AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThe present study aimed to investigate alterations in white matter microstructure and spontaneous neural activity in male college smokers, and to further explore their associations with nicotine dependence. Given that adolescence and early adulthood represent critical periods for brain maturation, particularly for white matter development, understanding the neural correlates of smoking behavior during this stage is of substantial importance for both neuroscience and public health. MethodsA total of 115 male undergraduate students were initially recruited for this study. After quality control and exclusion procedures, 52 male college smokers and 42 demographically matched healthy non-smokers were included in the final analysis. All participants underwent multimodal magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI) and resting-state functional MRI (rs-fMRI). White matter fiber tracts were reconstructed using the automated fiber quantification (AFQ) method, which enables precise identification and quantification of major fiber bundles. Eighteen major white matter tracts were segmented for each participant. Along the core trajectory of each tract, 100 equidistant nodes were sampled. Fractional anisotropy (FA) was calculated at each node to assess white matter microstructural integrity, while amplitude of low-frequency fluctuation (ALFF) was computed to evaluate spontaneous neural activity within white matter tracts. Between-group differences in FA and ALFF were assessed using two-sample t-tests, with appropriate corrections applied for multiple comparisons. Furthermore, Pearson correlation analyses were conducted to examine the relationships between imaging-derived metrics (FA and ALFF values in regions showing significant group differences) and nicotine dependence severity, as measured by the Fagerström test for nicotine dependence (FTND). ResultsCompared with healthy non-smokers, male college smokers exhibited significantly increased FA values in several white matter tracts, including the left thalamic radiation, right corticospinal tract, forceps major of the corpus callosum, left uncinate fasciculus, and right arcuate fasciculus. These findings suggest altered microstructural organization or increased directional coherence within these pathways. In addition, smokers demonstrated significantly elevated ALFF values in the forceps major, right uncinate fasciculus, and left arcuate fasciculus, indicating enhanced spontaneous neural activity in these white matter regions. Correlation analyses revealed that FA values in the left thalamic radiation and right corticospinal tract were negatively correlated with FTND scores, suggesting that higher levels of nicotine dependence were associated with reduced microstructural integrity or altered fiber organization in these regions. In contrast, ALFF values in the forceps major and right uncinate fasciculus were positively correlated with FTND scores, indicating that greater nicotine dependence was associated with increased spontaneous neural activity in specific white matter pathways. ConclusionThe present study provides evidence that male college smokers exhibit distinct alterations in both white matter microstructure and functional activity. These abnormalities are not uniformly distributed but rather localized to specific fiber tracts implicated in sensorimotor processing, interhemispheric communication, and higher-order cognitive and emotional regulation. Importantly, the observed associations between imaging metrics and nicotine dependence severity suggest that these structural and functional alterations may reflect neurobiological mechanisms underlying addiction. The combination of AFQ-based tract profiling and multimodal MRI offers a sensitive approach for detecting subtle changes along white matter pathways, highlighting its potential utility in identifying neuroimaging biomarkers of nicotine dependence. Overall, these findings indicate that smoking during early adulthood may disrupt ongoing white matter maturation, potentially leading to long-term consequences for brain function. This study provides novel insights into the neural basis of nicotine dependence and underscores the importance of early intervention and prevention strategies targeting young smokers.

To address the growing challenge of an increasing number of elderly lung cancer patients amidst China's aging population and to fill the gap in quality control standards for surgical treatment in this special population, this study aimed to develop a standardized surgical evaluation system for elderly lung cancer patients tailored to China's national conditions. The system was established through a literature review, integrated the pathophysiological characteristics of elderly patients, and was constructed following review, feedback, and revision by experts from multiple thoracic surgery centers. Employing a 100-point scoring system, it comprises three primary domains: physical infrastructure and geriatric adaptability foundational conditions (10 points); management level and perioperative care models (20 points); and technical proficiency and clinical outcomes (70 points). The system places a strong emphasis on geriatric adaptability, proposing specific, quantifiable indicators for age-friendly facility modifications, control of elderly-specific complications, multidisciplinary collaboration, and standardized perioperative management. It provides a convenient and measurable assessment tool for quality control in the surgical treatment of elderly lung cancer in China, which is expected to promote the standardization and homogenization of diagnosis and treatment.

