1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
3.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
4.Preparation,characterization and quantitative analysis of β-cyclodextrin inclusion complex with volatile oil from Qianghuo qushi qingwen granules
Yicheng SUN ; Lingrui QIN ; Kaiping ZOU ; Chenguang ZHAO ; Li DOU ; Shun LIU ; Lingang ZHAO
China Pharmacy 2026;37(6):746-751
OBJECTIVE To prepare the β -cyclodextrin ( β -CD) inclusion complex with volatile oil from Qianghuo qushi qingwen granules, and to characterize and quantitatively analyze the inclusion complex. METHODS The comprehensive scores calculated by inclusion rate and inclusion compound yield were used as indicators for screening the inclusion method. The single-factor experiments and Box-Behnken response surface experiments were used to op timize the inclusion conditions, with the above comprehensive score as response value, and taking the ratio of β -CD to volatile oil, inclusion temperature and inclusion time as indexes. The volatile oil inclusion complex of Qianghuo qushi qingwen granules was prepared according to the determined optimal process, followed by validation. Ultraviolet (UV)-visible spectroscopy, thin-layer chromatography (TLC), and microscopic imaging were also performed. Ultra-high performance liquid chromatography was used to determine the contents of perillaldehyde, pogostone and atractylodin. RESULTS The saturation aqueous solution method was adopted. The optimal inclusion process conditions were as follows: the ratio of β -CD to volatile oil was 7.5∶1, the inclusion temperature was 40 ℃, and the inclusion time was 2.2 h. In three verification experiments, the average inclusion rate was 72.32%, the average yield of inclusion compound was 74.45%, the average comprehensive score was 72.96 points, and the relative error with the predicted value (74.15 points) of the model was 1.61%. UV-visible spectroscopy, TLC and microscopic imaging showed that β -CD and volatile oil successfully formed a new inclusion complex. The average contents of perillaldehyde, pogostone and atractylodin were 4.498 2, 0.814 9, 0.905 7 mg/g, respectively, with RSDs of 0.31%, 0.56% and 0.63% ( n =3). CONCLUSIONS A stable and feasible preparation process of the volatile oil inclusion complex of Qianghuo qushi qingwen granules is successfully established.
5.Safety of using glucagon-like peptide-1 receptor agonists before gastrointestinal endoscopy:an overview of systematic reviews
Yuzhou LI ; Shuying ZOU ; Xiangnan ZHU ; Li TANG ; Peng LI ; Caixia XIE
China Pharmacy 2026;37(6):806-811
OBJECTIVE To conduct a systematic review concerning the safety of using glucagon-like peptide-1 receptor agonists (GLP-1RA) before gastrointestinal endoscopy. METHODS Chinese and English databases including CNKI, Wanfang Data, VIP, CBM, and PubMed were searched to collect systematic reviews and meta-analyses on the safety of using GLP-1RA before gastrointestinal endoscopy, with a search period from the inception to September 30, 2025. Report quality, methodological quality, risk of bias, and evidence quality were assessed using the PRISMA 2020 statement, AMSTAR 2 scale, ROBIS tool, and GRADE tool, respectively. Corrected covered area (CCA) was used to quantitatively evaluate the degree of outcome overlap, and a comprehensive quality analysis was performed on the quantitative results of systematic reviews/meta-analyses. RESULTS Ten studies were included. All 10 stu dies had some information deficiencies (15.5-19.5 points), and were at high risk of bias; 9 studies were extremely low methodological quality, while 1 study was low. In terms of evidence quality, among 88 outcome indexes, there was 1 moderate-level index, 28 low-level indexes, and 59 extremely low-level indexes. The CCA values of the incidence of residual gastric contents, aspiration, endoscopy interruption, repeated endoscopy, inadequate bowel preparation and Boston Bowel Preparation Scale scores were 37.30%, 35.00%, 35.00%, 50.00%, 29.60% and 20.00%, respectively. Results of comprehensive quality analysis showed that compared with the control group, the incidence of residual gastric contents, endoscopy interruption and repeated endoscopy were increased significantly in the intervention group, along with a notably prolonged gastric emptying time and a significantly lower score of Boston Bowel Preparation Scale ( P <0.05). However, the study results regarding the effects of GLP-1RA on the incidence of aspiration and inadequate bowel preparation were inconsistent. CONCLUSIONS The use of GLP-1RA before gastrointestinal endoscopy can increase certain safety risks, including residual gastric contents, endoscopy interruption and repeated endoscopy, prolong gastric emptying time, and reduce the quality of bowel preparation. However, the effects on aspiration and inadequate bowel preparation remain controversial. The reports included in systematic reviews/meta-analyses exhibited low quality in reporting, methodology and evidence, with high risk of bias. Therefore, conclusions should be interpreted with caution.
