1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
3.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
4.A fetus with Neurodevelopmental disorders with deformed facial features and distal skeletal abnormalities due to a rare variant of ZMIZ1 gene and literature review.
Jinghui ZOU ; Haibo LI ; Lulu YAN
Chinese Journal of Medical Genetics 2026;43(4):295-300
OBJECTIVE:
To investigate the clinical manifestations and genetic etiology of a fetus with Neurodevelopmental disorders with deformed facial features and distal skeletal abnormalities (NEDDFSA).
METHODS:
Clinical data of a NEDDFSA fetus diagnosed at the Affiliated Women and Children's Hospital Affiliated to Ningbo University in March 2025 was selected as the study subject. Whole-exome sequencing (WES) was carried out on the amniotic fluid and parental peripheral blood samples, and candidate variants was verified by Sanger sequencing. The pathogenicity of candidate variant was rated based on guidelines from the American College of Medical Genetics and Genomics (ACMG). This study was approved by the Medical Ethics Committee of the hospital (Ethics No.: EC2023-094).
RESULTS:
At 30 weeks of gestation, the fetus was found to have microcephaly, short femur and intrauterine growth restriction. WES revealed that the fetus harbored a de novo heterozygous frameshift variant c.2633dup (p.Gly879ArgfsTer22) of the ZMIZ1 gene, which was rated as pathogenic (PM2_Supporting+PS2_Supporting+PVS1). Combined with 25 cases from the literature, the main manifestations of patients have included intellectual disability, growth retardation and cranio-limb skeletal dysplasia, albeit without clear genotype-phenotype correlation.
CONCLUSION
The de novo variant c.2633dup (p.Gly879ArgfsTer22) of the ZMIZ1 gene probably underlay the NEDDFSA in this fetus. Genetic testing has enabled accurate prenatal diagnosis and provided evidence for genetic counseling and reproductive guidance of this family.
Humans
;
Female
;
Pregnancy
;
Neurodevelopmental Disorders/genetics*
;
Transcription Factors/genetics*
;
Fetus/abnormalities*
;
Exome Sequencing
;
Prenatal Diagnosis
5.Applications of Lactoferrin and Its Nanoparticles in Cancer Therapy
Wen-Tian YUE ; Shu-Rong HE ; Qin AN ; Yun-Xia ZOU ; Wen-Wen DONG ; Qing-Yong MENG ; Ya-Li ZHANG
Progress in Biochemistry and Biophysics 2026;53(2):342-355
Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.
6.Applications of Lactoferrin and Its Nanoparticles in Cancer Therapy
Wen-Tian YUE ; Shu-Rong HE ; Qin AN ; Yun-Xia ZOU ; Wen-Wen DONG ; Qing-Yong MENG ; Ya-Li ZHANG
Progress in Biochemistry and Biophysics 2026;53(2):342-355
Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.
7.Choline kinase alpha silencing affects proliferation and apoptosis in glioma cells by inducing mitochondrial dysfunction
Yang ZHAO ; Jialin LI ; Xiao WU ; Yourui ZOU ; Yang LIU ; Hui MA
Chinese Journal of Tissue Engineering Research 2026;30(1):130-138
BACKGROUND:Choline kinase alpha is a key enzyme in phospholipid metabolism,involved in the synthesis of phosphatidylcholine,and plays an important role in maintaining cell membrane integrity and signal transduction.Research has shown that choline kinase alpha is highly expressed in various tumors and is closely related to cell proliferation,metabolic reprogramming,and tumor progression.As a potential therapeutic target,the role of choline kinase alpha in tumor metabolism and mitochondrial function still needs further exploration.OBJECTIVE:To evaluate the effects and the underlying mechanisms of choline kinase alpha on the proliferation and apoptosis of glioma U87MG and U251 cells.METHODS:Short hairpin RNA of choline kinase alpha and its empty vector control were transfected into U87MG and U251 glioma cells.Mitochondrial morphology was observed by transmission electron microscopy.Mitochondrial structure and functional protein levels were assessed by western blot assay.Reactive oxygen species levels in cells were measured using a reactive oxygen species fluorescent probe.Mitochondrial membrane potential was assessed with a JC-1 assay.Intracellular adenosine triphosphate levels were measured by chemiluminescence.Cell proliferation was evaluated using a CCK-8 assay.Apoptosis levels were analyzed by flow cytometry.The mitochondrial fission inhibitor Mdivi-1 was used to protect the mitochondrial function of the choline kinase α-silenced lentiviral cells.Finally,U87MG cells were subcutaneously injected to construct a subcutaneous tumor model in nude mice.The tumor growth in nude mice was observed before and after choline kinase alpha silencing and after the use of the mitochondrial fission inhibitor Mdivi-1.RESULTS AND CONCLUSION:(1)Compared with the empty control group,the mitochondria of U87MG and U251 cells in the choline kinase alpha silencing lentivirus group exhibited significant structural abnormalities in mitochondria,such as vacuolization and cristae disruption.The expressions of mitochondrial structure and function-related proteins TOM20,ACO2,and ATP5A were significantly decreased(P<0.01,P<0.001),the expression of SOD2 was significantly increased(P<0.01,P<0.000 1),the fluorescence intensity of reactive oxygen species was significantly increased(P<0.01),the mitochondrial membrane potential and adenosine triphosphate level were significantly decreased(P<0.01,P<0.001),the cell proliferation ability was reduced(P<0.01),and the apoptosis level was increased(P<0.001).