AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

OBJECTIVE To establish a Chinese drug-related problem （DRP） classification system applicable to pharmacist-led pharmaceutical care in China， providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system， including literature review and analysis， comparison of existing classification systems， refinement of classification items and framework development， two rounds of standard case validation， expert discussion， and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ， assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem（including potential problems）， DRP evaluation， cause （including possible causes of potential problems）， intervention， acceptance of intervention and DRP status]， with 24 primary codes and 96 secondary codes. In the first round of case validation， κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round， κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system， positive ratings （“strongly agree” or “agree”） exceeded 85% for all items. Specifically， positive ratings for“the classification system can provide appropriate category selection”，“ the classification system is comprehensive”，“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability， providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.

ObjectiveTo construct a stable monoclonal human embryonic kidney 293 （HEK293） cell line expressing recombinant human coagulation factor Ⅶ （rhFⅦ） and evaluate the expression level and procoagulant bioactivity of rhFⅦ. MethodsThe plasmid pCDNA3.1-EGFP-FⅦ was transfected into HEK293 cells to verify the effectiveness of the transfection system. The plasmid pCDNA3.1-FⅦ was transfected into HEK293 cells， and monoclonal stable transfected cell lines were selected using geneticin （G418）. The transcription of the FⅦ gene was identified by reverse transcription polymerase chain reaction （RT-PCR）. The expression level of rhFⅦ in the supernatant of the monoclonal stable transfected cell line was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot. The concentration of rhFⅦ was determined by enzyme-linked immunosorbent assay （ELISA）， and the procoagulant activity of rhFⅦ was measured by human coagulation factor Ⅶ potency assay. ResultsHEK293 cells transfected with pcDNA3.1-EGFP-FⅦ showed green fluorescence， indicating that rhFⅦ was successfully expressed in the supernatant of HEK293 cells after transient transfection with pcDNA3.1-FⅦ. The monoclonal stable transfected cell line was obtained by G418 screening. RT-PCR identified that the FⅦ gene was integrated into the genome of the monoclonal stable transfected cell line. The cell viability was good as detected by Cell Counting Kit-8， and a single band of rhFⅦ was obtained by purification of the cell supernatant. The highest rhFⅦ expression was （1.27±0.09） mg/L， and the highest procoagulant activity was （380.29±13.80）%. ConclusionThe monoclonal HEK293 cell lines which can express rhFⅦ protein efficiently and stably with excellent procoagulant bioactivity is successfully screened.

ObjectiveTo investigate the mechanism of Zuogui Wan （ZGW） in improving ovarian inflammatory microenvironment and stemness of ovarian germline stem cells （OSCs） for treating ovarian aging via the cyclic guanosine monophosphate/adenosine monophosphate synthase （cGAS）/stimulator of interferon genes （STING） signaling pathway. MethodsForty C57BL/6 female mice were randomly divided into a blank group， a model group， a low-dose ZGW group （2.7 g·kg^-1）， a high-dose ZGW group （5.4 g·kg^-1）， and an estradiol valerate group （0.15 mg·kg^-1）， with 8 mice in each group. Except the blank group， all other groups received a single intraperitoneal injection of cyclophosphamide at 120 mg·kg^-1 to establish an ovarian aging mouse model. After successful modeling， each group was continuously administered for 4 weeks， once daily. The physiological status of the mice was observed， and the ovarian index was calculated. The estrus cycle of the mice was monitored. Hematoxylin-eosin （HE） staining was used to observe pathological changes in ovarian tissue. Enzyme-linked immunosorbent assay （ELISA） was used to detect serum sex hormone levels. Serum inflammatory factors interleukin-1β （IL-1β）， tumor necrosis factor-α （TNF-α）， and mouse interleukin-6 （IL-6） levels were detected using kits. Western blot was used to detect the protein expression of ovarian cGAS， STING， p-STING， TANK-binding kinase 1 （TBK1）， p-TBK1， interferon-induced transmembrane protein 3 （Fragilis）， and Vasa homolog protein （MVH）. Quantitative real-time polymerase chain reaction （Real-time PCR） was used to detect the mRNA expression of inflammatory factors in ovarian tissue. Immunofluorescence double labeling was performed to locate OSCs in ovarian tissues， and fluorescence intensities of OSCs markers MVH and octamer binding transcription factor 4 （Oct4） were calculated. ResultsCompared with the blank group， the model group showed reduced body weight， ovarian wet weight， and ovarian index （P<0.01） and a disordered estrus cycle （P<0.01）. In addition， the levels of serum follicle-stimulating hormone （FSH）， TNF-α， IL-6， and IL-1β were increased （P<0.01）， while anti-Müllerian hormone （AMH） and estradiol （E₂） levels were decreased （P<0.01）. The protein expression of cGAS， p-STING/STING， and p-TBK1/TBK1 in ovarian tissue was increased （P<0.05， P<0.01）， while that of OSCs stemness factors MVH and Fragilis was reduced （P<0.01）. Immunofluorescence indicated a reduction in MVH and Oct4 expression in OSCs （P<0.01）. The mRNA expression of inflammatory factors TNF-α， IL-6， and IL-1β in ovarian tissue was increased （P<0.05， P<0.01）. Compared with the model group， the treatment groups exhibited improved body weight， ovarian wet weight， and ovarian index （P<0.05） and a reduced rate of estrus cycle disorder （P<0.05， P<0.01）. The levels of serum FSH， TNF-α， IL-6， and IL-1β were decreased （P<0.05， P<0.01）， while AMH and E₂ levels were increased （P<0.01）. The protein expression levels of cGAS， p-STING/STING， and p-TBK1/TBK1 in ovarian tissue were decreased （P<0.05）， while the protein expression of MVH and Fragilis was increased （P<0.05）， and the fluorescence intensities of MVH and Oct4 were increased （P<0.05， P<0.01）. The mRNA expression of inflammatory factors in ovarian tissue was decreased （P<0.05）. ConclusionZGW alleviate ovarian inflammatory response， regulate ovarian microenvironment homeostasis， and maintain stemness of OSCs in ovarian aging mice probably by modulating the cGAS-STING signaling pathway， thereby improving ovarian function and delaying ovarian aging.

