK/AMPK and p-FoxO1/FoxO1 levels, increased the p-mTOR/mTOR level, and up-regulated the expression level of recombinant glucose transporter 4(GLUT4). Yuzhi Zhixue Granules can balance amino acid metabolism and pyruvate metabolism by regulating the AMPK/mTOR/FoxO/GLUT pathway to maintain the homeostasis of the ovarian environment and alleviate insulin resistance, thus treating PCOS-IR.
Animals ; Female ; Insulin Resistance ; Polycystic Ovary Syndrome/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Metabolomics ; Proteomics ; Rats, Sprague-Dawley ; Humans ; Ovary/metabolism* ; Signal Transduction/drug effects*

Sepsis is a systemic inflammatory response caused by severe infection or trauma, and is one of the common causes of acute lung injury(ALI) and acute respiratory distress syndrome(ARDS). Sepsis-acute lung injury(SALI) is a critical clinical condition with high morbidity and mortality. Its pathogenesis is complex and not yet fully understood, and there is currently a lack of targeted and effective treatment options. Pyroptosis, a novel form of programmed cell death, plays a key role in the pathological process of SALI by activating inflammasomes and releasing inflammatory factors, making it a potential therapeutic target. In recent years, the role of traditional Chinese medicine(TCM) in regulating signaling pathways related to pyroptosis through multi-components and multi-targets has attracted increasing attention. TCM may intervene in pyroptosis by inhibiting the activation of NLRP3 inflammasomes and regulating the expression of Caspase family proteins, thus alleviating inflammatory damage in lung tissues. This paper systematically reviews the molecular regulatory network of pyroptosis in SALI and explores the potential mechanisms and research progress on TCM intervention in cellular pyroptosis. The aim is to provide new ideas and theoretical support for basic research and clinical treatment strategies of TCM in SALI.
Pyroptosis/drug effects* ; Humans ; Sepsis/genetics* ; Acute Lung Injury/physiopathology* ; Animals ; Drugs, Chinese Herbal/therapeutic use* ; Medicine, Chinese Traditional ; Inflammasomes/metabolism* ; NLR Family, Pyrin Domain-Containing 3 Protein/genetics*

Subtype classification of age-related macular degeneration (AMD) based on optical coherence tomography (OCT) images serves as an effective auxiliary tool for clinicians in diagnosing disease progression and formulating treatment plans. To improve the classification accuracy of AMD subtypes, this study proposes a keypoint-based, attention-enhanced residual network (KPA-ResNet). The proposed architecture adopts a 50-layer residual network (ResNet-50) as the backbone, preceded by a keypoint localization module based on heatmap regression to outline critical lesion regions. A two-dimensional relative self-attention mechanism is incorporated into convolutional layers to enhance the representation of key lesion areas. Furthermore, the network depth is appropriately increased and an improved residual module, ConvNeXt, is introduced to enable comprehensive extraction of high-dimensional features and enrich the detail of lesion boundary contours, ultimately achieving higher classification accuracy of AMD subtypes. Experimental results demonstrate that KPA-ResNet achieves significant improvements in overall classification accuracy compared with conventional convolutional neural networks. Specifically, for the wet AMD subtypes, the classification accuracies for inactive choroidal neovascularization (CNV) and active CNV reach 92.8% and 95.2%, respectively, representing substantial improvement over ResNet-50. These findings validate the superior performance of KPA-ResNet in AMD subtype classification tasks. This work provides a high-accuracy, generalizable network architecture for OCT-based AMD subtype classification and offers new insights into integrating attention mechanisms with convolutional neural networks in ophthalmic image analysis.
Tomography, Optical Coherence/methods* ; Humans ; Macular Degeneration/diagnostic imaging* ; Neural Networks, Computer

OBJECTIVE: Several epidemiological observational studies have related particulate matter (PM) exposure to Inflammatory bowel disease (IBD), but many confounding factors make it difficult to draw causal links from observational studies. The objective of this study was to explore the causal association between PM _2.5 exposure, its absorbance, and IBD. METHODS: We assessed the association of PM _2.5 and PM _2.5 absorbance with the two primary forms of IBD (Crohn's disease [CD] and ulcerative colitis [UC]) using Mendelian randomization (MR) to explore the causal relationship. We conducted two-sample MR analyses with aggregated data from the UK Biobank genome-wide association study. Single-nucleotide polymorphisms linked with PM _2.5 concentrations or their absorbance were used as instrumental variables (IVs). We used inverse variance weighting (IVW) as the primary analytical approach and four other standard methods as supplementary analyses for quality control. RESULTS: The results of MR demonstrated that PM _2.5 had an adverse influence on UC risk (odds ratio [ OR] = 1.010; 95% confidence interval [ CI] = 1.001-1.019, P = 0.020). Meanwhile, the results of IVW showed that PM _2.5 absorbance was also causally associated with UC ( OR = 1.012; 95% CI = 1.004-1.019, P = 0.002). We observed no causal relationship between PM _2.5, PM _2.5 absorbance, and CD. The results of sensitivity analysis indicated the absence of heterogeneity or pleiotropy, ensuring the reliability of MR results. CONCLUSION Based on two-sample MR analyses, there are potential positive causal relationships between PM _2.5, PM _2.5 absorbance, and UC.
Humans ; Mendelian Randomization Analysis ; Particulate Matter/analysis* ; Polymorphism, Single Nucleotide ; Inflammatory Bowel Diseases/genetics* ; Air Pollutants/analysis* ; Crohn Disease/genetics* ; Colitis, Ulcerative/genetics* ; Genome-Wide Association Study ; Risk Factors ; Environmental Exposure