6.Current quality status and management countermeasures of occupational health technical services in Zhejiang Province
Qiuliang XU ; Feng HAN ; Peng WANG ; Zhen ZHOU ; Fei LI ; Hongwei XIE ; Yong HU ; Weiming YUAN ; Lifang ZHOU ; Hua ZOU
Journal of Environmental and Occupational Medicine 2026;43(3):341-346
Background The quality of occupational health technical services is directly linked to the protection of workers' health rights and the efficacy of occupational disease prevention and control. However, the industry still faces critical challenges: sporadic instances of institutional non-compliance and persistent irregularities in professional practice continue to undermine overall service performance. Objective To assess the current quality status of occupational health technical services in Zhejiang Province and propose countermeasures for quality improvement, providing a scientific basis for policy optimization and service delivery quality enhancement. Methods A total of 69 occupational health technical service institutions in Zhejiang Province that obtained formal accreditation as of April 30, 2024, were sampled, including 3 public institutions and 66 private institutions (comprising 3 formerly Class-A, 28 formerly Class-B, 11 formerly Class-C, and 24 newly certified institutions). Following the Technical Protocol for Quality Monitoring of Occupational Health Technical Service in Zhejiang Province and the Technical Protocol for Proficiency Testing of Occupational Health Detection in Zhejiang Province, a quality assessment task force comprising national and provincial experts was established. Evaluation was conducted across four dimensions: qualification maintenance and compliance, standardization of technical services, authenticity of technical services, and proficiency testing, utilizing a combination of document review, on-site inspections, and technical skill assessments. Results The occupational health technical service institutions in Zhejiang Province were predominantly private entities (82.5%), with significant disparities in overall service quality. The pass rates for qualification maintenance and compliance, technical service standardization, technical service authenticity, and the excellence rate for laboratory proficiency testing were 81.5%, 80.7%, 97.3%, and 90.4%, respectively. Regarding qualification maintenance, the pass rates for "environmental conditions" (49.8%, 56.7%) and "instrumentation and equipment" (58.2%、65.6%) were significantly lower for formerly Class-C and newly certified institutions compared to other categories. In terms of technical standardization, "standardized on-site inspections" recorded the lowest pass rate (67.4%), with newly certified institutions at only 48.0%. Regarding technical service authenticity, formerly Class-C institutions exhibited issues such as missing raw chromatograms for blank samples (85.7% pass rate). In laboratory proficiency testing, public and formerly Class-A institutions achieved 100% excellence rates, but the performance of formerly Class-C and newly certified institutions was comparatively weak; specifically, the failure rate for organic analysis in formerly Class-C institutions reached 20%; the failure rate for dust testing items in newly certified institutions was 10.3%. Conclusion The overall quality of occupational health technical services in Zhejiang Province still requires significant improvement, particularly in basic institutional conditions, the standardization of on-site inspections, and laboratory proficiency in organic and dust analysis. Formerly Class-C and newly certified institutions should be the primary focus of quality management efforts. Differentiated regulatory strategies are recommended, alongside strengthening interim and ex-post supervision to gradually enhance the quality of occupational health technical services across all institutions.
7.A fetus with Neurodevelopmental disorders with deformed facial features and distal skeletal abnormalities due to a rare variant of ZMIZ1 gene and literature review.
Jinghui ZOU ; Haibo LI ; Lulu YAN
Chinese Journal of Medical Genetics 2026;43(4):295-300
OBJECTIVE:
To investigate the clinical manifestations and genetic etiology of a fetus with Neurodevelopmental disorders with deformed facial features and distal skeletal abnormalities (NEDDFSA).
METHODS:
Clinical data of a NEDDFSA fetus diagnosed at the Affiliated Women and Children's Hospital Affiliated to Ningbo University in March 2025 was selected as the study subject. Whole-exome sequencing (WES) was carried out on the amniotic fluid and parental peripheral blood samples, and candidate variants was verified by Sanger sequencing. The pathogenicity of candidate variant was rated based on guidelines from the American College of Medical Genetics and Genomics (ACMG). This study was approved by the Medical Ethics Committee of the hospital (Ethics No.: EC2023-094).
RESULTS:
At 30 weeks of gestation, the fetus was found to have microcephaly, short femur and intrauterine growth restriction. WES revealed that the fetus harbored a de novo heterozygous frameshift variant c.2633dup (p.Gly879ArgfsTer22) of the ZMIZ1 gene, which was rated as pathogenic (PM2_Supporting+PS2_Supporting+PVS1). Combined with 25 cases from the literature, the main manifestations of patients have included intellectual disability, growth retardation and cranio-limb skeletal dysplasia, albeit without clear genotype-phenotype correlation.
