BACKGROUND:Choline kinase alpha is a key enzyme in phospholipid metabolism,involved in the synthesis of phosphatidylcholine,and plays an important role in maintaining cell membrane integrity and signal transduction.Research has shown that choline kinase alpha is highly expressed in various tumors and is closely related to cell proliferation,metabolic reprogramming,and tumor progression.As a potential therapeutic target,the role of choline kinase alpha in tumor metabolism and mitochondrial function still needs further exploration.OBJECTIVE:To evaluate the effects and the underlying mechanisms of choline kinase alpha on the proliferation and apoptosis of glioma U87MG and U251 cells.METHODS:Short hairpin RNA of choline kinase alpha and its empty vector control were transfected into U87MG and U251 glioma cells.Mitochondrial morphology was observed by transmission electron microscopy.Mitochondrial structure and functional protein levels were assessed by western blot assay.Reactive oxygen species levels in cells were measured using a reactive oxygen species fluorescent probe.Mitochondrial membrane potential was assessed with a JC-1 assay.Intracellular adenosine triphosphate levels were measured by chemiluminescence.Cell proliferation was evaluated using a CCK-8 assay.Apoptosis levels were analyzed by flow cytometry.The mitochondrial fission inhibitor Mdivi-1 was used to protect the mitochondrial function of the choline kinase α-silenced lentiviral cells.Finally,U87MG cells were subcutaneously injected to construct a subcutaneous tumor model in nude mice.The tumor growth in nude mice was observed before and after choline kinase alpha silencing and after the use of the mitochondrial fission inhibitor Mdivi-1.RESULTS AND CONCLUSION:(1)Compared with the empty control group,the mitochondria of U87MG and U251 cells in the choline kinase alpha silencing lentivirus group exhibited significant structural abnormalities in mitochondria,such as vacuolization and cristae disruption.The expressions of mitochondrial structure and function-related proteins TOM20,ACO2,and ATP5A were significantly decreased(P＜0.01,P＜0.001),the expression of SOD2 was significantly increased(P＜0.01,P＜0.000 1),the fluorescence intensity of reactive oxygen species was significantly increased(P＜0.01),the mitochondrial membrane potential and adenosine triphosphate level were significantly decreased(P＜0.01,P＜0.001),the cell proliferation ability was reduced(P＜0.01),and the apoptosis level was increased(P＜0.001).(2)Following Mdivi-1 treatment,the fluorescence intensity of reactive oxygen species in U87MG and U251 cells decreased(P＜0.05,P＜0.01),mitochondrial membrane potential and adenosine triphosphate levels were significantly restored(P＜0.05,P＜0.01,P＜0.001),cell proliferation ability was improved(P＜0.05,P＜0.01),and apoptosis level was decreased(P＜0.05).(3)In addition,the in vitro subcutaneous tumor formation experiment of nude mice showed that compared with the empty control group,the mass and growth rate of subcutaneous tumors formed by U87MG cells in the choline kinase alpha silencing lentivirus group were significantly reduced(P＜0.000 1).After Mdivi-1 treatment,the mass and growth rate of tumors were significantly increased(P＜0.000 1).(4)The results show that choline kinase alpha silencing affects the proliferation and apoptosis of glioma cells by inducing mitochondrial dysfunction.

