AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor （ErbB）， namely ErbB1， ErbB2， ErbB3， and ErbB4， in the spinal dorsal horn of inflammatory pain model rats， and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）". MethodsThe study was divided into five parts. In experiment 1， 14 Sprague Dawley （SD） rats were randomly divided into control and inflammatory pain group （7 rats each group） to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2， 30 rats were randomly divided into control group 1， inflammatory pain group 1， and low-， medium-， and high-concentration TX1-85-1 groups， with 6 rats in each group， to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3， 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group， with 6 rats in each group， to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4， 44 rats were randomly divided into control group 2， inflammatory pain group 2， electroacupuncture group， and sham electroacupuncture group， with 11 rats in each group， to observe the effect of electroacupuncture. In experiment 5， 40 rats were randomly divided into control group 3， inflammatory pain group 3， electroacupuncture group 1， and electroacupuncture + NRG1 group， with 10 rats in each group， to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-， medium-， and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA （shRNA） into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli （ST 36）" and "Kunlun （BL 60）" from day 1 to day 7 after modeling， with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 （NRG1） after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1， 3， 5， and 7 after modeling to evaluate behavior， and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group， rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats， and increased expression of phosphorylated ErbB3 （p-ErbB3） protein in the spinal dorsal horn on days 1， 3， 5， and 7 after modeling （P＜0.01）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 1， the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 1， 3， 5， and 7 after modeling， compared with the control virus group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased （P＜0.05）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 2 and the sham electroacupuncture group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 5 and day 7 after modeling， compared with the electroacupuncture + NRG1 group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased （P＜0.05）. ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain， and electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.

Objective: To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control. Methods: Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence. Results: A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk. Conclusions SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.

ObjectiveThis paper aims to observe the role of Danlou tablet in treating coronary heart disease （CHD） with phlegm-stasis intermingling syndrome in minipigs by improving platelet function and explore the potential pharmacological mechanism of Danlou tablet in regulating platelet function by using proteomics technology. MethodsThirty Bama minipigs were randomly divided into a normal control group （6 pigs） and a high-fat diet group （24 pigs）. After 2 weeks of high-fat diet feeding， the high-fat diet group was randomly subdivided into a model group， an atorvastatin group （1 mg·kg^-1）， and Danlou tablet groups （0.6 g·kg^-1 and 0.3 g·kg^-1）. All groups continued to receive a high-fat diet for 8 weeks after the procedure. The normal control group was given a regular diet， underwent only coronary angiography， and did not receive an interventional injury procedure. The model group and each administration group were fed a high-fat diet. Two weeks later， they underwent a coronary angiography injury procedure. After the procedure， drugs were mixed into the feed every morning for 8 consecutive weeks， with the minipigs maintained on a continuous high-fat diet during this period. Quantitative proteomics technology was further used to study platelet proteins， and differential proteins were obtained by screening. Bioinformatics analysis was performed to analyze key regulatory proteins and biological pathways involved in the therapeutic effect of Danlou tablet on CHD with phlegm-stasis intermingling syndrome. ResultsCompared with the normal control group， the model group showed a significant increase in total cholesterol （TC）， triglyceride （TG）， high-density lipoprotein cholesterol （HDL-C）， and low-density lipoprotein cholesterol （LDL-C） of minipigs' serum （P<0.01）， a significant shortening in prothrombin time of （PT） （P<0.01）， a coagulation function index， and an increase in whole blood viscosity （P<0.01） and platelet aggregation rate （P<0.01）. Moreover， the platelet morphology was altered， and the contents of endothelin-1 （ET-1） and nitric oxide （NO） were significantly increased （P<0.01）. Hemodynamic parameters were obviously abnormal， including significantly decreased systolic blood pressure （SBP）， diastolic blood pressure （DBP）， mean arterial pressure （MAP）， left ventricular systolic pressure （LVSP）， and left ventricular maximal positive dp/dt （LV+dp/dt_max） （P<0.01）. Left ventricular maximal negative dp/dt （LV-dp/dt_max） was significantly increased （P<0.01）. Besides， there were myocardial cell hypertrophy， obvious edematous degeneration， massive interstitial inflammatory cell infiltration， high degree of fibrosis， and coronary endothelial atherosclerosis. TC and TG levels in minipigs' serum were significantly reduced in Danlou tablet groups with 0.6 g·kg^-1 and 0.3 g·kg^-1 （P<0.05， P<0.01）， compared with those in the model group. LDL-C was decreased in the Danlou tablet group with 0.6 g·kg^-1 （P<0.05）. The whole blood viscosity under low and high shear conditions was significantly reduced in the Danlou tablet group with 0.6 g·kg^-1 （P<0.05）. In groups with all doses of Danlou tablet， maximum aggregation rate （MAR） and average aggregation rate （AAR） were significantly decreased （P<0.05， P<0.01）， and platelets' morphological changes such as pseudopodia extension were reduced. ET-1 levels in the serum were significantly reduced. In the Danlou tablet group with 0.6 g·kg^-1， NO level in the serum was reduced （P<0.05）. In groups with all doses of Danlou tablet， DBP and MAP were significantly increased （P<0.05）. In the Danlou tablet group with 0.6 g·kg^-1， LVSP and LV+dp/dt_max were significantly increased （P<0.05， P<0.01）， and LV-dp/dt_max was significantly decreased （P<0.05）. In groups with all doses of Danlou tablet， edematous degeneration in myocardial tissue was milder， and coronary artery lesion degree was significantly alleviated. Compared with the normal control group， there were 94 differentially expressed proteins in the model group， including 81 up-regulated and 13 down-regulated proteins. Compared with the model group， the Danlou tablet group with 0.6 g·kg^-1 showed 174 differentially expressed proteins， including 100 up-regulated and 74 down-regulated proteins. A total of 30 proteins were reversed after Danlou tablet intervention. Bioinformatics analysis revealed that its pharmacological mechanism may exert anti-platelet activation， aggregation， and adhesion effects through biological pathways such as regulation of actin cytoskeleton， platelet activation pathway， Fcγ receptor-mediated phagocytosis， as well as proteins such as growth factor receptor-bound protein 2 （GRB2）， Ras-related C3 botulinum toxin substrate 2 （RAC2）， RAC1， and heat shock protein 90 alpha family class A member 1 （HSP90AA1）. ConclusionDanlou tablet can effectively reduce platelet activation and aggregation， exerting a good therapeutic effect on CHD with phlegm-stasis intermingling syndrome in minipigs. Its pharmacological mechanism may involve regulating biological pathways such as actin cytoskeleton and platelet activation pathway， as well as proteins like GRB2， RAC2， RAC1， and HSP90AA1， thereby exerting a pharmacological effect in anti-platelet activation， aggregation， and adhesion.

