1.TGF-β1-engineered Biomimetic Platelet Nanoparticles for Targeted Therapy of Ischemic Stroke
Li-Qi CHEN ; Tian-Fang KANG ; Guo-Jun HUANG ; Ting YIN ; Ai-Qing MA ; Lin-Tao CAI ; Hong PAN
Progress in Biochemistry and Biophysics 2026;53(3):697-710
ObjectivePost-ischemic acute inflammation and the subsequent persistent dysregulation of the immune microenvironment represent major pathological drivers that aggravate neuronal injury and severely restrict functional recovery following ischemic stroke. Although current reperfusion therapies partially restore blood flow, they fail to effectively modulate the secondary inflammatory cascade and oxidative stress, which remain critical barriers to neurological restoration. To address this challenge, this study aimed to engineer and systematically evaluate a biomimetic nanosystem composed of transforming growth factor-β1 (TGF-β1)-loaded platelet membrane-camouflaged lipid nanoparticles (PLP). This nanosystem was designed to achieve dual lesion-targeted delivery and immune microenvironment remodeling. By verifying its spatiotemporal accumulation, anti-inflammatory activity, and neuroprotective efficacy, we sought to establish an integrated therapeutic strategy that simultaneously enables lesion targeting, immune regulation, and functional recovery after ischemic injury. MethodsThe physicochemical properties of PLP, including hydrodynamic particle size, zeta potential, structural stability, and morphology, were characterized using dynamic light scattering, zeta potential analysis, and transmission electron microscopy. The preservation of platelet membrane-derived adhesion and immunoregulatory proteins was confirmed by SDS-PAGE through comparative analysis of protein band profiles between PLP and native platelet membranes. The in vitro biological activities of PLP were evaluated using two complementary cellular models. LPS-induced M1-polarized RAW264.7 macrophages were employed to assess inflammatory modulation, while oxygen glucose deprivation/reperfusion (OGD/R)-induced BV2 microglial cells and SH-SY5Y neuronal cells were utilized to investigate neuroinflammatory regulation and neuronal protection. For in vivo validation, a transient middle cerebral artery occlusion (tMCAO) mouse model was established to mimic ischemia-reperfusion injury. The spatiotemporal biodistribution and lesion-targeting capability of the PLP were monitored through live fluorescence imaging. Therapeutic efficacy was comprehensively evaluated by triphenyltetrazolium chloride (TTC) staining, glial fibrillary acidic protein (GFAP) immunofluorescence analysis, body weight monitoring, and neurological severity score (NSS) assessment. ResultsPLP nanoparticles displayed a uniform spherical morphology, nanoscale particle size distribution, and stable negative surface charge, indicating favorable colloidal stability and circulation potential. SDS-PAGE results confirmed the effective retention of key platelet membrane proteins associated with endothelial adhesion, immune evasion, and inflammatory regulation, demonstrating the successful biomimetic construction. Optimal therapeutic concentrations were determined in OGD/R-induced BV2 cells, where PLP exhibited excellent cytocompatibility and anti-inflammatory activity.In vitro experiments demonstrated that PLP significantly inhibited the polarization of RAW264.7 macrophages toward the pro-inflammatory M1 phenotype and markedly reduced neuronal apoptosis under ischemia-reperfusion conditions. In vivo fluorescence imaging revealed that PLP rapidly accumulated in the ischemic brain hemisphere and maintained prolonged retention for up to 7 d, suggesting enhanced lesion-specific targeting and sustained drug release. Compared with control group, PLP treatment significantly reduced cerebral infarct volume, attenuated reactive astrogliosis, improved weight recovery, and accelerated neurological functional restoration, as reflected by significantly improved NSS scores. ConclusionThis study establishes a multifunctional biomimetic nanoplatform that integrates platelet membrane-mediated active targeting with the anti-inflammatory, antioxidative, and neuroprotective properties of TGF-β1. The PLP system enables rapid lesion homing and long-term retention while synergistically regulating the post-stroke inflammatory microenvironment by suppressing pro-inflammatory immune activation, reducing neuronal apoptosis, and limiting excessive astrocyte reactivity. Importantly, this study proposes a conceptually therapeutic paradigm that combines targeted delivery with immune microenvironment remodeling to achieve comprehensive neurovascular protection. These findings provide strong experimental evidence supporting the translational potential of biomimetic nanotherapeutics as next-generation precision interventions for ischemic stroke.