(2)Following Mdivi-1 treatment,the fluorescence intensity of reactive oxygen species in U87MG and U251 cells decreased(P<0.05,P<0.01),mitochondrial membrane potential and adenosine triphosphate levels were significantly restored(P<0.05,P<0.01,P<0.001),cell proliferation ability was improved(P<0.05,P<0.01),and apoptosis level was decreased(P<0.05).(3)In addition,the in vitro subcutaneous tumor formation experiment of nude mice showed that compared with the empty control group,the mass and growth rate of subcutaneous tumors formed by U87MG cells in the choline kinase alpha silencing lentivirus group were significantly reduced(P<0.000 1).After Mdivi-1 treatment,the mass and growth rate of tumors were significantly increased(P<0.000 1).(4)The results show that choline kinase alpha silencing affects the proliferation and apoptosis of glioma cells by inducing mitochondrial dysfunction.
8.Development and evaluation of classification system for drug-related problems in China
Shuang ZOU ; Tingting LU ; Lei BAO ; Yun LIAO ; Ling LI ; Ping ZHANG
China Pharmacy 2026;37(3):371-376
OBJECTIVE To establish a Chinese drug-related problem (DRP) classification system applicable to pharmacist-led pharmaceutical care in China, providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system, including literature review and analysis, comparison of existing classification systems, refinement of classification items and framework development, two rounds of standard case validation, expert discussion, and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ, assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem(including potential problems), DRP evaluation, cause (including possible causes of potential problems), intervention, acceptance of intervention and DRP status], with 24 primary codes and 96 secondary codes. In the first round of case validation, κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round, κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system, positive ratings (“strongly agree” or “agree”) exceeded 85% for all items. Specifically, positive ratings for“the classification system can provide appropriate category selection”,“ the classification system is comprehensive”,“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability, providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.
9.Construction and characterization of recombinant human coagulation factor Ⅶ stable transfected cell lines
Xiaoxiao LI ; Jiabin CHEN ; Jiajun LIU ; Zhifei ZHANG ; Sen ZOU ; Lihua ZHU ; Zhaoyong YANG
Acta Universitatis Medicinalis Anhui 2026;61(1):16-22
ObjectiveTo construct a stable monoclonal human embryonic kidney 293 (HEK293) cell line expressing recombinant human coagulation factor Ⅶ (rhFⅦ) and evaluate the expression level and procoagulant bioactivity of rhFⅦ. MethodsThe plasmid pCDNA3.1-EGFP-FⅦ was transfected into HEK293 cells to verify the effectiveness of the transfection system. The plasmid pCDNA3.1-FⅦ was transfected into HEK293 cells, and monoclonal stable transfected cell lines were selected using geneticin (G418). The transcription of the FⅦ gene was identified by reverse transcription polymerase chain reaction (RT-PCR). The expression level of rhFⅦ in the supernatant of the monoclonal stable transfected cell line was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot. The concentration of rhFⅦ was determined by enzyme-linked immunosorbent assay (ELISA), and the procoagulant activity of rhFⅦ was measured by human coagulation factor Ⅶ potency assay. ResultsHEK293 cells transfected with pcDNA3.1-EGFP-FⅦ showed green fluorescence, indicating that rhFⅦ was successfully expressed in the supernatant of HEK293 cells after transient transfection with pcDNA3.1-FⅦ. The monoclonal stable transfected cell line was obtained by G418 screening. RT-PCR identified that the FⅦ gene was integrated into the genome of the monoclonal stable transfected cell line. The cell viability was good as detected by Cell Counting Kit-8, and a single band of rhFⅦ was obtained by purification of the cell supernatant. The highest rhFⅦ expression was (1.27±0.09) mg/L, and the highest procoagulant activity was (380.29±13.80)%. ConclusionThe monoclonal HEK293 cell lines which can express rhFⅦ protein efficiently and stably with excellent procoagulant bioactivity is successfully screened.
