BACKGROUND:3D-printed bone tissue engineering scaffolds have obvious advantages in the research and clinical treatment of bone defect repair.As one of the important raw materials for 3D printed bone scaffolds,poly-L-lactic acid has a great potential for application in performing bone defect repair,but clinical patients with different bone defect causative factors have different requirements for the comprehensive performance of poly-L-lactic acid bone scaffolds.OBJECTIVE:To summarize and review the development of 3D printing technology and poly-L-lactic acid scaffolds and the design strategies chosen for scaffolds for bone repair in the setting of bone diseases such as osteomyelitis,bone tumor,osteonecrosis,and osteoporosis.METHODS:Literature from CNKI,WanFang,PubMed,Science Direct,and Web of Science databases were searched and screened from 1994 to 2024.Search terms were"3D printing,polylactic acid,bone tissue engineering scaffold,osteomyelitis,bone tumor,osteonecrosis,osteoporosis,bone defect"in Chinese and English.The screened 62 articles were systematically summarized and analyzed.RESULTS AND CONCLUSION:(1)Poly-L-lactic acid is considered to be an ideal raw material for artificial bone scaffold design due to its non-toxicity,processability,biocompatibility,and ability to self-degrade in the human environment.The application of 3D printing technology has enabled poly-L-lactic acid bone scaffolds to meet the multilayered and porous structural design requirements of biomimetic artificial bone repair materials,and to optimize the mechanical properties for better bone repair.(2)According to different bone disease microenvironments,timely adjustment of the functional design of poly-L-lactic acid scaffolds is important for the comprehensive osteogenic efficacy of the scaffolds.The article discusses the application of poly-L-lactic acid scaffolds in bone disease environments such as osteomyelitis,bone tumor,osteonecrosis,and osteoporosis,and highlights the importance of rationally grasping the timing of bone disease treatment and bone tissue regeneration for bone defects caused by different bone diseases.(3)Although poly-L-lactic acid scaffolds show potential in bone repair,there are still some problems,such as the need to further optimize the structural design of the scaffolds to fit new bone regeneration,enhance the bioactivity of the scaffolds,and take into account other functions(e.g.,antimicrobial,anti-tumor,and anti-osteoporosis)in order to adapt to the needs of bone tissue repair in different pathological environments.

BACKGROUND:Age-related macular degeneration and deep vein thrombosis may share common pathophysiological mechanisms,but there is a lack of direct evidence regarding their relationship.Traditional studies are confounded by confounding factors and reverse causation.OBJECTIVE:To investigate the causal relationship between age-related macular degeneration and deep vein thrombosis based on Mendelian randomization design.METHODS:Through a two-way Mendelian randomization analysis,single nucleotide polymorphisms of exposure and outcomes were obtained from publicly available genome-wide association studies,with deep vein thrombosis data from the FinnGen database in a European population with a sample size of 363 612 and 1 048 575 single nucleotide polymorphisms.In addition,we obtained data on age-related macular degeneration from the IEUOpenGWAS project,also from a European population sample of 105 248 cases covering 11 304 110 single nucleotide polymorphisms.In R4.4.1,we used the TwoSampleMR package(version 0.6.8)to explore the causal effects of exposure factors on outcomes.At the same time,we also conducted a sensitivity analysis via MR-Egger regression,weighted median,weighted model and simple model methods to ensure that the assessment results were robust and reliable.In addition,we used the"heterogeneity"function to test for heterogeneity,and the"horizontal pleiotropy"function and the MR-PRESSO test to further assess horizontal pleotropy.The Cochran's Q test was used to determine whether there was statistical heterogeneity between single nucleotide polymorphisms,and the leave-one-out method was used to assess whether single nucleotide polymorphisms would significantly interfere with Mendelian randomization analysis.Funnel plots were drawn to assess the potential bias of single nucleotide polymorphisms.Forest plots were plotted to show the effect estimates of single nucleotide polymorphisms on exposure and outcomes,and their confidence intervals were plotted.Scatter plots were plotted to evaluate the relationship between the potency of single nucleotide polymorphisms and their causal effect size on outcome estimates.RESULTS AND CONCLUSION:Both forward and reverse studies showed that there was no causal association between age-related macular degeneration and the occurrence of deep vein thrombosis(P＞0.05).Sensitivity analysis showed that the main analysis results were reliable and robust,with no outliers,heterogeneity,and horizontal pleiotropy,and no single nucleotide polymorphism significantly affected the overall effect estimate.Although it is based on European population data,it has methodological reference value for Chinese biomedical research on complex disease associations.In this field,China can carry out multi-center large-sample studies,accurately analyze the internal links between Chinese population-related diseases,and provide a basis for prevention and treatment strategies and clinical practice.