OBJECTIVE: To investigate chronic hepatitis C virus (HCV) infection's effect on gestational liver function, pregnancy and delivery complications, and neonatal development. METHODS: A total of 157 HCV antibody-positive (anti-HCV[+]) and HCV RNA(+) patients (Group C) and 121 anti-HCV(+) and HCV RNA(-) patients (Group B) were included as study participants, while 142 anti-HCV(-) and HCV RNA(-) patients (Group A) were the control group. Data on biochemical indices during pregnancy, pregnancy complications, delivery-related information, and neonatal complications were also collected. RESULTS: Elevated alanine aminotransferase (ALT) rates in Group C during early, middle, and late pregnancy were 59.87%, 43.95%, and 42.04%, respectively-significantly higher than Groups B (26.45%, 15.70%, 10.74%) and A (23.94%, 19.01%, 6.34%) ( P < 0.05). Median ALT levels in Group C were significantly higher than in Groups A and B at all pregnancy stages ( P < 0.05). No significant differences were found in neonatal malformation rates across groups ( P > 0.05). However, neonatal jaundice incidence was significantly greater in Group C (75.16%) compared to Groups A (42.25%) and B (57.02%) ( χ ² = 33.552, P < 0.001). HCV RNA positivity during pregnancy was an independent risk factor for neonatal jaundice ( OR = 2.111, 95% CI 1.242-3.588, P = 0.006). CONCLUSIONS Chronic HCV infection can affect the liver function of pregnant women, but does not increase the pregnancy or delivery complication risks. HCV RNA(+) is an independent risk factor for neonatal jaundice.
Humans ; Female ; Pregnancy ; Adult ; Pregnancy Complications, Infectious/epidemiology* ; Retrospective Studies ; Pregnancy Outcome ; Infant, Newborn ; Viremia/virology* ; Hepatitis C ; Hepacivirus/physiology* ; Hepatitis C, Chronic/virology* ; Young Adult ; Alanine Transaminase/blood*

OBJECTIVE: Lipid oxidation is involved in the pathogenesis of atherosclerosis and may be contribute to the development of Ischemic stroke (IS). However, the lipid profiles associated with IS have been poorly studied. We conducted a pilot study to identify potential IS-related lipid molecules and pathways using lipidomic profiling. METHODS: Serum lipidomic profiling was performed using LC-MS in 20 patients with IS and 20 age- and sex-matched healthy controls. Univariate and multivariate analyses were simultaneously performed to identify the differential lipids. Multiple testing was controlled for using a false discovery rate (FDR) approach. Enrichment analysis was performed using MetaboAnalyst software. RESULTS: Based on the 294 lipids assayed, principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA) models were used to distinguish patients with IS from healthy controls. Fifty-six differential lipids were identified with an FDR-adjusted P less than 0.05 and variable influences in projection (VIP) greater than 1.0. These lipids were significantly enriched in glycerophospholipid metabolism (FDR-adjusted P = 0.009, impact score = 0.216). CONCLUSIONS Serum lipid profiles differed significantly between patients with IS and healthy controls. Thus, glycerophospholipid metabolism may be involved in the development of IS. These results provide initial evidence that lipid molecules and their related metabolites may serve as new biomarkers and potential therapeutic targets for IS.
Humans ; Pilot Projects ; Lipidomics ; Male ; Female ; Biomarkers/blood* ; Middle Aged ; Ischemic Stroke/blood* ; Aged ; China ; Lipids/blood* ; Adult ; Case-Control Studies ; East Asian People

OBJECTIVE: This study aimed to explore the association between body mass index (BMI) and mortality based on the 10-year population-based multicenter prospective study. METHODS: A general population-based multicenter prospective study was conducted at four sites in rural China between 2013 and 2023. Multivariate Cox proportional hazards models and restricted cubic spline analyses were used to assess the association between BMI and mortality. Stratified analyses were performed based on the individual characteristics of the participants. RESULTS: Overall, 19,107 participants with a sum of 163,095 person-years were included and 1,910 participants died. The underweight (< 18.5 kg/m ²) presented an increase in all-cause mortality (adjusted hazards ratio [ aHR] = 2.00, 95% confidence interval [ CI]: 1.66-2.41), while overweight (≥ 24.0 to < 28.0 kg/m ²) and obesity (≥ 28.0 kg/m ²) presented a decrease with an aHR of 0.61 (95% CI: 0.52-0.73) and 0.51 (95% CI: 0.37-0.70), respectively. Overweight ( aHR = 0.76, 95% CI: 0.67-0.86) and mild obesity ( aHR = 0.72, 95% CI: 0.59-0.87) had a positive impact on mortality in people older than 60 years. All-cause mortality decreased rapidly until reaching a BMI of 25.7 kg/m ² ( aHR = 0.95, 95% CI: 0.92-0.98) and increased slightly above that value, indicating a U-shaped association. The beneficial impact of being overweight on mortality was robust in most subgroups and sensitivity analyses. CONCLUSION This study provides additional evidence that overweight and mild obesity may be inversely related to the risk of death in individuals older than 60 years. Therefore, it is essential to consider age differences when formulating health and weight management strategies.
Humans ; Body Mass Index ; China/epidemiology* ; Male ; Female ; Middle Aged ; Prospective Studies ; Rural Population/statistics & numerical data* ; Aged ; Follow-Up Studies ; Adult ; Mortality ; Cause of Death ; Obesity/mortality* ; Overweight/mortality*