The global burden of malignant tumors keeps increasing， and the increased morbidity and mortality make malignant tumors one of the major challenges to global health. Currently， malignant tumors are mainly managed by surgical resection， radiotherapy， chemotherapy， targeted therapy， and immunotherapy， which， however， usually cause serious adverse reactions， such as tissue damage， immune function inhibition， and multidrug resistance， affecting the prognosis and quality of life of the patients. Traditional Chinese medicine with low toxic and side effects and multi-target， multi-system， and multi-pathway therapeutic effects has shown positive therapeutic potential in cancer treatment. In particular， the traditional Chinese medicine with the effects of softening hardness and dissipating mass， which contains a variety of active ingredients， have shown strong inhibitory effects on tumor cells. Such medicine can not only directly attack tumor cells and inhibit their proliferation and invasion but also exert therapeutic effects by inducing apoptosis， blocking tumor-related signaling pathways， and inhibiting tumor angiogenesis. In addition， traditional Chinese medicine can improve the overall efficacy of cancer treatment by regulating the immune status of the body and reversing the drug resistance of tumor cells. Traditional Chinese medicine can exert the anti-tumor effect by regulating intracellular signaling pathways， which is one of the research hotspots in this field. Signaling pathways such as signal transducer and activator of transcription 3 （STAT3）， phosphatidylinositol 3-kinase （PI3K）/protein kinase B （Akt）/mammalian target of rapamycin （mTOR）， and mitogen-activated protein kinase （MAPK） play a key role in the formation and development of tumors. Traditional Chinese medicine can regulate the growth， apoptosis， and metabolic process of tumor cells by affecting the activity of these signaling pathways， thus exerting the therapeutic effects on tumors. Based on these mechanisms， a large number of experimental studies and clinical trials have proved that traditional Chinese medicine has broad prospects in anti-tumor treatment. To further verify these research results and provide a basis for the clinical application of traditional Chinese medicine and the development of new drugs， a systematic review and integrated analysis of the research reports on the anti-tumor effect of traditional Chinese medicine was carried out to summarize the anti-tumor mechanisms of traditional Chinese medicine. This review is expected to promote the wide application of traditional Chinese medicine in anti-tumor treatment worldwide and bring more hope and possibility to cancer patients.

