AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo investigate the effect and mechanism of Polygonatum neutral polysaccharides from sibiricum （PSP-NP） on colon injury in mice with chronic obstructive pulmonary disease （COPD）. MethodsMale C57BL/6J mice were randomly divided into a control group， a COPD model group， and a PSP-NP group. The COPD model was established using smoke exposure combined with intranasal LPS administration. The PSP-NP group was simultaneously treated daily with 200 mg/kg of PSP-NP via intragastric gavage， while the other groups received an equal volume of saline. HE staining was used to observe the pathological changes in the colon. ELISA was employed to detect the levels of LPS in serum and the expressions of ZO-1， Occludin， IL-6， and TNF-α in colon tissue. UPLC-MS was used to detect the types and contents of bile acids in colonic content， and to screen for differential bile acids. Differential microbial flora were identified using 16S rRNA gene sequencing， and correlation analysis was conducted with differential bile acids. PSP-NP was combined with the differential bile acids cholic acid （CA）， and deoxycholic acid （DCA） in vitro to analyze the binding capacity of PSP-NP for CA and DCA. PSP-NP was applied to NCM460 normal colonic epithelial cells cultured in CA and DCA. Cell migration ability was assessed using the scratch assay， and the mRNA expression levels of inflammatory cytokines TNF-α， IL-6， and NF-κB were measured by RT-qPCR. ResultsPSP-NP effectively improved colonic damage in COPD model mice， enhanced mechanical barrier function， alleviated inflammatory response， and regulated abnormal changes in colonic flora and bile acid metabolism. Correlation analysis further revealed that PSP-NP regulated colonic bile acid metabolism and reduced the redundancy of secondary bile acids by increasing the relative abundance of Bacteroidota， Verrucomicrobiota， Bacteroides， and Akkermansia， while decreasing the relative abundance of Lactobacillus and Bifidobacterium. Notably， in vitro binding assays demonstrated that PSP-NP bound to differential bile acids DCA and CA， with the strongest binding capacity for DCA at 58.2%. In cellular functional studies， DCA inhibited the migration ability of colonic epithelial cells NCM460 and significantly increased the relative mRNA expression levels of inflammatory factors TNF-α， IL-6， and NF-κB. Importantly， co-treatment with PSP-NP significantly ameliorated the impact of DCA on NCM460 cells. ConclusionsPSP-NP may significantly improve colonic damage in COPD model mice. The mechanism may involve the regulation of colonic bile acid metabolism and bile acid profiles through both microbial modulation and direct binding， thereby reducing the damage caused by secondary bile acids such as DCA to colonic epithelial cells.

Background Kurtosis reflecting noise's temporal structure is an effective metric for evaluating noise-induced hearing loss (NIHL), and its threshold is still unclear. Objective To explore the energy range of kurtosis and the threshold of NIHL induced by kurtosis in this energy rangeMethods Using cross-sectional design, 4631 noise-exposed workers in manufacturing industry were selected. The hearing loss and noise exposure data of each worker were collected. Logistic regression model was used to establish the dose-response relationship between noise exposure and hearing loss and estimate the range of energy effects. Restricted cubic spline model was utilized to analyze the dose-response relationship curves of kurtosis to noise-induced hearing loss (NIHI) and high-frequency noise-induced hearing loss (HFNIHL) under different 8 h equivalent sound levels (L_{EX,8 h}), as well as to estimate the kurtosis effect threshold. Results The logistic regression model analysis showed that the prevalence of NIHI and HFNIHL increased significantly with increase of L_{EX,8 h} for steady noise; when L_{EX,8 h} of non-steady noise was 80-100 dB(A), the risk of hearing loss increased with an increase in kurtosis (P<0.05). The restricted cubic spline model showed that when L_{EX,8 h} of non-steady noise was 0-80 dB(A) or >100 dB(A), there was no significant relationship between kurtosis and NIHI or HFNIHL. When L_{EX,8 h} was 80-100 dB(A), there was a significant nonlinear dose-response relationship between kurtosis and NIHL or HFNIHL (P <0.001), and kurtosis > 28.08 exerted effect in elevating NIHI or HFNIHL. Conclusion The effect threshold of kurtosis on NIHL is 28.08 when non-steady noise levels are in the range of 80-100 dB(A). The effect threshold of kurtosis needs further verification.