BACKGROUND:The incidence rate of chronic non-specific neck pain is high and the etiology is unknown.Myofascial pain and deep cervical flexor atrophy are the key factors.Extracorporeal shockwave therapy can improve microcirculation,relieve local pain,and delay the degenerative development of the cervical spine,while motion control training can significantly improve neck muscle strength and endurance and reduce neck pain.However,both methods have limited effectiveness when applied individually.OBJECTIVE:To explore the therapeutic efficacy of extracorporeal shock wave intervention combined with motion control training at the upper trapezius muscle on chronic non-specific neck pain.METHODS:Forty-two patients with chronic non-specific neck pain recruited from Shenyang Sport University were randomly divided into three groups:a shock wave group(n=14),in which extracorporeal shockwave intervention at the upper trapezius muscle was given for 10-15 minutes,once a week for 4 weeks;a training group(n=14),in which motion control training was given for 40-50 minutes,three times a week for 4 weeks;and a combination group(n=14),in which extracorporeal shockwave intervention at the upper trapezius muscle combined with motion control training was performed for 4 weeks.Patients were assessed for pain intensity,cervical spine function,upper trapezius muscle thickness,hemodynamic parameters,and serum interleukin 6 and tumor necrosis factor α levels before intervention,1 week and 4 weeks after intervention.RESULTS AND CONCLUSION:(1)Compared with the pre-intervention period,the visual analogue scale scores and neck disability index in the three groups were lower after 1 and 4 weeks of intervention(P＜0.05),and the visual analogue scale scores and neck disability index in the combination group were lower than those of the shock wave group and the training group(P＜0.05).(2)Compared with the pre-intervention period,the upper trapezius thickness increased in the training group and the combination group after 4 weeks of intervention(P＜0.05);the upper trapezius thickness was greater in the combination group than in the shock wave group and the training group after 4 weeks of intervention(P＜0.05).(3)The shock wave group and the combination group had an increase in the peak systolic velocity of the ascending segment of the transverse carotid artery(P＜0.05)and a decrease in the resistance index(P＜0.05)after 1 and 4 weeks of intervention,while the training group showed an increase in the peak systolic velocity of the ascending segment of the transverse carotid artery(P＜0.05)and a decrease in the resistance index(P＜0.05)after 4 weeks of intervention.The peak systolic velocity of the ascending segment of the transverse carotid artery in the combination group was higher(P＜0.05)and the resistance index was lower(P＜0.05)than those in the shockwave group and the training group after 1 and 4 weeks of intervention.(4)Compared with the pre-intervention period,the levels of interleukin 6 and tumor necrosis factor α were reduced in the shock wave and combination groups after 1 and 4 weeks of intervention(P＜0.05),and in the training group after 4 weeks of intervention(P＜0.05).After 1 and 4 weeks of intervention,the levels of interleukin 6 and tumor necrosis factor α were lower in the combination group than in the shock wave group and the training group(P＜0.05).To conclude,extracorporeal shock wave combined with motion control training for chronic non-specific neck pain significantly reduces pain and improves neck function,and the mechanism of action may be to promote the blood flow velocity at the trigger point,reduce blood flow resistance,reduce the serum levels of interleukin 6 and tumor necrosis factor α,and increase the thickness of the upper trapezius muscle.