Objective To investigate the etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate (HoLEP) for benign prostatic hyperplasia (BPH), so as to improve the therapeutic efficacy. Methods A retrospective analysis was conducted on 1361 BPH patients who received HoLEP at our hospital during Mar. 2018 and Mar. 2025. All patients underwent ultrasound, computed tomography (CT), urethral probing or radiography, cystourethroscopy, and urodynamic testing. The causes, treatments and prognosis of dysuria after operation were summarized. Results ninety-eight patients (7.2%) experienced dysuria within 3 months after surgery, and all patients received initial urethral dilation. Among the 62 cases with urethral stricture, 28 were treated with urethral dilation (average of 8 sessions), 16 underwent external urethral incision, 8 underwent anterior urethroplasty, and 10 underwent transurethral plasma incision for urethral stricture. Of the 12 cases with residual prostate tissue, 5 underwent urethral plasma prostatectomy and 7 received medication. All of the 12 cases with bladder neck contracture underwent transurethral plasma incision of the bladder neck and local drug injection. Five cases with intravesical blood clots underwent urethral blood clot irrigation, 2 of which developed active bleeding and then underwent electrocoagulation. Four cases with detrusor dysfunction had catheters re-indwelled for one week followed by medication. Two cases with stone and one case with tissue fragment impacted in the urethra underwent urethral holmium lithotripsy and cystoscopic removal. All patients underwent reoperation successfully and experienced complete resolution or significant improvement of urinary difficulties. Conclusion A certain proportion of patients experience dysuria after HoLEP, with diverse etiologies. The combination of prevention and treatment can reduce the incidence of dysuria.

The purpose of the present study was to investigate the effects of resistance combined with aerobic chrono-exercise on the common carotid artery elasticity and hemodynamics. 24 healthy young men (21.96±0.43 years old) underwent a single acute resistance combined with aerobic exercise intervention at eight time periods (6, 8, 10, 12, 14, 16, 18, and 20 o'clock). The axial flow velocity and diameter waveforms of the common carotid artery were measured, and the hemodynamics were calculated using the classical hemodynamic theory before exercise, immediately after exercise, 10 min and 20 min after exercise. The results showed that during exercise recovery, systolic and mean pressures decreased more markedly after exercise at 8 o'clock (P < 0.05); At 20 min post-exercise, arterial stiffness index and pressure-strain elastic modulus after exercise at 6 o'clock were reduced compared with the resting state, but were significantly elevated after exercise at 20 o'clock (P < 0.05). Immediately after exercise, the pressure rise was higher after exercise at 6 o'clock and the mean wall shear stress was higher after exercise at 20 o'clock (P < 0.05). These results suggest that resistance combined with aerobic chrono-exercise produces different effects on common carotid artery hemodynamics in young men. A single acute session of resistance combined with aerobic exercise at 8 o'clock is more effective in lowering blood pressure. Exercise at 6 o'clock is beneficial to improve arterial elasticity but is not recommended for young male individuals with cardiovascular disease risks because of the excessive increase in blood pressure immediately after exercise. Exercise at 20 o'clock is more effective in improving wall shear stress but is accompanied by elevated arterial stiffness indices and pressure-strain elastic modulus. These results provide a scientific basis for healthy young men in choosing the time of exercise by exploring the common carotid artery elasticity and hemodynamic-related indices.
Humans ; Male ; Young Adult ; Exercise/physiology* ; Carotid Artery, Common/physiology* ; Hemodynamics/physiology* ; Vascular Stiffness/physiology* ; Elasticity ; Resistance Training ; Adult

