AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveColorectal cancer (CRC) is a highly heterogeneous malignancy, and traditional Chinese medicine (TCM) syndrome differentiation is widely used in its clinical management. However, the biological basis underlying different TCM syndromes remains insufficiently understood. This study aimed to investigate the proteomic differences between qi-blood deficiency syndrome (QBDS) and damp-heat syndrome (DHS) in CRC patients and to establish a “syndrome-differential protein-herbal component” network for exploring potential molecular mechanisms and therapeutic targets associated with syndrome-specific treatment strategies. MethodsTumor tissue samples were collected from 10 patients with pathologically confirmed CRC, including 5 patients diagnosed with QBDS and 5 with DHS according to standardized TCM syndrome differentiation criteria. Tandem mass tag (TMT)-based quantitative proteomics was employed to identify differentially expressed proteins (DEPs) between the two syndrome groups. Functional enrichment analyses, including Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses, were performed to characterize the biological functions and signaling pathways associated with the identified DEPs. Least absolute shrinkage and selection operator (LASSO) regression analysis was further applied to screen key syndrome-related proteins and construct a core protein prediction model. Subsequently, molecular docking was conducted to evaluate the binding affinities between representative herbal compounds, astragaloside IV and berberine, and the identified core proteins. Finally, cell counting kit-8 (CCK-8) assays were performed in HCT 116 and HT-29 colorectal cancer cell lines to validate the anti-proliferative activities of these compounds in vitro. ResultsA total of 44 DEPs were identified between QBDS and DHS tissues, including 21 upregulated and 23 downregulated proteins in the QBDS group relative to the DHS group. Functional enrichment analyses revealed that these proteins were primarily associated with antiviral immune responses, regulation of inflammatory signaling, NF‑κB signaling pathways, cholesterol metabolism, and other biological processes relevant to tumor progression and host immune regulation. LASSO regression analysis identified eight core proteins with potential syndrome-specific significance. Among them, ST7, GPCPD1, and PODXL were closely associated with QBDS, whereas FAT1, GRB7, KRT7, MAFF, and MMP8 were associated with DHS. Molecular docking demonstrated favorable interactions between astragaloside IV and QBDS-related proteins, with binding energies lower than -5 kcal/mol, indicating stable binding activity. Berberine exhibited even lower binding energies and stronger binding specificity toward DHS-related core proteins. In vitro experiments further confirmed that both compounds inhibited CRC cell proliferation, while berberine displayed significantly greater anti-proliferative efficacy. The lowest 48 h IC₅₀ value of berberine reached 15.21 mg/L in CRC cells, indicating a stronger growth-inhibitory effect than astragaloside IV. ConclusionCRC patients with QBDS and DHS exhibit distinct proteomic characteristics, suggesting that different TCM syndromes possess unique molecular signatures. The identified core proteins may serve as potential biomarkers for syndrome differentiation, while astragaloside IV and berberine may exert therapeutic effects through targeting syndrome-specific molecular networks. These findings provide preliminary proteomic evidence supporting syndrome-guided precision integrative medicine in CRC and offer new insights into the biological basis of TCM syndrome differentiation and individualized therapeutic strategies.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

The prevalence of Class III malocclusion varies among different countries and regions. The populations from Southeast Asian countries (Chinese and Malaysian) showed the highest prevalence rate of 15.8%, which can seriously affect oral function, facial appearance, and mental health. As anterior crossbite tends to worsen with growth, early orthodontic treatment can harness growth potential to normalize maxillofacial development or reduce skeletal malformation severity, thereby reducing the difficulty and shortening the treatment cycle of later-stage treatment. This is beneficial for the physical and mental growth of children. Therefore, early orthodontic treatment for Class III malocclusion is particularly important. Determining the optimal timing for early orthodontic treatment requires a comprehensive assessment of clinical manifestations, dental age, and skeletal age, and can lead to better results with less effort. Currently, standardized treatment guidelines for early orthodontic treatment of Class III malocclusion are lacking. This review provides a comprehensive summary of the etiology, clinical manifestations, classification, and early orthodontic techniques for Class III malocclusion, along with systematic discussions on selecting early treatment plans. The purpose of this expert consensus is to standardize clinical practices and improve the treatment outcomes of Class III malocclusion through early orthodontic treatment.
Humans ; Malocclusion, Angle Class III/classification* ; Orthodontics, Corrective/methods* ; Consensus ; Child