As a patented characteristic medicine of Yi ethnic minority， Pingxuan capsules have the effects of nourishing the liver and kidney， pacifying the liver， and subduing Yang. With the main indications of dizziness， headache， palpitations， tinnitus， insomnia， dreaminess， waist and knee soreness caused by liver-kidney deficiency and liver Yang upward disturbance， Pingxuan capsules are widely used in the treatment of posterior circulation ischemic vertigo， vestibular migraine， benign paroxysmal positional vertigo. However， the current knowledge is limited regarding the efficacy， syndrome differentiation， and safety of this medicine. On the basis of summarizing the experience of clinicians and the existing evidence， this study invites clinical experts of traditional Chinese and Western medicine， pharmaceutical experts， and methodological experts from relevant fields across China to conduct evidence-based evaluation of Pingxuan capsules. The evaluation follows the Specifications for the Development of Clinical Expert Consensus on Chinese Patent Medicines issued by the Standardization Office of the China Association of Chinese Medicine， and reaches 5 recommendations and 16 consensus suggestions. The consensus clarifies the clinical applications， efficacy， dose， course of treatment， combination of medicines， precautions， and contraindications of Pingxuan capsules in the treatment of vertigo and explains the safety of clinical application. This consensus is applicable to clinicians （traditional Chinese medicine， Western medicine， and integrated traditional Chinese and Western medicine） and pharmacists in tertiary hospitals， secondary hospitals， and community-level medical and health institutions across China， providing a reference for the rational use of Pingxuan capsules in the treatment of vertigo. It is hoped that the promotion of this consensus can facilitate the rational use of drugs in clinical practice， reduce the risk of drug use， and give full play to the advantages of Pingxuan capsules in the treatment of vertigo diseases. This consensus has been reviewed and published by the China Association of Chinese Medicine， with the number GS/CACM330-2023.