Metabonomics and proteomics were employed to investigate the mechanism of Yuzhi Zhixue Granules in treating polycystic ovary syndrome with insulin resistance(PCOS-IR). The disease model was established by feeding a high-fat diet and gavage of letrozole solution and it was then treated with different doses of Yuzhi Zhixue Granules. The therapeutic effect of Yuzhi Zhixue Granules was evaluated based on the body mass, homeostasis model assessment of insulin resistance and insulin sensitivity index, serum levels of adipokines, and histopathological changes of rats. Metabolomics and proteomics were employed to find the action pathways of Yuzhi Zhixue Granules. The results showed that Yuzhi Zhixue Granules reduced the body mass, improved the insulin sensitivity and aromatase activity, improved the levels of leptin, adiponectin and other adipokines, and alleviated insulin resistance, histopathological changes, and metabolic disorders in PCOS-IR rats. Metabolomics results revealed 14 metabolites with altered levels in the ovarian tissue, which were closely related to glutathione metabolism and pyruvate metabolism. Proteomics results showed that the therapeutic effect of Yuzhi Zhixue Granules was mainly related to the adipokine, adenosine 5'-monophosphate(AMP)-activated protein kinase(AMPK), phosphatidylinositol 3-kinase/protein kinase B(PI3K/Akt), forkhead box protein O(FoxO), and mechanistic target of rapamycin(mTOR) signaling pathways. Western blot results showed that compared with the model group, Yuzhi Zhixue Granules treatment decreased the p-AMPK/AMPK and p-FoxO1/FoxO1 levels, increased the p-mTOR/mTOR level, and up-regulated the expression level of recombinant glucose transporter 4(GLUT4). Yuzhi Zhixue Granules can balance amino acid metabolism and pyruvate metabolism by regulating the AMPK/mTOR/FoxO/GLUT pathway to maintain the homeostasis of the ovarian environment and alleviate insulin resistance, thus treating PCOS-IR.
Animals ; Female ; Insulin Resistance ; Polycystic Ovary Syndrome/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Metabolomics ; Proteomics ; Rats, Sprague-Dawley ; Humans ; Ovary/metabolism* ; Signal Transduction/drug effects*

Sepsis is a systemic inflammatory response caused by severe infection or trauma, and is one of the common causes of acute lung injury(ALI) and acute respiratory distress syndrome(ARDS). Sepsis-acute lung injury(SALI) is a critical clinical condition with high morbidity and mortality. Its pathogenesis is complex and not yet fully understood, and there is currently a lack of targeted and effective treatment options. Pyroptosis, a novel form of programmed cell death, plays a key role in the pathological process of SALI by activating inflammasomes and releasing inflammatory factors, making it a potential therapeutic target. In recent years, the role of traditional Chinese medicine(TCM) in regulating signaling pathways related to pyroptosis through multi-components and multi-targets has attracted increasing attention. TCM may intervene in pyroptosis by inhibiting the activation of NLRP3 inflammasomes and regulating the expression of Caspase family proteins, thus alleviating inflammatory damage in lung tissues. This paper systematically reviews the molecular regulatory network of pyroptosis in SALI and explores the potential mechanisms and research progress on TCM intervention in cellular pyroptosis. The aim is to provide new ideas and theoretical support for basic research and clinical treatment strategies of TCM in SALI.
Pyroptosis/drug effects* ; Humans ; Sepsis/genetics* ; Acute Lung Injury/physiopathology* ; Animals ; Drugs, Chinese Herbal/therapeutic use* ; Medicine, Chinese Traditional ; Inflammasomes/metabolism* ; NLR Family, Pyrin Domain-Containing 3 Protein/genetics*