Perimenopausal depression （PMD） is an affective disorder that occurs in women during the transition from sexual maturity to old age. It can induce various complications， such as insomnia and cognitive decline. The etiology of PMD is complex. Although multiple hypotheses have been proposed， there is still no unified theory that fully explains its pathogenesis. Research into its mechanisms relies heavily on animal experiments， and establishing reliable animal models is crucial for experimental studies. Appropriate animal models can better simulate human pathophysiological states， rapidly evaluate the efficacy and safety of drugs and intervention methods， grasp the essence of the disease， and uncover its intrinsic connections， thereby exploring more advanced intervention strategies. However， there is a lack of systematic review and summarization of literature related to model construction. Additionally， traditional Chinese medicine （TCM）， adhering to the principles of ''syndrome differentiation and treatment'' and ''holistic concept''， has shown significant efficacy in treating PMD. In recent years， research exploring and analyzing its therapeutic mechanisms has been increasing. Therefore， to gain a clearer and more comprehensive understanding of PMD animal modeling methods and the mechanisms of TCM， this paper reviewed Chinese and English literature on PMD animal models and mechanisms of TCM in PMD treatment. It summarized the construction methods of single-factor and multi-factor PMD models， and discussed the advantages and disadvantages of each modeling approach. Furthermore， it delved into the mechanisms of TCM intervention in PMD， revealing that TCM formulas primarily exert their effects by regulating the hypothalamic-pituitary-adrenal axis， hypothalamic-pituitary-ovarian axis， gut-brain axis， cell signaling pathways， neural circuits， hormone levels， and neurotransmitter levels. This review aims to provide a reference for future research in this field. In summary， by summarizing the progress in the methods for PMD animal model construction and the mechanisms of TCM， the paper seeks to offer new insights into the mechanistic research of TCM intervention in PMD.

Neurocritical care involves complex pathophysiological mechanisms, and its incidence is higher, injuries are more severe, and treatment is more challenging in high-altitude environments. This consensus, based on the latest domestic and international evidence-based medical data, establishes a standardized, goal-oriented framework for neurocritical care management applicable in high-altitude regions and nationwide. The consensus was developed following international standards for evidence quality assessment and underwent two rounds of Delphi expert consultation, resulting in 32 recommendation statements covering three parts: management systems, monitoring and assessment, and core strategies. Key updates include: advocating for the establishment of independent neurocritical care units and implementing precise tiered diagnosis and treatment based on the "Five Differences in Critical Care" concept; constructing a "trinity" multimodal brain monitoring system centered on cerebral blood flow, cerebral oxygenation, and brain function, emphasizing routine bedside transcranial Doppler ultrasound, cerebral oximetry, and continuous electroencephalography monitoring; shifting management strategies from mild hypothermia therapy to targeted temperature management, and defining the "446" target management pathway for the supercritical stage; emphasizing the assessment of static and dynamic cerebrovascular autoregulation functions through multimodal methods to achieve individualized optimal mean arterial pressure management; elevating cerebrospinal fluid management goals to the level of "glymphatic system" function maintenance; implementing a multidisciplinary collaborative, whole-process management model focusing on patients' long-term neurological functional outcomes; de-escalation criteria include multidimensional indicators such as recovery of brain structure, restoration of cerebrovascular autoregulation, improvement in cerebrospinal fluid dynamics, and reduction in biomarker levels; and integrating cutting-edge technologies like artificial intelligence into post-critical care management and rehabilitation planning. This consensus systematically integrates the entire process of neurocritical care management, reflecting the modern connotation of goal-oriented, dynamic, and multimodal integration in neurocritical care medicine. It aims to adapt to new trends such as deepening understanding of pathophysiological mechanisms, the integration of medicine and engineering, and the empowerment of artificial intelligence, thereby further advancing the discipline of critical care medicine.

With the rapid advancement of hemodynamic indices and monitoring technologies, their classification methods and application processes have become increasingly complex. Currently, no unified standard hasbeen established, making it difficult to fully meet the clinical requirements for hemodynamic management. To assist in hemodynamic monitoring assessment and therapeutic decision-making in critically ill patients, the Critical Hemodynamic Therapy Collaborative Group, in conjunction with the Critical Ultrasound Study Group, has jointly developed the Standard for the Application of Hemodynamic Monitoring Techniques in Critical Care. The first part of this standard systematically categorizes hemodynamic indicators into flow indicators, pressure and its derivative indicators, and tissue perfusion indicators, while elaborating on the clinical application of each. The second part establishes a standardized clinical implementation pathway for hemodynamic monitoring. It proposes a tiered monitoring strategy-comprising basic, advanced, indication-specific, and special scenario monitoring-tailored to different clinical settings. It emphasizes the central role of critical care ultrasound across all levels of monitoring and establishes hemodynamic assessment standards for organs such as the brain, kidneys, and gastrointestinal tract. This standard aims to provide a unified framework for clinical practice, teaching, training, and research in critical care medicine, thereby promoting standardized development within the discipline.