Background Temporal kurtosis (without frequency weighting, i.e., Z-weighted kurtosis) can evaluate noise-induced hearing loss (NIHL). However, few studies have considered the function of frequency weighting (A- or C-weighted) kurtosis on NIHL. Objective To study the significance of A- and C-weighted kurtosis adjustment for equivalent sound level (L'_{EX,8 h}) in evaluating occupational hearing loss. Methods A cross-sectional survey was used to select 973 noise-exposed workers in seven industries as the subjects. The noise exposure of all workers was assessed by distributions of A-, C-, and Z-weighted kurtosis (e.g., K_A, K_C, and K_Z) and respective adjusted equivalent sound level (e.g., L'_{EX,8 h}-K_A, L'_{EX,8 h}-K_C, and L'_{EX,8 h}-K_Z). The significance of A- and C-weighted kurtosis in evaluating NIHL was evaluated by correlations between three types of L'_{EX,8 h} and NIHL, and improvement of noise-induced permanent threshold shift (NIPTS) underestimation predicted by the ISO prediction model (Acoustics—Estimation of noise-induced hearing loss, ISO 1999-2013). Results The median K_A, K_C, and K_Z were 68.33, 28.22, and 19.82, respectively. The binary logistic regression showed that L_{EX, 8 h}-K_A, L_{EX, 8 h}-K_C, and L'_{EX, 8 h}-K_Z were risk factors for NIHL (OR>1, P<0.001). The receiver operating characteristic (ROC) curve showed that when the outcome variable was noise-induced hearing impairment (NIHI), the areas under the curves corresponding to L'_{EX,8 h}-K_A, L'_{EX,8 h}-K_C, and L'_{EX,8 h}-K_Z were 0.625, 0.628, and 0.625, respectively. When the outcome variable was high-frequency noise-induced hearing loss (HFNIHL), the areas under the curves corresponding to L'_{EX,8 h}-K_A, L'_{EX, 8 h}-K_C, and L'_{EX,8 h}-K_Z were 0.624, 0.623, and 0.622, respectively (P<0.05). The order of underestimation improvement values predicted by L'_{EX,8 h} for NIPTS₁₂₃₄ was: L'_{EX,8 h}-K_A (4.68 dB HL)>L'_{EX,8 h}-K_C (4.38 dB HL)>L'_{EX,8 h}-K_Z (4.28 dB HL) (P<0.001). The order of underestimation improvement values predicted by L'_{EX,8 h}-K for NIPTS₃₄₆ was: L'_{EX,8 h}-K_A (7.20 dB HL)>L'_{EX,8 h}-K_C (6.83 dB HL)>L'_{EX,8 h}-K_Z (6.71 dB HL) (P<0.001). Conclusion The adjustment of A- and C-weighted kurtosis to equivalent sound level L_{EX,8 h} can effectively improve the accuracy of the ISO 1999 prediction model in NIPTS prediction, and compared with the C-weighted, the A-weighted kurtosis can improve the result of the ISO 1999 prediction model in terms of underestimating NIPTS.