BACKGROUND:Choline kinase alpha is a key enzyme in phospholipid metabolism,involved in the synthesis of phosphatidylcholine,and plays an important role in maintaining cell membrane integrity and signal transduction.Research has shown that choline kinase alpha is highly expressed in various tumors and is closely related to cell proliferation,metabolic reprogramming,and tumor progression.As a potential therapeutic target,the role of choline kinase alpha in tumor metabolism and mitochondrial function still needs further exploration.OBJECTIVE:To evaluate the effects and the underlying mechanisms of choline kinase alpha on the proliferation and apoptosis of glioma U87MG and U251 cells.METHODS:Short hairpin RNA of choline kinase alpha and its empty vector control were transfected into U87MG and U251 glioma cells.Mitochondrial morphology was observed by transmission electron microscopy.Mitochondrial structure and functional protein levels were assessed by western blot assay.Reactive oxygen species levels in cells were measured using a reactive oxygen species fluorescent probe.Mitochondrial membrane potential was assessed with a JC-1 assay.Intracellular adenosine triphosphate levels were measured by chemiluminescence.Cell proliferation was evaluated using a CCK-8 assay.Apoptosis levels were analyzed by flow cytometry.The mitochondrial fission inhibitor Mdivi-1 was used to protect the mitochondrial function of the choline kinase α-silenced lentiviral cells.Finally,U87MG cells were subcutaneously injected to construct a subcutaneous tumor model in nude mice.The tumor growth in nude mice was observed before and after choline kinase alpha silencing and after the use of the mitochondrial fission inhibitor Mdivi-1.RESULTS AND CONCLUSION:(1)Compared with the empty control group,the mitochondria of U87MG and U251 cells in the choline kinase alpha silencing lentivirus group exhibited significant structural abnormalities in mitochondria,such as vacuolization and cristae disruption.The expressions of mitochondrial structure and function-related proteins TOM20,ACO2,and ATP5A were significantly decreased(P＜0.01,P＜0.001),the expression of SOD2 was significantly increased(P＜0.01,P＜0.000 1),the fluorescence intensity of reactive oxygen species was significantly increased(P＜0.01),the mitochondrial membrane potential and adenosine triphosphate level were significantly decreased(P＜0.01,P＜0.001),the cell proliferation ability was reduced(P＜0.01),and the apoptosis level was increased(P＜0.001).(2)Following Mdivi-1 treatment,the fluorescence intensity of reactive oxygen species in U87MG and U251 cells decreased(P＜0.05,P＜0.01),mitochondrial membrane potential and adenosine triphosphate levels were significantly restored(P＜0.05,P＜0.01,P＜0.001),cell proliferation ability was improved(P＜0.05,P＜0.01),and apoptosis level was decreased(P＜0.05).(3)In addition,the in vitro subcutaneous tumor formation experiment of nude mice showed that compared with the empty control group,the mass and growth rate of subcutaneous tumors formed by U87MG cells in the choline kinase alpha silencing lentivirus group were significantly reduced(P＜0.000 1).After Mdivi-1 treatment,the mass and growth rate of tumors were significantly increased(P＜0.000 1).(4)The results show that choline kinase alpha silencing affects the proliferation and apoptosis of glioma cells by inducing mitochondrial dysfunction.

Objective: To explore the efficacy of a novel injectable hydrogel (GelMA/P11/IL4@LIP) loaded with P11 bacteriophages and interleukin-4 (IL-4) liposomes (LIP) in preventing relapse after maxillary expansion in mice, providing experimental evidence for its clinical application. Methods: This study was approved by the experimental animal ethics committee of our hospital. First, 15 7-week-old C57BL/6 mice were used to establish a maxillary expansion model and divided into 5 groups (3 mice in each group): a control group, post expansion day 3 group (PED3 group), post expansion day 7 group (PED7 group), retention for 14 days group (RET group), and relapse for 7 days group (REL group). The mice in each group were sacrificed at their designated time points (day 0, 3, 7, 21, 28), and their maxilla and anterior cranial regions were collected. Bone parameters and the inter-crestal distance (ICD) of maxillary incisor mesial alveolar ridge were measured using micro-computed