OBJECTIVE To investigate the effects of early continuous renal replacement therapy （CRRT） combined with nafamostat mesylate （NM） on clinical outcomes， safety， inflammatory reaction， and oxidative stress in patients with sepsis- associated acute kidney injury （SA-AKI）. METHODS Patients’ data were gathered from 153 cases admitted to the intensive care unit of the our hospital between January 2023 and January 2025， who initiated CRRT within 48 hours after being diagnosed with SA-AKI. These patients were divided into control group （75 cases） and observation group （78 cases） according to different anticoagulant drugs used during CRRT. After CRRT， control group was given sodium citrate， while observation group was given NM. The clinical outcomes [the duration of mechanical ventilation， length of stay in the intensive care unit （ICU）] as well as Acute Physiology and Chronic Health Evaluation Ⅱ （APACHE Ⅱ） score， Sequential Organ Failure Assessment （SOFA） score， renal function indexes [serum creatinine （Scr）， blood urea nitrogen （BUN）， cystatin C （CysC）]， inflammatory indexes [C-reactive protein （CRP）， procalcitonin （PCT）， interleukin-6 （IL-6）]， oxidative stress markers [malondialdehyde （MDA）， superoxide dismutase （SOD）， glutathione peroxidase （GSH-Px）] and the occurrence of adverse drug reactions before and after treatment were compared between the two groups. RESULTS After treatment， the observation group had significantly shorter mechanical ventilation duration and ICU length of stay compared to the control group （P＜0.05）. APACHE Ⅱ scores， SOFA scores， renal function indexes， inflammatory indexes and MDA levels of two groups were significantly lower than those before treatment within the same group （P＜0.05）， and the observation group were significantly lower than the control group （P＜0.05）. The levels of SOD and GSH-Px were significantly higher than those before treatment within the same group （P＜0.05）， and the observation group were significantly higher than the control group （P＜0.05）. There was no statistically significant difference in the overall incidence of adverse events between the two groups （P＞0.05）. CONCLUSIONS Compared with early CRRT combined with sodium citrate， early CRRT combined with NM can significantly improve renal function in patients with SA-AKI， alleviate the degree of inflammatory reaction and oxidative stress， shorten ICU stay length， and demonstrate favorable safety.

Based on the theory of "disease of both blood and water" in Essentials from the Golden Cabinet （《金匮要略》）， and in combination with the dynamic syndrome evolution of heart failure with preserved ejection fraction （HFpEF）， this paper systematically clarifies the pathomechanism of HFpEF， characterized by yang deficiency as the root， blood stasis as the pivotal factor and water retention as the manifestation. Accordingly， the therapeutic principles have been proposed， which are warming yang and banking up original qi to consolidate the root， activating blood and unblocking collaterals to smooth the mechanism， and promoting urination and regulating pivot to remove the branch. On this basis， a compound formula structure of "one monarch， one minister and one assistant" is established， forming an integrated intervention strategy that synergistically combines the three methods of warming yang， activating blood， and promoting urination through combined classical formulas. Zhenwu Decoction （真武汤）， which warms yang and dissolves rheum， is used to consolidate the root and directly target the source of yang deficiency， serving as the monarch； Guizhi Fuling Pills （桂枝茯苓丸）， which activates blood， promotes urination and unblocks the pivot， assists in interrupting the binding of blood stasis and water retention， serving as the minister； Tingli Dazao Xiefei Decoction （葶苈大枣泻肺汤）， which regulates qi， disperses retained fluids， and eliminates the manifestation， alleviates acute water-retention symptoms， serving as the assistant. This compound formula is warming without being drying， diuretic without being drastic， and dispels stasis without consuming blood， thereby achieving the therapeutic effects of warming yang， activating blood， and promoting urination.

ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.