Objective To investigate the effects of fractionated low-dose ionizing radiation (LDIR) on the ferroptosis in human bronchial epithelial (HBE) cells as well as the associated differentially expressed genes (DEGs), biological processes, and signaling pathways. Methods HBE cells were exposed to different single doses of X-ray irradiation (0, 25, 50, 75, and 100 mGy) for 24, 48, and 72 h, respectively. The change in cell viability was detected by MTT assay. Cells were irradiated with 0, 25, 50, and 100 mGy X-rays 5 times, with 48 h between each irradiation and a dose rate of 50 mGy/min. Cells were harvested 24 h after irradiation for the measurement of the expression of ferroptosis-related genes SLC7A11 and GPX4 at the mRNA and protein levels, cellular iron content, and the expression of FTH1 and FTL mRNAs. High-throughput sequencing was used to screen for the DEGs in each dose group, followed by Gene Ontology-Biological Process (GO-BP) analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and Gene Set Enrichment Analysis (GSEA). Results Compared with the control group, single-dose LDIR significantly increased cell proliferation at 75 mGy after 24 h (P < 0.05), at 50, 75, and 100 mGy after 48 h (P < 0.05), and at 75 and 100 mGy after 72 h (P < 0.05). Compared with the control group, at the end of the fifth fractionated LDIR, SLC7A11 and GPX4 mRNAs decreased at all doses (P < 0.05), SLC7A11 protein decreased at all doses, GPX4 protein decreased at 25 and 100 mGy, iron content increased at all doses, and FTH1 and FTL mRNAs decreased at all doses (P< 0.05). Sequencing analysis identified 248, 30, and 291 DEGs and 10, 2, and 9 ferroptosis-associated genes at the three doses compared to the control. Gene Ontology-Biological Process analysis showed that DEGs were mainly enriched in biological processes such as response to lipids, cell death, and response to unfolded proteins. Kyoto Encyclopedia of Genes and Genomes analysis showed that DEGs were mainly enriched in the JAK-STAT signaling pathway, lipids and atherosclerosis, ferroptosis, protein processing in the endoplasmic reticulum, and FoxO signaling pathway. Gene set enrichment analysis showed that DEGs were mainly enriched in ferroptosis, fatty acid degradation, and glutathione metabolism. Conclusion Fractionated low-dose radiation induced ferroptosis in HBE cells, and DEGs were predominantly enriched in biological processes and signaling pathways related to inflammation, ferroptosis, and endoplasmic reticulum stress.

Background In recent years, the increasingly widespread application of nuclear and medical radiation technologies has resulted in a large number of occupational populations exposed to low-dose ionizing radiation (LDIR). At present, there is no consistent conclusion on the effects of long-term exposure to LDIR on the metabolic health of the occupational population. Objective To explore the association between long-term exposure to LDIR and metabolic syndrome (MetS) among medical radiologists. Methods A cross-sectional study was conducted to enroll 6431 medical radiologists who ordered occupational health checkups from January 2022 to December 2023, and basic information such as demographic characteristics, occupational characteristics, lifestyles, and dietary habits was collected through questionnaires. Physical examinations were conducted using a standardized protocol. Individual dose equivalents of occupational external exposure were monitored by dosimeters worn by medical radiologists. Logistic regression model was used for identifying influencing factors of MetS and sensitivity analysis, and restricted cubic spline model was used to explore the dose-response relationship between cumulative effective dose and MetS. Two-stage linear regression was used to evaluate threshold effect of association between cumulative effective dose and MetS. Results The positive rate of MetS was 13.6% (877/6431) among the enrolled 6431 study participants. The logistic regression showed that gender, age, monthly income, body mass index (BMI), cumulative effective dose, and smoking were influencing factors for MetS. The risk of MetS was higher in males (OR=1.511, 95%CI: 1.209, 1.888); using the < 30 years old group as reference, the risk of MetS was higher in the 30-39 years old (OR=1.509, 95%CI: 1.095, 2.079), 40-49 years old (OR=2.214, 95%CI: 1.551, 3.161), and ≥50 years old (OR=3.480, 95%CI: 2.338, 5.181) groups; using the <10000 yuan group as reference, the risk of MetS was lower in the group with a monthly income of 10000-14999 yuan (OR=0.715, 95%CI: 0.582, 0.878); the risk of MetS was higher in the BMI ≥ 24 kg·m⁻² group (OR=7.548, 95%CI: 6.223, 9.156); using the < 0.76 mSv group as reference, the risk of MetS was higher in the cumulative effective dose of 0.76-2.73 mSv group (OR=1.270, 95%CI: 1.017, 1.586); the risk of MetS was higher in the smoking group (OR=1.734, 95%CI: 1.428, 2.107). The results of restricted cubic spline showed that the cumulative effective dose was nonlinearly correlated with MetS (P _{non-linearity}=0.028), with an inflection point of 1.25 mSv. The risk of developing MetS increased by 34.1% for each unit increase in cumulative effective dose up to 1.25 mSv, whereas above 1.25 mSv, the statistical association was not significant. The sensitivity analysis results showed that after excluding the self-reported hypertensive and diabetic patients, the cumulative effective dose 0.76-2.73 mSv group still had an increased risk of developing MetS compared with the < 0.76 mSv group (P < 0.05), and the results were robust. Conclusion Among medical radiologists, male, age, BMI, and smoking are positively correlated with MetS, and monthly income is negatively correlated with MetS; cumulative effective dose is non-linearly correlated with MetS among medical radiologists.

