ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To explore a model for constructing a platform for medical institution formulation and provide insights for promoting their development. METHODS By systematically reviewing the development status and challenges of medical institution preparations in China， and based on the theory of industry-university-research collaborative innovation， the organizational structure， collaborative processes， and safeguard mechanisms of the platform were designed. RESULTS & CONCLUSIONS Medical institution formulations in China mainly faced challenges such as weak research and development （R&D） capacity， uneven quality standards， and blocked transformation pathways. This study established a full-chain， whole- industry collaborative innovation network covering the government， medical institutions， universities/research institutes， pharmaceutical enterprises， and the market， forming a new “government-industry-university-research-application” five-in-one platform model for medical institution formulations. By establishing mechanisms such as multi-entity collaborative cooperation， full- chain intellectual property management， contribution-based benefit distribution， staged risk-sharing， and third-party evaluation， the model clarified the responsibilities and collaborative pathways of all parties. The new model highlights the whole-process transformation of clinical experience-based prescriptions， enabling precise alignment between clinical needs and technological R&D， as well as between preparation achievements and industrial transformation. While breaking down the barriers of traditional platform construction， it effectively achieves optimal resource allocation and complementary advantages， addresses problems emerging in the development of medical institution preparations， and provides reference value for the formulation of relevant systems.

Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.

OBJECTIVE To establish a Chinese drug-related problem （DRP） classification system applicable to pharmacist-led pharmaceutical care in China， providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system， including literature review and analysis， comparison of existing classification systems， refinement of classification items and framework development， two rounds of standard case validation， expert discussion， and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ， assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem（including potential problems）， DRP evaluation， cause （including possible causes of potential problems）， intervention， acceptance of intervention and DRP status]， with 24 primary codes and 96 secondary codes. In the first round of case validation， κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round， κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system， positive ratings （“strongly agree” or “agree”） exceeded 85% for all items. Specifically， positive ratings for“the classification system can provide appropriate category selection”，“ the classification system is comprehensive”，“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability， providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.

The promulgation of the Technical Specifications for Clinical Use of Blood (2025 Edition) signifies that China's clinical blood transfusion management has transitioned from mere technical operations to a new stage centered on patient blood management (PBM). Through an in-depth comparison of the new and old specifications, this paper analyzes the core transformations regarding conceptual reconstruction, legal alignment, technological upgrades, and closed-loop management. The new specifications establish PBM principles, reinforce legal safeguards for informed consent and emergency treatment, and construct a comprehensive, refined quality control system by specifying compatibility testing standards and introducing a post-transfusion evaluation system. Medical institutions should seize this opportunity to update management protocols and information systems, deepen multidisciplinary collaboration, and drive the profound transformation of clinical blood use from focusing solely on safety assurance to placing equal emphasis on science and value.

Objective To explore the effects of CYP2C19, CYP2C9 and CYP3A5 genotypes on the plasma concentration of voriconazole in children. Methods Collected blood samples from 50 hospitalized children with invasive fungal infections who received intravenous voriconazole from January 2020 to December 2020. High performance liquid chromatography was used to detect the blood trough concentration of voriconazole, and the time-of-flight mass spectrometry detection system was used to detect the genotypes of CYP2C19, CYP2C9 and CYP3A5, and the effects of children’s genotyping on the plasma concentration, efficacy and adverse reactions of voriconazole were analyzed. Results The total effective rate of 50 children with IFI was 84% （42/50 cases） after voriconazole treatment. The incidence of adverse reactions was 20% （10/50 cases）. The measured plasma concentration of voriconazole ranged from 0.56~7.62 μg/ml. Combined with the different mutation types of CYP2C19 gene loci, three metabolic activities were produced: fast, medium and slow, and the test results showed that there were 16 cases of fast metabolism, 27 cases of intermediate metabolism and 7 cases of slow metabolism. There was a significant difference in plasma concentrations among the three groups （F=15.359, P<0.001）, and the drug concentrations in the fast metabolic group were significantly lower than those in the intermediate metabolic and slow metabolic groups. The mutations of CYP2C9 and CYP3A5 had no significant effect on the plasma concentrations of the drugs, which were （F=2.213, P=0.086 and F=0.757, P=0.475）. Conclusion Voriconazole had significant efficacy in the treatment of invasive fungal infections in children, and the adverse reactions were mild. CYP2C19 genotype was significantly related to the rate of drug metabolism and was an important factor affecting blood drug concentration, the detection of drug concentration and genotype of voriconazole was helpful to adjust the effective drug dose clinically and would achieve more scientific and individualized treatment.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

AIM: To observe the manifestations and distribution patterns of visual field in non-arteritic anterior ischemic optic neuropathy(NAION).METHODS: Retrospective observational study. The investigation encompassed 183 patients(246 eyes)diagnosed with NAION who were evaluated at the Neuro-Ophthalmology/Acupuncture Department within the Eye Hospital, China Academy of Chinese Medical Sciences from June 2018 to December 2023. Recorded clinical data covered demographic details, incidence, disease duration, presence of systemic diseases, and histories of tobacco and alcohol use, along with best-corrected visual acuity(BCVA), visual field index(VFI), type of visual field defect, and thickness of the peripapillary retinal nerve fiber layer(pRNFL).RESULTS: A total of 183 patients(246 eyes)were enrolled. The cohort consisted of 101 males and 82 females; 120 exhibited unilateral symptoms, while 63 showed bilateral symptoms, with a mean age of 56.20±9.78 years(range 29-81 years). The types of visual field defects observed were varied: 90 eyes(36.6%)had diffuse loss, 63 eyes(25.6%)experienced inferior hemifield loss, 32 eyes(13.0%)displayed ring scotomas, 22 eyes(8.9%)had arcuate scotomas, 11 eyes(4.5%)presented with quadrant defects, 15 eyes(6.1%)had sectorial or wedge defects, and 13 eyes(5.3%)showed superior hemifield loss. The BCVA(LogMAR)and VFI of patients with diffuse visual field loss were poorer than patients with other types of visual defects(all P<0.05). There were statistically significant differences in visual field defects among patients of different genders and ages(all P<0.05). However, history of hypertension, diabetes, hyperlipidemia, sleep apnea and other systemic diseases, history of smoking and alcohol, and course of disease did not show specificity in the NAION visual field(all P>0.05).CONCLUSION:NAION manifests with a broad spectrum of visual field impairments across different genders, age, and levels of visual functionality. Extensive future research is necessary to identify additional reasons influencing the types of visual field damage in NAION.

Five saponins were isolated from the kernels of Momordica cochinchinensis, by macroporous resin, silica gel, ODS column chromatography, and semi preparative HPLC. Based on MS and NMR analysis, combining with alkaline hydrolysis and acid hydrolysis, their structures were identified as: gypsogenin-3-O-{β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonosyl}-28-O-β-D-xylopyranosyl (1→3)-[β-D-xylopyranosyl (1→4)]-α-L-rhamnopyranosyl (1→2)-β-D-fucopyranoside (1), quillaic acid-3-O-{β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonosyl}-28-O-β-D-xylopyranosyl (1→3)-[β-D-xylopyranosyl (1→4)]-α-L-rhamnopyranosyl (1→2)-β-D-fucopyranoside (2), gypsogenin-3-O-β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonoside sodium (3), quillaic acid-3-O-β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonoside sodium (4), 18α-quillaic acid-3-O-β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonoside (5). Compounds 1-5 were new compounds, and named as mubezhisides A, B, C, D, E, respectively. They all could obviously inhibited the growth of Candida albicans, C. parapsilosis, and C. tropicalis.