ObjectiveTo explore the effect of serum containing Zhenwutang on myocardial mast cell apoptosis induced by angiotensin Ⅱ （AngⅡ） and the mechanism of the correlation between apoptosis and mitochondrial autophagy. MethodsIn this experiment， AngⅡ and serum containing Zhenwutang with different concentrations were used to interfere with H9C2 cardiomyocytes for 24 h， and the survival rate of H9C2 cardiomyocytes was detected by cell counting kit-8 （CCK-8） to screen the optimal concentration for the experiment. Enzyme-linked immunosorbent assay （ELISA） was used to detect the content of B-type natriuretic peptide （BNP） in cell culture supernatant， and immunofluorescence was used to detect the cell surface area to verify the construction of the myocardial mast cell model. Subsequently， the experiment was divided into a blank group （20% blank serum）， a model group （20% blank serum + 5×10^-5 mol·L^-1 AngⅡ）， low-， medium-， and high-dose （5%， 10% and 20%） serum containing Zhenwutang groups， an autophagy inhibitor group （1×10^-4 mol·L^-1 3-MA）， and autophagy inducer group （1×10^-7 mol·L^-1 rapamycin）. The apoptosis level of H9C2 cells and the changes of mitochondrial membrane potential were detected by flow cytometry. The lysosomal probe （Lyso Tracker） and mitochondrial probe （Mito Tracker） co-localization was employed to detect autophagy. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） was used to detect Caspase-3， Caspase-9， B-cell lymphoma 2 （Bcl-2）， Bcl-2-related X protein （Bax）， and cytochrome C （Cyt C） in apoptosis-related pathways and the relative mRNA expression of ubiquitin ligase （Parkin）， phosphatase and tensin homolog （PTEN）-induced kinase 1 （PINK1）， and p62 protein in mitochondrial autophagy-related pathways. Western blot was used to detect cleaved Caspase-3， cleaved Caspase-9， Bax， Bcl-2， and Cyt C in apoptosis-related pathways， phosphorylated ubiquitin ligase （p-Parkin）， phosphorylated PTEN-induced kinase 1 （p-PINK1）， p62， and Bcl-2 homology domain protein Beclin1 in mitochondrial autophagy-related pathways， and the change of microtubule-associated protein 1 light chain 3 （LC3） Ⅱ/Ⅰ ratio. ResultsCCK-8 showed that when the concentration of AngⅡ was 5×10^-5 mol·L^-1， the cell activity was the lowest， and there was no cytotoxicity. At this concentration， the surface area of cardiomyocytes was significantly increased （P<0.01）， and the content of BNP in the supernatant of culture medium was significantly increased （P<0.05）. Therefore， AngⅡ with a concentration of 5×10^-5 mol·L^-1 was selected for the subsequent modeling of myocardial mast cells. Compared with the blank group， the model group and the autophagy inhibitor 3-MA group had a significantly increased apoptosis rate （P<0.01） and significantly decreased mitochondrial membrane potential （P<0.01）. The results of immunofluorescence co-localization showed that compared with the blank group， the model group had a significantly decreased number of red and green fluorescence spots. The results of Real-time PCR showed that compared with that in the blank group， the relative mRNA expression of Bax， Caspase-3， Caspase-9， Cyt C， and p62 in the model group was significantly up-regulated （P<0.01）， while the relative mRNA expression of Bcl-2， Parkin， and PINK1 was significantly down-regulated （P<0.01）. In addition， the relative protein expression of Bax， cleaved Caspase-3， cleaved Caspase-9， Cyt C， and p62 was significantly up-regulated （P<0.01）. The LC3Ⅱ/Ⅰ was significantly decreased， and the relative protein expression of Bcl-2， p-Parkin， p-PINK1， and Beclin1 was significantly down-regulated （P<0.01）. Compared with the model group， the serum containing Zhenwutang groups and the autophagy inducer group had significantly decreased apoptosis rate （P<0.01）， and the decrease ratio of mitochondrial membrane potential is significantly lowered （P<0.01） in a dose-dependent manner. Additionally， both red and green fluorescence spots became more in these groups. In the 3-MA group， the number of red and green fluorescence spots decreased significantly. The relative mRNA expression of Bax， Caspase-3， Caspase-9， Cyt C， and p62 was significantly down-regulated （P<0.05， P<0.01）， while that of Bcl-2， Parkin， and PINK1 was significantly up-regulated （P<0.01）. In the serum containing Zhenwutang groups， the relative protein expression levels of Bax， cleaved Caspase-3， cleaved Caspase-9， Cyt C， and p62 were significantly down-regulated （P<0.05，P<0.01）. The LC3Ⅱ/Ⅰ was significantly increased， and the relative protein expression levels of Bcl-2， p-Parkin， p-PINK1， and Beclin1 were significantly up-regulated （P<0.01）. ConclusionThe serum containing Zhenwutang can reduce the apoptosis of myocardial mast cells and increase mitochondrial autophagy. This is related to the inhibition of intracellular Bax/Bcl-2/Caspase-3 apoptosis pathway and regulation of Parkin/PINK1 mitochondrial autophagy pathway.

