Background The quality of occupational health technical services is directly linked to the protection of workers' health rights and the efficacy of occupational disease prevention and control. However, the industry still faces critical challenges: sporadic instances of institutional non-compliance and persistent irregularities in professional practice continue to undermine overall service performance. Objective To assess the current quality status of occupational health technical services in Zhejiang Province and propose countermeasures for quality improvement, providing a scientific basis for policy optimization and service delivery quality enhancement. Methods A total of 69 occupational health technical service institutions in Zhejiang Province that obtained formal accreditation as of April 30, 2024, were sampled, including 3 public institutions and 66 private institutions (comprising 3 formerly Class-A, 28 formerly Class-B, 11 formerly Class-C, and 24 newly certified institutions). Following the Technical Protocol for Quality Monitoring of Occupational Health Technical Service in Zhejiang Province and the Technical Protocol for Proficiency Testing of Occupational Health Detection in Zhejiang Province, a quality assessment task force comprising national and provincial experts was established. Evaluation was conducted across four dimensions: qualification maintenance and compliance, standardization of technical services, authenticity of technical services, and proficiency testing, utilizing a combination of document review, on-site inspections, and technical skill assessments. Results The occupational health technical service institutions in Zhejiang Province were predominantly private entities (82.5%), with significant disparities in overall service quality. The pass rates for qualification maintenance and compliance, technical service standardization, technical service authenticity, and the excellence rate for laboratory proficiency testing were 81.5%, 80.7%, 97.3%, and 90.4%, respectively. Regarding qualification maintenance, the pass rates for "environmental conditions" (49.8%, 56.7%) and "instrumentation and equipment" (58.2%、65.6%) were significantly lower for formerly Class-C and newly certified institutions compared to other categories. In terms of technical standardization, "standardized on-site inspections" recorded the lowest pass rate (67.4%), with newly certified institutions at only 48.0%. Regarding technical service authenticity, formerly Class-C institutions exhibited issues such as missing raw chromatograms for blank samples (85.7% pass rate). In laboratory proficiency testing, public and formerly Class-A institutions achieved 100% excellence rates, but the performance of formerly Class-C and newly certified institutions was comparatively weak; specifically, the failure rate for organic analysis in formerly Class-C institutions reached 20%; the failure rate for dust testing items in newly certified institutions was 10.3%. Conclusion The overall quality of occupational health technical services in Zhejiang Province still requires significant improvement, particularly in basic institutional conditions, the standardization of on-site inspections, and laboratory proficiency in organic and dust analysis. Formerly Class-C and newly certified institutions should be the primary focus of quality management efforts. Differentiated regulatory strategies are recommended, alongside strengthening interim and ex-post supervision to gradually enhance the quality of occupational health technical services across all institutions.

OBJECTIVE: To investigate the clinical manifestations and genetic etiology of a fetus with Neurodevelopmental disorders with deformed facial features and distal skeletal abnormalities (NEDDFSA). METHODS: Clinical data of a NEDDFSA fetus diagnosed at the Affiliated Women and Children's Hospital Affiliated to Ningbo University in March 2025 was selected as the study subject. Whole-exome sequencing (WES) was carried out on the amniotic fluid and parental peripheral blood samples, and candidate variants was verified by Sanger sequencing. The pathogenicity of candidate variant was rated based on guidelines from the American College of Medical Genetics and Genomics (ACMG). This study was approved by the Medical Ethics Committee of the hospital (Ethics No.: EC2023-094). RESULTS: At 30 weeks of gestation, the fetus was found to have microcephaly, short femur and intrauterine growth restriction. WES revealed that the fetus harbored a de novo heterozygous frameshift variant c.2633dup (p.Gly879ArgfsTer22) of the ZMIZ1 gene, which was rated as pathogenic (PM2_Supporting+PS2_Supporting+PVS1). Combined with 25 cases from the literature, the main manifestations of patients have included intellectual disability, growth retardation and cranio-limb skeletal dysplasia, albeit without clear genotype-phenotype correlation. CONCLUSION The de novo variant c.2633dup (p.Gly879ArgfsTer22) of the ZMIZ1 gene probably underlay the NEDDFSA in this fetus. Genetic testing has enabled accurate prenatal diagnosis and provided evidence for genetic counseling and reproductive guidance of this family.
Humans ; Female ; Pregnancy ; Neurodevelopmental Disorders/genetics* ; Transcription Factors/genetics* ; Fetus/abnormalities* ; Exome Sequencing ; Prenatal Diagnosis

Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.

Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

OBJECTIVE To establish a Chinese drug-related problem （DRP） classification system applicable to pharmacist-led pharmaceutical care in China， providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system， including literature review and analysis， comparison of existing classification systems， refinement of classification items and framework development， two rounds of standard case validation， expert discussion， and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ， assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem（including potential problems）， DRP evaluation， cause （including possible causes of potential problems）， intervention， acceptance of intervention and DRP status]， with 24 primary codes and 96 secondary codes. In the first round of case validation， κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round， κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system， positive ratings （“strongly agree” or “agree”） exceeded 85% for all items. Specifically， positive ratings for“the classification system can provide appropriate category selection”，“ the classification system is comprehensive”，“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability， providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.