tomography (micro-CT). Histological staining was performed to evaluate bone formation and resorption, while immunohistochemistry (IHC) was performed for macrophage markers (CD86 and CD206), mesenchymal stem cell markers (glioma-associated oncogene homolog 1 [Gli1]), and osteogenic markers (Runt-related transcription factor 2 [Runx2] and Osterix [OSX]). Next, GelMA/P11/IL4@LIP was synthesized and administered to mouse models of maxillary expansion. A total of 24 7-week-old C57BL/6 mice were divided into 4 groups (6 mice in each group): a blank control group, GelMA group, GelMA/P11 group, and GelMA/P11/IL4@LIP group. All mice underwent palatal expansion. On PED7, the expanders of all 24 mice were cemented with resin to initiate the 14-day retention period. On day 1 of the retention phase, the mice in each group received injections of saline, GelMA, GelMA/P11, or GelMA/P11/IL4@LIP at the midpalatal suture. After the 14-day retention period, three mice in each group were randomly selected and sacrificed, while the other three had their expanders removed and underwent a 7-day relapse before being sacrificed on day 28 (REL). Micro-CT, histological staining, and IHC were performed to evaluate the preventive effect of GelMA/P11/IL4@LIP on post-expansion relapse. Results: The mice maxillary expansion model exhibited a decreased ICD at REL compared to RET in micro-CT analysis (P = 0.008). IHC analysis demonstrated prolonged M1 macrophage infiltration, scarce Gli1+ mesenchymal stem cells, and insufficient expression of osteogenic markers (RUNX2 and OSX) (P < 0.001). Compared to the blank control and GelMA groups, GelMA/P11/IL4@LIP hydrogel injection in the midpalatal suture led to increased ICD at REL, promoted the timely M2 polarization of macrophages, recruited Gli1+ mesenchymal stem cells, and upregulated the expression of RUNX2 and OSX (P < 0.05). Conclusion The mechanism of relapse after maxillary expansion involves the persistent infiltration of M1 macrophages, as well as the inadequate recruitment and insufficient osteogenic differentiation of MSCs in the midpalatal suture. The GelMA/P11/IL4@LIP composite enhanced orofacial mesenchymal stem cell recruitment and promoted the M2 polarization of macrophages, thereby enhancing osteogenesis in the midpalatal suture and preventing post-expansion relapse.

Objective: To explore the association between warning signs of psychological and behavioral development problems with emotional and behavioral problems in preschool children in Bao an District, Shenzhen, so as to provide an empirical basis for optimizing psychological screening strategies in kindergartens. Methods: From September 2023 to August 2024, a total of 49 804 preschool children aged 4-6 years from all 401 kindergartens in Bao an District were enrolled as study subjects. The Warning Signs Checklist for Screening Psychological, Behavioral and Developmental Problems of Children and the parent version of the Strengths and Difficulties Questionnaire (SDQ) were used to assess children s developmental status and emotional and behavioral problems, respectively. Multivariable Logistic regression analysis was used to examine the association between warning signs and emotional and behavioral problems, stratified by sex. Results: The overall positive screening rate for developmental warning signs was 1.5%, and the detection rate for high risk in the SDQ total difficulties score was 6.3%. Multivariable Logistic regression analysis revealed that after adjusting for age, children who screened positive for warning signs exhibited a significantly higher risk of elevated SDQ total difficulties and subscale scores compared to those who screened negative, across both sexes (a OR boys =1.66-13.42, a OR girls =2.04-22.15, all P <0.01). The only exceptions were gross motor skills and conduct problems in boys, and personal social skills and conduct problems in girls. Notably, abnormalities in the personal social domain demonstrated the strongest association with emotional/behavioral problems (a OR boys =7.72-13.42, a OR girls =3.88-22.15), followed by the language domain (a OR boys =4.63-9.23, a OR girls =3.78-14.41) (all P <0.01). Conclusion A positive screening result for warning signs, particularly in the personal social and language domains, serves as a strong indicator of emotional and behavioral problems in preschool children.