Instrument separation is a critical complication during root canal therapy, impacting treatment success and long-term tooth preservation. The etiology of instrument separation is multifactorial, involving the intricate anatomy of the root canal system, instrument-related factors, and instrumentation techniques. Instrument separation can hinder thorough cleaning, shaping, and obturation of the root canal, posing challenges to successful treatment outcomes. Although retrieval of separated instrument is often feasible, it carries risks including perforation, excessive removal of tooth structure and root fractures. Effective management of separated instruments requires a comprehensive understanding of the contributing factors, meticulous preoperative assessment, and precise evaluation of the retrieval difficulty. The application of appropriate retrieval techniques is essential to minimize complications and optimize clinical outcomes. The current manuscript provides a framework for understanding the causes, risk factors, and clinical management principles of instrument separation. By integrating effective strategies, endodontists can enhance decision-making, improve endodontic treatment success and ensure the preservation of natural dentition.
Humans ; Root Canal Therapy/adverse effects* ; Consensus ; Root Canal Preparation/adverse effects*

Nipah virus (NiV) and related viruses form a distinct henipavirus genus within the Paramyxoviridae family. NiV continues to spillover into the humans causing deadly outbreaks with increasing human-bat interaction. NiV encodes the large protein (L) and phosphoprotein (P) to form the viral RNA polymerase machinery. Their sequences show limited homologies to those of non-henipavirus paramyxoviruses. We report two cryo-electron microscopy (cryo-EM) structures of the Nipah virus (NiV) polymerase L-P complex, expressed and purified in either its full-length or truncated form. The structures resolve the RNA-dependent RNA polymerase (RdRp) and polyribonucleotidyl transferase (PRNTase) domains of the L protein, as well as a tetrameric P protein bundle bound to the L-RdRp domain. L-protein C-terminal regions are unresolved, indicating flexibility. Two PRNTase domain zinc-binding sites, conserved in most Mononegavirales, are confirmed essential for NiV polymerase activity. The structures further reveal anchoring of the P protein bundle and P protein X domain (XD) linkers on L, via an interaction pattern distinct among Paramyxoviridae. These interactions facilitate binding of a P protein XD linker in the nucleotide entry channel and distinct positioning of other XD linkers. We show that the disruption of the L-P interactions reduces NiV polymerase activity. The reported structures should facilitate rational antiviral-drug discovery and provide a guide for the functional study of NiV polymerase.
Nipah Virus/chemistry* ; Cryoelectron Microscopy ; Viral Proteins/genetics* ; RNA-Dependent RNA Polymerase/genetics* ; Phosphoproteins/genetics* ; Humans ; Models, Molecular ; Protein Binding