Prescription optimization is a crucial aspect in the study of traditional Chinese medicine （TCM） compounds. In recent years， the introduction of mathematical methods， data mining techniques， and artificial neural networks has provided new tools for elucidating the compatibility rules of TCM compounds. The study of TCM compounds involves numerous variables， including the proportions of different herbs， the specific extraction parts of each ingredient， and the interactions among multiple components. These factors together create a complex nonlinear dose-effect relationship. In this context， it is essential to identify methods that suit the characteristics of TCM compounds and can leverage their advantages for effective application in new drug development. This paper provided a comprehensive review of the cutting-edge optimization experimental design methods applied in recent studies of TCM compound compatibilities. The key technical issues， such as the optimization of source material selection， dosage optimization of compatible herbs， and multi-objective optimization indicators， were discussed. Furthermore， the evaluation methods for component effects were summarized during the optimization process， so as to provide scientific and practical foundations for innovative research in TCM and the development of new drugs based on TCM compounds.

Ovarian cancer （OC） is one of the most common malignant tumors in women， with the mortality rate being the highest among gynaecological malignant tumors. As the atypical symptoms of OC are difficult to be detected in the early stage， most patients are already in the advanced stage when being diagnosed. As a result， the clinical treatment has limited effects. Currently， the main therapies for OC are surgery and chemotherapy， while their drug resistance and adverse reactions seriously reduce the quality of life of patients. In recent years， traditional Chinese medicine （TCM） has attracted the attention of clinicians and researchers because of its high efficacy， low toxicity， and mild side effects. According to the TCM philosophy of treatment based on syndrome differentiation， the Chinese medicines with multiple targets， wide range， and mild side effects can be screened based on the molecular targets involved in the occurrence and development of OC， which can bring out the unique advantages of TCM in the treatment of OC. Modern studies have shown that the occurrence and development of OC are closely related to the abnormal expression of multiple signaling pathways. The continued abnormal activation of the signal transducer and activator of transcription 3 （STAT3） signaling pathway can lead to abnormal proliferation and malignancy of OC. cause abnormal proliferation and malignant transformation of OC， which is closely related to the development of OC. In addition， studies have shown that Chinese medicine can inhibit the proliferation， angiogenesis， invasion， and metastasis and promote the autophagy and apoptosis of OC cells by regulating the Janus kinase 2 （JAK2）/STAT3 signaling pathway， providing new therapeutic strategies and ideas for the prevention and treatment of OC. This paper summarizes the role of JAK2/STAT3 signaling pathway in OC development by reviewing the relevant articles and reviews the mechanism and research progress of active components and compound prescriptions of Chinese medicine intervening in OC development by regulating the JAK2/STAT3 signaling pathway. This review is expected to provide a systematic reference for clinical research and drug development of OC.

The medicinal use of Malvae Semen has a long history. In this paper， by consulting the ancient materia medica， prescription， agronomy， literature and other aspects of the classics， the name， origin， evolution of scientific name， quality， harvesting and processing， functions and indications and others of Malvae Semen were systematically sorted out and verified， so as to provide a basis for the development and utilization of famous classical formulas containing this herb. According to the textual research， Shennong Bencaojing began to use Dongkuizi as the correct name， which was used in the past dynasties， and there were also aliases such as Kuicaizi， Huacai， and Kuizi. Through the original research， it can be seen that Kuicai is the mainstream original plant of Malvae Semen， that is， Malva verticillata var. crispa， the Alcea rosea and M. cathayensis are also used. In modern times， the seeds of Abutilon theophrasti have been passed off as Malvae Semen， while the seeds of M. verticillata var. crispa have rarely been used in medicine. And Abutili Semen has been another medicinal material with different efficacy since the collection of Newly Revised Materia Medica in the Tang dynasty. Since the Ming and Qing dynasties， the cultivation of Kuicai has been decreasing， while A. theophrasti is more common and easy to obtain， and Abutili Semen and Malvae Semen are similar in morphology and confused， which should be corrected. In addition， Malvae Fructus is a Mongolian customary medicinal herb， which is different from the traditional use of seeds in traditional Chinese medicine. Kuicai， as an important vegetable in history， was widely cultivated and gradually shrunk after the Song dynasty， it is now mainly produced in southern provinces. The quality evaluation of Malvae Semen is better for those with dry bodies， full grain， grayish brown color， no mud， and no impurities. The harvesting is generally in the autumn and winter. After drying， it is seeded， sieved peel and impurities， mashed， or slightly stir-fried to yellow-white color with gentle fire. It is sweet， cold and slippery in nature and taste， with the main effects of laxation， diuresis， lactation and elimination of swelling. The efficacy of Abutili Semen is clearing heat and removing toxicity， promoting diuresis and removing nebula， the efficacy is quite different from that of Malvae Semen. Based on the results of textual research， it is suggested that M. verticillata var. crispa should be used as the medicinal source of Malvae Semen in the development of famous classical formulas， the corresponding processing methods should be selected according to the requirements of drug processing in the formulas， while the raw products are recommended to be used if the processing is not specified.