Objective To explore the relationship between triglyceride-glucose(TyG)index and hypertension in patients with cerebral hemorrhage.Methods A total of 1718 patients with cere-bral hemorrhage admitted to our hospital from January,2013 to May,2023 were enrolled in this study.According to the TyG index quartile,437 cases were assigned into Q1 group(≤8.375),424 cases into Q2 group(TyG index 8.376～8.737),429 cases into Q3 group(TyG index 8.738～9.087),and 428 cases into Q4 group(≥9.088).The general clinical data were compared in the four groups.Logistic regression analysis was used to study the correlation between TyG index and hy-pertension.Results There were significant differences among the four groups in terms of age,hy-pertension,diabetes,SBP,DBP,TC,TG,HDL-C,LDL-C,FBG,glycated hemoglobin and TyG in-dex(P＜0.05,P＜0.01).Logistic regression analysis showed that when the TyG index was a con-tinuous variable,it was significantly correlated with the risk of hypertension(OR=1.999,95％CI:1.393-2.869,P=0.001).When the index was used as a categorical variable,with Q1as a ref-erence,TyG index in Q3 and Q4 was associated with an increase in OR of hypertension(OR=1.869,95％CI:1.220-2.865,P=0.004;OR=1.844,95％CI:1.125-3.020,P=0.015).After ad-justing cofounders,the association of TyG index and risk of hypertension was stronger in the fe-males(OR=2.618,95％CI:1.312-5.221,P=0.006)than the males(OR=1.783,95％CI:1.151-2.761,P=0.010),and in the patients ≥65 years old(OR=3.277,95％CI:1.600-6.741,P=0.001)than those＜65 years old(OR=1.782,95％CI:1.076-2.949,P=0.025).Conclusion TyG index is closely associated with hypertension in patients with cerebral hemorrhage,especially in women and elderly.

Aim To investigate the mechanism by which sufentanil(Suf)improved hypoxia-reoxygen-ation(H/R)-induced myocardial cell injury by regula-ting hypoxia inducible factor-1α(HIF-1α)and KC-NQ1 opposite strand/antisense transcript 1(Kcnq1ot1).Methods Bioinformatics analysis was conducted to predict the interaction between HIF-1αand Kcnq1ot1.Subsequently,H9c2 cells were divided into multiple treatment groups:Ctrl group,H/R group,and Suf group.Further grouping was based on different transfection conditions,including oe-HIF-1α group,oe-HIF-1α+Suf group,sh-HIF-1α group,and sh-HIF-1α+Kcnq1ot1 group.Cell viability was detected u-sing the MTT assay,cell apoptosis was detected using the TUNEL assay,and the concentrations of CK-MB and HBDH in cell supernatants were measured using ELISA.HIF-1α protein expression in cellswas deter-mined by Western blot,and the mRNA expression level of Kcnq1ot1 was measured by reverse transcription quantitative PCR(RT-qPCR).Additionally,a rat model of myocardial is chemia reperfusion was con-structed to evaluate the therapeutic potential of Suf for myocardial ischemia reperfusion injury in vivo.Results The results of bioinformatics analysis showed a direct interaction between HIF-1α and Kcnq1ot1.Compared with the Ctrl group,the H/R group showed significantly reduced H9c2 cell viability,increased cell apoptosis,and significantly upregulated concentrations of CK-MB and HBDH,along with significantly enhanced expres-sion of HIF-1α and Kcnq1ot1(all P＜0.05).When H9c2 cells were transfected with oe-HIF-1 α,cell via-bility further decreased,apoptosis was worsened,and CK-MB and HBDH concentrations further increased(all P＜0.05);however,these adverse effects were significantly inhibited when combined with Suf inter-vention(all P＜0.05).Additionally,compared with the H/R group,the sh-HIF-1α group showed signifi-cantly improved cell viability,reduced apoptosis and decreased CK-MB and HBDH concentrations(all P＜0.05);however,these improvements were partially re-versed upon transfection with Kcnq1ot1(all P＜0.05).Animal experiments confirmed that Suf could improve myocardial ischemia-reperfusion injury in myo-cardial ischemia-reperfusion injury rats.Conclusions Suf improves myocardial H/R injury by inhibiting the HIF-1α-Kcnq1ot1.