The innate immune system can be boosted in response to subsequent triggers by pre-exposure to microbes or microbial products, known as “trained immunity”. Compared to classical immune memory, innate trained immunity has several different features. Firstly, the molecules involved in trained immunity differ from those involved in classical immune memory. Innate trained immunity mainly involves innate immune cells (e.g., myeloid immune cells, natural killer cells, innate lymphoid cells) and their effector molecules (e.g., pattern recognition receptor (PRR), various cytokines), as well as some kinds of non-immune cells (e.g., microglial cells). Secondly, the increased responsiveness to secondary stimuli during innate trained immunity is not specific to a particular pathogen, but influences epigenetic reprogramming in the cell through signaling pathways, leading to the sustained changes in genes transcriptional process, which ultimately affects cellular physiology without permanent genetic changes (e.g., mutations or recombination). Finally, innate trained immunity relies on an altered functional state of innate immune cells that could persist for weeks to months after initial stimulus removal. An appropriate inducer could induce trained immunity in innate lymphocytes, such as exogenous stimulants (including vaccines) and endogenous stimulants, which was firstly discovered in bone marrow derived immune cells. However, mature bone marrow derived immune cells are short-lived cells, that may not be able to transmit memory phenotypes to their offspring and provide long-term protection. Therefore, trained immunity is more likely to be relied on long-lived cells, such as epithelial stem cells, mesenchymal stromal cells and non-immune cells such as fibroblasts. Epigenetic reprogramming is one of the key molecular mechanisms that induces trained immunity, including DNA modifications, non-coding RNAs, histone modifications and chromatin remodeling. In addition to epigenetic reprogramming, different cellular metabolic pathways are involved in the regulation of innate trained immunity, including aerobic glycolysis, glutamine catabolism, cholesterol metabolism and fatty acid synthesis, through a series of intracellular cascade responses triggered by the recognition of PRR specific ligands. In the view of evolutionary, trained immunity is beneficial in enhancing protection against secondary infections with an induction in the evolutionary protective process against infections. Therefore, innate trained immunity plays an important role in therapy against diseases such as tumors and infections, which has signature therapeutic effects in these diseases. In organ transplantation, trained immunity has been associated with acute rejection, which prolongs the survival of allografts. However, trained immunity is not always protective but pathological in some cases, and dysregulated trained immunity contributes to the development of inflammatory and autoimmune diseases. Trained immunity provides a novel form of immune memory, but when inappropriately activated, may lead to an attack on tissues, causing autoinflammation. In autoimmune diseases such as rheumatoid arthritis and atherosclerosis, trained immunity may lead to enhance inflammation and tissue lesion in diseased regions. In Alzheimer’s disease and Parkinson’s disease, trained immunity may lead to over-activation of microglial cells, triggering neuroinflammation even nerve injury. This paper summarizes the basis and mechanisms of innate trained immunity, including the different cell types involved, the impacts on diseases and the effects as a therapeutic strategy to provide novel ideas for different diseases.

To summarize the clinical experience of Professor LIU Jinmin in treatment for epilepsy. It is believed that main pathogenesis of epilepsy is yangming failure to close and vital activity loss control， so a therapeutic approach focused on restoring the closure of yangming and regaining vital activity was proposed for the treatment of epilepsy. For excess syndrome， the treatment focuses on draining excess and descending qi， promoting purgation and restoring spirit. When yangming dryness-heat predominates， the approach involves unblock the bowels and regulating the spirit， descending qi and reducing fire， with modified Chengqi Decoction （承气汤） as prescription； when yangming phlegm-fire predominates， the treatment focuses on clearing heat and resolving phlegm， calming mind and suppressing fright， with modified Qingxin Wendan Decoction （清心温胆汤） as prescription； when yangming blood stasis predominates， the approach involves breaking up blood stasis and promoting purgation， eliminating stasis and awakening the mind， with Taoren Chengqi Decoction （桃核承气汤） as prescription. For deficiency syndrome， the treatment emphasizes tonifying deficiency and raising qi， strengthening the stomach and nourishing the spirit. When center qi deficiency and sinking of clear qi of the nutrients from food， the approach involves replenishing and uplifting qi while nourishing vital activity， with modified Liujunzi Decoction （六君子汤） as prescription； when yin deficiency and fluid consumption， the treatment focuses on nourishing stomach and tonifying yin， promoting fluid production and calming the spirit， with modified Maimendong Decoction （麦门冬汤） combined with Yiwei Decoction （益胃汤） as prescriptions. In clinical situations of deficiency-excess complex， it is essential to distinguish the primary condition from the secondary， applying both supplementing and draining methods flexibly to achieve optimal treatment.