The medicinal use of Malvae Semen has a long history. In this paper， by consulting the ancient materia medica， prescription， agronomy， literature and other aspects of the classics， the name， origin， evolution of scientific name， quality， harvesting and processing， functions and indications and others of Malvae Semen were systematically sorted out and verified， so as to provide a basis for the development and utilization of famous classical formulas containing this herb. According to the textual research， Shennong Bencaojing began to use Dongkuizi as the correct name， which was used in the past dynasties， and there were also aliases such as Kuicaizi， Huacai， and Kuizi. Through the original research， it can be seen that Kuicai is the mainstream original plant of Malvae Semen， that is， Malva verticillata var. crispa， the Alcea rosea and M. cathayensis are also used. In modern times， the seeds of Abutilon theophrasti have been passed off as Malvae Semen， while the seeds of M. verticillata var. crispa have rarely been used in medicine. And Abutili Semen has been another medicinal material with different efficacy since the collection of Newly Revised Materia Medica in the Tang dynasty. Since the Ming and Qing dynasties， the cultivation of Kuicai has been decreasing， while A. theophrasti is more common and easy to obtain， and Abutili Semen and Malvae Semen are similar in morphology and confused， which should be corrected. In addition， Malvae Fructus is a Mongolian customary medicinal herb， which is different from the traditional use of seeds in traditional Chinese medicine. Kuicai， as an important vegetable in history， was widely cultivated and gradually shrunk after the Song dynasty， it is now mainly produced in southern provinces. The quality evaluation of Malvae Semen is better for those with dry bodies， full grain， grayish brown color， no mud， and no impurities. The harvesting is generally in the autumn and winter. After drying， it is seeded， sieved peel and impurities， mashed， or slightly stir-fried to yellow-white color with gentle fire. It is sweet， cold and slippery in nature and taste， with the main effects of laxation， diuresis， lactation and elimination of swelling. The efficacy of Abutili Semen is clearing heat and removing toxicity， promoting diuresis and removing nebula， the efficacy is quite different from that of Malvae Semen. Based on the results of textual research， it is suggested that M. verticillata var. crispa should be used as the medicinal source of Malvae Semen in the development of famous classical formulas， the corresponding processing methods should be selected according to the requirements of drug processing in the formulas， while the raw products are recommended to be used if the processing is not specified.

Aromatic inhalation therapy is a key traditional Chinese medicine （TCM） approach for preventing respiratory infectious diseases. Its foundational theory， "aromatics acting on the spleen"， is deeply rooted in TCM principles and supported by modern medical research. The theory posits that the aromatic properties of medicinals primarily act on the spleen， and the aromatic inhalation therapy achieved its protective effects by modulation of the spleen and spleen channel to enhance the regulation of wei qi， striae and interstices. In TCM， the spleen is considered the mother of the lungs， with the function of nurturing lung； it is also seen as the source of wei qi， responsible for external defense； and the root of healthy qi， forming the foundation of acquired （postnatal） constitution. Thus， preventive strategies for respiratory infectious diseases focus on strengthening the spleen. From a modern medical perspective， the spleen's role in regulating lung immune responses， the shared immune functions of the respiratory and gastrointestinal mucosa， and the spleen's overall immune modulation provide scientific evidence for using aromatic inhalation therapy to prevent respiratory infections. Additionally， aromatic inhalation therapy offers several advantages， including direct action， rapid onset， minimal side effects， controllable risks， convenience， and ease of dissemination， making it a practical and effective preventive measure for respiratory infectious diseases.