Objective: To investigate the association between screening detected myopia in primary school students and mixed exposure to air pollutants, so as to provide a scientific basis for the prevention and control of myopia in children and adolescents. Methods: From May to July 2023, a cluster random sampling method was used to select 15 102 primary school students in grades 3 through 6 from Hefei, Zhongshan, Shenyang, and Nanchang citys. Data were collected through questionnaires, distance vision screening, and computerized refraction. Monthly average concentration data for particulate matter (PM 10 ), fine particulate matter (PM 2. 5), NO 2 and SO 2 were used to calculate the annual average pollutant concentrations for primary school students. Quantile g computation model was employed to analyze the association between mixed exposure to air pollutants and screening detected myopia. Results: The differences in concentrations of the four pollutants among cities were statistically significant ( H =12 886.0, 13 285.0, 8 559.0, 13 181.0, all P <0.01). In the overall sample, there was no statistically significant association between combined exposure to air pollutants and the risk of myopia ( β=0.033, 95%CI=-0.004-0.072, P =0.08). Stratified analysis by outdoor activity time showed that among primary school students with outdoor activity time ≤1 h/d, mixed exposure to air pollutants was positively associated with the risk of myopia ( β=0.050, 95%CI=0.002-0.099, P =0.04); after stratification by city, combined exposure to air pollutants was significantly associated with the risk of myopia among primary school students in Nanchang and Shenyang [ β (95% CI )= 0.232(0.175-0.289), 0.080(0.006-0.155), both P <0.05], whereas no statistically significant association was observed among primary school students in Hefei and Zhongshan [ β (95% CI )=-0.010(-0.071-0.051), -0.032(-0.167-0.102), both P ＞ 0.05 ]. Conclusions Exposure to multiple air pollutants may increase the risk of myopia in primary school students, with the risk influenced by time spent outdoors and geographical location. It is recommended that outdoor activity management for children be strengthened in areas with higher air pollution levels, and that environmental factors be incorporated into comprehensive myopia prevention and control strategies.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

OBJECTIVE To establish a Chinese drug-related problem （DRP） classification system applicable to pharmacist-led pharmaceutical care in China， providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system， including literature review and analysis， comparison of existing classification systems， refinement of classification items and framework development， two rounds of standard case validation， expert discussion， and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ， assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem（including potential problems）， DRP evaluation， cause （including possible causes of potential problems）， intervention， acceptance of intervention and DRP status]， with 24 primary codes and 96 secondary codes. In the first round of case validation， κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round， κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system， positive ratings （“strongly agree” or “agree”） exceeded 85% for all items. Specifically， positive ratings for“the classification system can provide appropriate category selection”，“ the classification system is comprehensive”，“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability， providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.

ObjectiveTo construct a stable monoclonal human embryonic kidney 293 （HEK293） cell line expressing recombinant human coagulation factor Ⅶ （rhFⅦ） and evaluate the expression level and procoagulant bioactivity of rhFⅦ. MethodsThe plasmid pCDNA3.1-EGFP-FⅦ was transfected into HEK293 cells to verify the effectiveness of the transfection system. The plasmid pCDNA3.1-FⅦ was transfected into HEK293 cells， and monoclonal stable transfected cell lines were selected using geneticin （G418）. The transcription of the FⅦ gene was identified by reverse transcription polymerase chain reaction （RT-PCR）. The expression level of rhFⅦ in the supernatant of the monoclonal stable transfected cell line was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot. The concentration of rhFⅦ was determined by enzyme-linked immunosorbent assay （ELISA）， and the procoagulant activity of rhFⅦ was measured by human coagulation factor Ⅶ potency assay. ResultsHEK293 cells transfected with pcDNA3.1-EGFP-FⅦ showed green fluorescence， indicating that rhFⅦ was successfully expressed in the supernatant of HEK293 cells after transient transfection with pcDNA3.1-FⅦ. The monoclonal stable transfected cell line was obtained by G418 screening. RT-PCR identified that the FⅦ gene was integrated into the genome of the monoclonal stable transfected cell line. The cell viability was good as detected by Cell Counting Kit-8， and a single band of rhFⅦ was obtained by purification of the cell supernatant. The highest rhFⅦ expression was （1.27±0.09） mg/L， and the highest procoagulant activity was （380.29±13.80）%. ConclusionThe monoclonal HEK293 cell lines which can express rhFⅦ protein efficiently and stably with excellent procoagulant bioactivity is successfully screened.