CONCLUSION
The de novo variant c.2633dup (p.Gly879ArgfsTer22) of the ZMIZ1 gene probably underlay the NEDDFSA in this fetus. Genetic testing has enabled accurate prenatal diagnosis and provided evidence for genetic counseling and reproductive guidance of this family.
Humans
;
Female
;
Pregnancy
;
Neurodevelopmental Disorders/genetics*
;
Transcription Factors/genetics*
;
Fetus/abnormalities*
;
Exome Sequencing
;
Prenatal Diagnosis
8.Applications of Lactoferrin and Its Nanoparticles in Cancer Therapy
Wen-Tian YUE ; Shu-Rong HE ; Qin AN ; Yun-Xia ZOU ; Wen-Wen DONG ; Qing-Yong MENG ; Ya-Li ZHANG
Progress in Biochemistry and Biophysics 2026;53(2):342-355
Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.
9.Applications of Lactoferrin and Its Nanoparticles in Cancer Therapy
Wen-Tian YUE ; Shu-Rong HE ; Qin AN ; Yun-Xia ZOU ; Wen-Wen DONG ; Qing-Yong MENG ; Ya-Li ZHANG
Progress in Biochemistry and Biophysics 2026;53(2):342-355
Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.
10.Proteome-wide Mendelian randomization analysis of plasma proteins identifies biomarkers for anxiety disorders
Xuelian LI ; Min DENG ; Rongting RAN ; Yuqian HE ; Geman WANG ; Yujie LI ; Zhili ZOU
Sichuan Mental Health 2026;39(1):63-69
BackgroundAnxiety disorder is a common mental disorder, with its prevalence showing a continuous upward trend, significantly affecting the quality of life and social function of patients. Due to the lack of objective and reliable biomarkers in clinical practice, the early identification and treatment of anxiety disorder have been somewhat limited. Plasma proteins have the potential to serve as biomarkers for mental diseases, however, the causal relationship between them and anxiety disorder remains unclear. ObjectiveTo identify the plasma proteins that have a causal relationship with anxiety disorders, and to elucidate the associated biological pathways, in order to provide references for the search for biomarkers of anxiety disorders and the exploration of potential therapeutic targets. MethodsBased on the protein quantitative trait locus (pQTL) data of 4 907 plasma proteins covering 35 559 Icelandic individuals from the deCODE database, and the genome-wide association studies (GWAS) data of 50 486 patients with anxiety disorders and 330 460 healthy controls, the inverse-variance weighted (IVW) method was used as the main analysis method, supplemented by MR-Egger method, weighted median method, simple model method, and weighted model method for bidirectional Mendelian randomization analysis. Enrichment analysis of gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways was conducted for the related proteins. Sensitivity analysis was performed using Cochran's Q test, MR-Egger intercept test, MR-PRESSO test, and leave-one-out analysis to evaluate the robustness of the results. ResultsA total of 10 plasma proteins were identified as significantly associated with anxiety disorders. Among these, SPATA9 (OR=0.856, 95% CI: 0.784–0.934, P<0.01) and PDE5A (OR=0.911, 95% CI: 0.864–0.961, P<0.01) were identified as protective factors, while CRYGD (OR=1.209, 95% CI: 1.095–1.334, P<0.01), BTN3A3 (OR=1.045, 95% CI: 1.018–1.073, P<0.01), SERPINB13 (OR=1.102, 95% CI: 1.040–1.168, P<0.01), ERBB4 (OR=1.283, 95% CI: 1.109–1.484, P<0.01), LSAMP (OR=1.096, 95% CI: 1.037–1.158, P<0.01), ICOSLG (OR=1.283, 95% CI: 1.104–1.490, P<0.01), DNAJB11 (OR=1.172, 95% CI: 1.076–1.277, P<0.01), and TREML1 (OR=1.115, 95% CI: 1.054–1.179, P<0.01) were identified as risk factors. The sensitivity analysis showed that the results were robust, with no heterogeneity (Cochran's Q test P>0.05) or pleiotropy (MR-Egger intercept test P>0.05). Enrichment analysis indicated that these plasma proteins were enriched in biological processes such as T-cell signal transduction, lymphocyte proliferation, cell membrane structure and synaptic function, as well as the intestinal immune network that produces IgA and the ErbB signaling pathway. ConclusionThis study identified 10 plasma proteins associated with anxiety disorders. The functions of these plasma proteins involve multiple biological processes such as neural development and immune regulation.

Result Analysis
Print
Save
E-mail