Subtype classification of age-related macular degeneration (AMD) based on optical coherence tomography (OCT) images serves as an effective auxiliary tool for clinicians in diagnosing disease progression and formulating treatment plans. To improve the classification accuracy of AMD subtypes, this study proposes a keypoint-based, attention-enhanced residual network (KPA-ResNet). The proposed architecture adopts a 50-layer residual network (ResNet-50) as the backbone, preceded by a keypoint localization module based on heatmap regression to outline critical lesion regions. A two-dimensional relative self-attention mechanism is incorporated into convolutional layers to enhance the representation of key lesion areas. Furthermore, the network depth is appropriately increased and an improved residual module, ConvNeXt, is introduced to enable comprehensive extraction of high-dimensional features and enrich the detail of lesion boundary contours, ultimately achieving higher classification accuracy of AMD subtypes. Experimental results demonstrate that KPA-ResNet achieves significant improvements in overall classification accuracy compared with conventional convolutional neural networks. Specifically, for the wet AMD subtypes, the classification accuracies for inactive choroidal neovascularization (CNV) and active CNV reach 92.8% and 95.2%, respectively, representing substantial improvement over ResNet-50. These findings validate the superior performance of KPA-ResNet in AMD subtype classification tasks. This work provides a high-accuracy, generalizable network architecture for OCT-based AMD subtype classification and offers new insights into integrating attention mechanisms with convolutional neural networks in ophthalmic image analysis.
Tomography, Optical Coherence/methods* ; Humans ; Macular Degeneration/diagnostic imaging* ; Neural Networks, Computer

Objective Zinc finger protein 335 (Zfp335) plays a crucial role in the early development of thymic T cells and the differentiation of peripheral T cell subpopulations. The objective of this study is to investigate the role and underlying mechanisms of Zfp335 in the regulation of regulatory T cell (Treg) within tumor immunity. Methods The Zfp335 gene was specifically knocked out in Treg using tamoxifen (Zfp335^fl/fl FOXP3^creERT2), and the MC38 tumor model was established. On the 7th day after tumor inoculation, tumor size was observed and measured. Tumor size was monitored and recorded daily starting from day 7 post-inoculation. On day 12, tumors were harvested, and the proportions of CD4⁺ T cells, CD8⁺ T cells, and Treg were analyzed by flow cytometry. Additionally, the mitochondrial function of effector regulatory T cell (eTreg) was assessed. Results From day 10 post-tumor inoculation, tumor volume in the Zfp335^CKO group was significantly reduced compared to that of the wild-type (WT) group. Furthermore, the infiltration of CD4⁺ and CD8⁺ T cells, along with their respective effector cells, was significantly higher in the Zfp335^CKO group than in the WT group. The proportions of CD4⁺ and CD8⁺ T cells producing interferon-gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α) were also significantly increased in the Zfp335^CKO group compared to that of the WT group. In addition, the percentage of CD8⁺ T cells secreting granzyme B (GzmB) was significantly higher in the Zfp335^CKO group than that in the WT group. In contrast, the proportion of Treg and inducible T cell co-stimulator (ICOS)⁺ Treg in the Zfp335^CKO group was significantly lower than that in the WT group. Finally, the expression level of Mitotracker Deep Red in eTreg from the Zfp335^CKO group was significantly reduced compared to that in the WT group. Conclusion During tumorigenesis, the specific deletion of Zfp335 impairs Treg activation, which is related to decreased mitochondrial function in eTreg. In Zfp335^CKO mice. Tumors exhibit increased infiltration of effector T cells, accompanied by elevated levels of cytotoxic cytokines, ultimately enhancing resistance to tumor progression.
Animals ; T-Lymphocytes, Regulatory/metabolism* ; Mice ; CD8-Positive T-Lymphocytes/immunology* ; Neoplasms/genetics* ; Cell Line, Tumor ; Mice, Inbred C57BL ; Mice, Knockout ; DNA-Binding Proteins/genetics* ; Female

Patients with Noonan syndrome (NS) are born with normal or slightly lower body length and weight compared to the normal ranges. However, their height gradually falls behind that of the general population, leading to growth retardation and delayed puberty. In China, the incidence of short stature in patients with NS is approximately 65%. Short stature in these patients arises from multiple causes, including feeding difficulties in infancy, comorbidities such as congenital heart disease, genetic heterogeneity, and disorders of the growth hormone/insulin-like growth factor-1 axis. Growth hormone is commonly used to alleviate symptoms of short stature. This article reviews the growth and development patterns at different stages of NS, analyzes the causes of short stature, and summarizes the latest advances in treatment to provide new insights for the diagnosis and management of short stature in patients with NS.
Noonan Syndrome/complications* ; Humans ; Body Height ; Growth Disorders/therapy*