ObjectiveTo construct a stable monoclonal human embryonic kidney 293 （HEK293） cell line expressing recombinant human coagulation factor Ⅶ （rhFⅦ） and evaluate the expression level and procoagulant bioactivity of rhFⅦ. MethodsThe plasmid pCDNA3.1-EGFP-FⅦ was transfected into HEK293 cells to verify the effectiveness of the transfection system. The plasmid pCDNA3.1-FⅦ was transfected into HEK293 cells， and monoclonal stable transfected cell lines were selected using geneticin （G418）. The transcription of the FⅦ gene was identified by reverse transcription polymerase chain reaction （RT-PCR）. The expression level of rhFⅦ in the supernatant of the monoclonal stable transfected cell line was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot. The concentration of rhFⅦ was determined by enzyme-linked immunosorbent assay （ELISA）， and the procoagulant activity of rhFⅦ was measured by human coagulation factor Ⅶ potency assay. ResultsHEK293 cells transfected with pcDNA3.1-EGFP-FⅦ showed green fluorescence， indicating that rhFⅦ was successfully expressed in the supernatant of HEK293 cells after transient transfection with pcDNA3.1-FⅦ. The monoclonal stable transfected cell line was obtained by G418 screening. RT-PCR identified that the FⅦ gene was integrated into the genome of the monoclonal stable transfected cell line. The cell viability was good as detected by Cell Counting Kit-8， and a single band of rhFⅦ was obtained by purification of the cell supernatant. The highest rhFⅦ expression was （1.27±0.09） mg/L， and the highest procoagulant activity was （380.29±13.80）%. ConclusionThe monoclonal HEK293 cell lines which can express rhFⅦ protein efficiently and stably with excellent procoagulant bioactivity is successfully screened.

ObjectiveTo investigate the mechanism of Zuogui Wan （ZGW） in improving ovarian inflammatory microenvironment and stemness of ovarian germline stem cells （OSCs） for treating ovarian aging via the cyclic guanosine monophosphate/adenosine monophosphate synthase （cGAS）/stimulator of interferon genes （STING） signaling pathway. MethodsForty C57BL/6 female mice were randomly divided into a blank group， a model group， a low-dose ZGW group （2.7 g·kg^-1）， a high-dose ZGW group （5.4 g·kg^-1）， and an estradiol valerate group （0.15 mg·kg^-1）， with 8 mice in each group. Except the blank group， all other groups received a single intraperitoneal injection of cyclophosphamide at 120 mg·kg^-1 to establish an ovarian aging mouse model. After successful modeling， each group was continuously administered for 4 weeks， once daily. The physiological status of the mice was observed， and the ovarian index was calculated. The estrus cycle of the mice was monitored. Hematoxylin-eosin （HE） staining was used to observe pathological changes in ovarian tissue. Enzyme-linked immunosorbent assay （ELISA） was used to detect serum sex hormone levels. Serum inflammatory factors interleukin-1β （IL-1β）， tumor necrosis factor-α （TNF-α）， and mouse interleukin-6 （IL-6） levels were detected using kits. Western blot was used to detect the protein expression of ovarian cGAS， STING， p-STING， TANK-binding kinase 1 （TBK1）， p-TBK1， interferon-induced transmembrane protein 3 （Fragilis）， and Vasa homolog protein （MVH）. Quantitative real-time polymerase chain reaction （Real-time PCR） was used to detect the mRNA expression of inflammatory factors in ovarian tissue. Immunofluorescence double labeling was performed to locate OSCs in ovarian tissues， and fluorescence intensities of OSCs markers MVH and octamer binding transcription factor 4 （Oct4） were calculated. ResultsCompared with the blank group， the model group showed reduced body weight， ovarian wet weight， and ovarian index （P<0.01） and a disordered estrus cycle （P<0.01）. In addition， the levels of serum follicle-stimulating hormone （FSH）， TNF-α， IL-6， and IL-1β were increased （P<0.01）， while anti-Müllerian hormone （AMH） and estradiol （E₂） levels were decreased （P<0.01）. The protein expression of cGAS， p-STING/STING， and p-TBK1/TBK1 in ovarian tissue was increased （P<0.05， P<0.01）， while that of OSCs stemness factors MVH and Fragilis was reduced （P<0.01）. Immunofluorescence indicated a reduction in MVH and Oct4 expression in OSCs （P<0.01）. The mRNA expression of inflammatory factors TNF-α， IL-6， and IL-1β in ovarian tissue was increased （P<0.05， P<0.01）. Compared with the model group， the treatment groups exhibited improved body weight， ovarian wet weight， and ovarian index （P<0.05） and a reduced rate of estrus cycle disorder （P<0.05， P<0.01）. The levels of serum FSH， TNF-α， IL-6， and IL-1β were decreased （P<0.05， P<0.01）， while AMH and E₂ levels were increased （P<0.01）. The protein expression levels of cGAS， p-STING/STING， and p-TBK1/TBK1 in ovarian tissue were decreased （P<0.05）， while the protein expression of MVH and Fragilis was increased （P<0.05）， and the fluorescence intensities of MVH and Oct4 were increased （P<0.05， P<0.01）. The mRNA expression of inflammatory factors in ovarian tissue was decreased （P<0.05）. ConclusionZGW alleviate ovarian inflammatory response， regulate ovarian microenvironment homeostasis， and maintain stemness of OSCs in ovarian aging mice probably by modulating the cGAS-STING signaling pathway， thereby improving ovarian function and delaying ovarian aging.