10.Zuogui Wan Improve Ovarian Inflammatory Microenvironment and Stemness of Ovarian Germline Stem Cells in Ovarian Aging via cGAS/STING Signaling Pathway
Yunling ZHENG ; Xinyi PAN ; Zuang LI ; Yixuan WANG ; Junyi AN ; Yuxin ZOU ; Mengting XIAO ; Zheng CHEN ; Ling ZHU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(7):1-10
ObjectiveTo investigate the mechanism of Zuogui Wan (ZGW) in improving ovarian inflammatory microenvironment and stemness of ovarian germline stem cells (OSCs) for treating ovarian aging via the cyclic guanosine monophosphate/adenosine monophosphate synthase (cGAS)/stimulator of interferon genes (STING) signaling pathway. MethodsForty C57BL/6 female mice were randomly divided into a blank group, a model group, a low-dose ZGW group (2.7 g·kg-1), a high-dose ZGW group (5.4 g·kg-1), and an estradiol valerate group (0.15 mg·kg-1), with 8 mice in each group. Except the blank group, all other groups received a single intraperitoneal injection of cyclophosphamide at 120 mg·kg-1 to establish an ovarian aging mouse model. After successful modeling, each group was continuously administered for 4 weeks, once daily. The physiological status of the mice was observed, and the ovarian index was calculated. The estrus cycle of the mice was monitored. Hematoxylin-eosin (HE) staining was used to observe pathological changes in ovarian tissue. Enzyme-linked immunosorbent assay (ELISA) was used to detect serum sex hormone levels. Serum inflammatory factors interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), and mouse interleukin-6 (IL-6) levels were detected using kits. Western blot was used to detect the protein expression of ovarian cGAS, STING, p-STING, TANK-binding kinase 1 (TBK1), p-TBK1, interferon-induced transmembrane protein 3 (Fragilis), and Vasa homolog protein (MVH). Quantitative real-time polymerase chain reaction (Real-time PCR) was used to detect the mRNA expression of inflammatory factors in ovarian tissue. Immunofluorescence double labeling was performed to locate OSCs in ovarian tissues, and fluorescence intensities of OSCs markers MVH and octamer binding transcription factor 4 (Oct4) were calculated. ResultsCompared with the blank group, the model group showed reduced body weight, ovarian wet weight, and ovarian index (P<0.01) and a disordered estrus cycle (P<0.01). In addition, the levels of serum follicle-stimulating hormone (FSH), TNF-α, IL-6, and IL-1β were increased (P<0.01), while anti-Müllerian hormone (AMH) and estradiol (E2) levels were decreased (P<0.01). The protein expression of cGAS, p-STING/STING, and p-TBK1/TBK1 in ovarian tissue was increased (P<0.05, P<0.01), while that of OSCs stemness factors MVH and Fragilis was reduced (P<0.01). Immunofluorescence indicated a reduction in MVH and Oct4 expression in OSCs (P<0.01). The mRNA expression of inflammatory factors TNF-α, IL-6, and IL-1β in ovarian tissue was increased (P<0.05, P<0.01). Compared with the model group, the treatment groups exhibited improved body weight, ovarian wet weight, and ovarian index (P<0.05) and a reduced rate of estrus cycle disorder (P<0.05, P<0.01). The levels of serum FSH, TNF-α, IL-6, and IL-1β were decreased (P<0.05, P<0.01), while AMH and E2 levels were increased (P<0.01). The protein expression levels of cGAS, p-STING/STING, and p-TBK1/TBK1 in ovarian tissue were decreased (P<0.05), while the protein expression of MVH and Fragilis was increased (P<0.05), and the fluorescence intensities of MVH and Oct4 were increased (P<0.05, P<0.01). The mRNA expression of inflammatory factors in ovarian tissue was decreased (P<0.05). ConclusionZGW alleviate ovarian inflammatory response, regulate ovarian microenvironment homeostasis, and maintain stemness of OSCs in ovarian aging mice probably by modulating the cGAS-STING signaling pathway, thereby improving ovarian function and delaying ovarian aging.

Result Analysis
Print
Save
E-mail