ObjectiveTo investigate the effect and mechanism of Polygonatum neutral polysaccharides from sibiricum （PSP-NP） on colon injury in mice with chronic obstructive pulmonary disease （COPD）. MethodsMale C57BL/6J mice were randomly divided into a control group， a COPD model group， and a PSP-NP group. The COPD model was established using smoke exposure combined with intranasal LPS administration. The PSP-NP group was simultaneously treated daily with 200 mg/kg of PSP-NP via intragastric gavage， while the other groups received an equal volume of saline. HE staining was used to observe the pathological changes in the colon. ELISA was employed to detect the levels of LPS in serum and the expressions of ZO-1， Occludin， IL-6， and TNF-α in colon tissue. UPLC-MS was used to detect the types and contents of bile acids in colonic content， and to screen for differential bile acids. Differential microbial flora were identified using 16S rRNA gene sequencing， and correlation analysis was conducted with differential bile acids. PSP-NP was combined with the differential bile acids cholic acid （CA）， and deoxycholic acid （DCA） in vitro to analyze the binding capacity of PSP-NP for CA and DCA. PSP-NP was applied to NCM460 normal colonic epithelial cells cultured in CA and DCA. Cell migration ability was assessed using the scratch assay， and the mRNA expression levels of inflammatory cytokines TNF-α， IL-6， and NF-κB were measured by RT-qPCR. ResultsPSP-NP effectively improved colonic damage in COPD model mice， enhanced mechanical barrier function， alleviated inflammatory response， and regulated abnormal changes in colonic flora and bile acid metabolism. Correlation analysis further revealed that PSP-NP regulated colonic bile acid metabolism and reduced the redundancy of secondary bile acids by increasing the relative abundance of Bacteroidota， Verrucomicrobiota， Bacteroides， and Akkermansia， while decreasing the relative abundance of Lactobacillus and Bifidobacterium. Notably， in vitro binding assays demonstrated that PSP-NP bound to differential bile acids DCA and CA， with the strongest binding capacity for DCA at 58.2%. In cellular functional studies， DCA inhibited the migration ability of colonic epithelial cells NCM460 and significantly increased the relative mRNA expression levels of inflammatory factors TNF-α， IL-6， and NF-κB. Importantly， co-treatment with PSP-NP significantly ameliorated the impact of DCA on NCM460 cells. ConclusionsPSP-NP may significantly improve colonic damage in COPD model mice. The mechanism may involve the regulation of colonic bile acid metabolism and bile acid profiles through both microbial modulation and direct binding， thereby reducing the damage caused by secondary bile acids such as DCA to colonic epithelial cells.

Ferroptosis, a programmed cell death modality discovered and defined in the last decade, is primarily induced by iron-dependent lipid peroxidation. At present, it has been found that ferroptosis is involved in various physiological functions such as immune regulation, growth and development, aging, and tumor suppression. Especially its role in tumor biology has attracted extensive attention and research. Breast cancer is one of the most common female tumors, characterized by high heterogeneity and complex genetic background. Triple negative breast cancer (TNBC) is a special type of breast cancer, which lacks conventional breast cancer treatment targets and is prone to drug resistance to existing chemotherapy drugs and has a low cure rate after progression and metastasis. There is an urgent need to find new targets or develop new drugs. With the increase of studies on promoting ferroptosis in breast cancer, it has gradually attracted attention as a treatment strategy for breast cancer. Some studies have found that certain compounds and natural products can act on TNBC, promote their ferroptosis, inhibit cancer cells proliferation, enhance sensitivity to radiotherapy, and improve resistance to chemotherapy drugs. To promote the study of ferroptosis in TNBC, this article summarized and reviewed the compounds and natural products that induce ferroptosis in TNBC and their mechanisms of action. We started with the exploration of the pathways of ferroptosis, with particular attention to the System X_c^--cystine-GPX4 pathway and iron metabolism. Then, a series of compounds, including sulfasalazine (SAS), metformin, and statins, were described in terms of how they interact with cells to deplete glutathione (GSH), thereby inhibiting the activity of glutathione peroxidase 4 (GPX4) and preventing the production of lipid peroxidases. The disruption of the cellular defense against oxidative stress ultimately results in the death of TNBC cells. We have also our focus to the realm of natural products, exploring the therapeutic potential of traditional Chinese medicine extracts for TNBC. These herbal extracts exhibit multi-target effects and good safety, and have shown promising capabilities in inducing ferroptosis in TNBC cells. We believe that further exploration and characterization of these natural compounds could lead to the development of a new generation of cancer therapeutics. In addition to traditional chemotherapy, we discussed the role of drug delivery systems in enhancing the efficacy and reducing the toxicity of ferroptosis inducers. Nanoparticles such as exosomes and metal-organic frameworks (MOFs) can improve the solubility and bioavailability of these compounds, thereby expanding their therapeutic potential while minimizing systemic side effects. Although preclinical data on ferroptosis inducers are relatively robust, their translation into clinical practice remains in its early stages. We also emphasize the urgent need for more in-depth and comprehensive research to understand the complex mechanisms of ferroptosis in TNBC. This is crucial for the rational design and development of clinical trials, as well as for leveraging ferroptosis to improve patient outcomes. Hoping the above summarize and review could provide references for the research and development of lead compounds for the treatment for TNBC.