2.Effect of Microorganisms on The Spoilage of Donkey Hides From Different Regions
Meng ZHANG ; Qiu-Mei LI ; Jia-Wei KANG ; Jie YU ; Xia LI ; Yue YU
Progress in Biochemistry and Biophysics 2026;53(3):754-766
ObjectiveDonkey hide is the sole legally designated raw material for the preparation of the traditional Chinese medicine Ejiao. The quality stability of donkey hide during preservation directly determines the efficacy and safety of Ejiao. This study focuses on the dynamic succession of microbial communities during the preservation of donkey hides from different origins, aiming to clarify the correlation between microbial biodiversity difference and the degradation profiles of hide collagen and critical biochemical components, thereby providing a theoretical foundation for developing targeted preservation strategies based on microbial regulation. MethodsDonkey hides originating from four different regions were subjected to an accelerated microbial aging assay to simulate the spoilage process. The microbial community succession was analyzed using high-throughput sequencing. Microstructure changes and pore structure characteristics were assessed by scanning electron microscopy and mercury intrusion porosimetry, respectively. Additionally, the content of major components, including lipids, proteins, and sugars were determined by biochemical methods. ResultsAfter 96 h of aging, the collagen fiber structure in Africa donkey hides (ADH) exhibited significant degradation and collapse, followed by Xinjiang donkey hides (XDH). Instead, the microstructure of Dong’e black donkey hides (DDH) and Peru donkey hides (PDH) remained relatively intact. The porosities of DDH, XDH, PDH, and ADH increased from 27.9%, 15.7%, 30.3%, and 46.2% to 36.5%, 52.6%, 42.8%, and 57.7%, respectively, during the aging process, which suggested that the originally compact fiber structure was disrupted by microbial aging. Fourier transform infrared spectrometer analysis revealed the amide bands in XDH exhibited relatively weak intensity, and no collagen amide I band was observed in ADH. Meanwhile, the lipid and protein contents decreased in all four types of donkey hides, indicating that these components served as the primary nutrient sources for the growth of microorganism. Notably, the most severe collagen degradation was observed in XDH and ADH. A substantial increase was detected in the total soluble sugar in PDH aging solution and hydroxyproline in the ADH aging solution, respectively. These results indicated that donkey hides exhibit distinct patterns of structural degradation and nutrient utilization. Furthermore, the viable cells number of donkey hides increased sharply after 48 h of aging. Metagenomic analysis revealed that the relative abundance of Euryarchaeota in ADH, PDH and XDH declining from initial 93.19%, 97.73% and 30.08% to 0.79%, 1.43% and 0.02% after 96 h, respectively. Conversely, a significantly increase was observed in the abundance of Bacillota, with a marked increase in ADH, peaking at 92.75%. Additionally, the abundance of Pseudomonadota in PDH increased from 0.10% to 87.84%, suggesting that Bacillota and Pseudomonadota may be key factors exacerbating donkey hide spoilage. Unlike the other three types of donkey hides, the dominant bacterial phylum in DDH shifted from Pseudomonadota to Bacteroidota, characterized by a substantial abundance increase of Bacteroidota from 0.13% to 44.22%. ConclusionRegional variation in origin significantly influence the microbial aging of donkey hides, leading to distinct patterns of structural deterioration and differential nutrient utilization. Therefore, implementing origin-specific preservation strategies, through the precisely controlling environmental factors to suppress harmful phyla such as Bacillota and Pseudomonadota, is crucial for enhancing the storage quality of donkey hides.
3.Construction and Application of a Real-World Cohort of Community-Acquired Pneumonia Based on a Multimodal Large-Scale Traditional Chinese Medicine Big Data Platform
Zhichao WANG ; Xianmei ZHOU ; Fanchao FENG ; Mengqi WANG ; Xin WANG ; Bin KANG ; Xiaofan YU ; Xiaoxiao WANG ; Lei XIAO ; Juan LI ; Zhichao ZHANG ; Ye MA ; Yeqing JI ; Xin TONG ; Zhuoyue WU ; Jia LIU
Journal of Traditional Chinese Medicine 2026;67(9):961-965
This paper introduces a real-world cohort research model for community-acquired pneumonia (CAP) based on the Jiangsu Traditional Chinese Medicine (TCM) Dominant Diseases Diagnosis and Treatment Data Platform. Firstly, data cleaning is performed by standardizing diagnosis, symptoms, treatment and imaging, intelligently extracting unstructured information, and cleaning and constructing a standardized database. Secondly, for cohort establishment, CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly, in terms of protocol design, the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria, estimate sample size, define interventions, outcomes and economic evaluations, providing a reference for real-world TCM research on CAP.
4.Construction and Application of a Real-World Cohort of Community-Acquired Pneumonia Based on a Multimodal Large-Scale Traditional Chinese Medicine Big Data Platform
Zhichao WANG ; Xianmei ZHOU ; Fanchao FENG ; Mengqi WANG ; Xin WANG ; Bin KANG ; Xiaofan YU ; Xiaoxiao WANG ; Lei XIAO ; Juan LI ; Zhichao ZHANG ; Ye MA ; Yeqing JI ; Xin TONG ; Zhuoyue WU ; Jia LIU
Journal of Traditional Chinese Medicine 2026;67(9):961-965
This paper introduces a real-world cohort research model for community-acquired pneumonia (CAP) based on the Jiangsu Traditional Chinese Medicine (TCM) Dominant Diseases Diagnosis and Treatment Data Platform. Firstly, data cleaning is performed by standardizing diagnosis, symptoms, treatment and imaging, intelligently extracting unstructured information, and cleaning and constructing a standardized database. Secondly, for cohort establishment, CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly, in terms of protocol design, the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria, estimate sample size, define interventions, outcomes and economic evaluations, providing a reference for real-world TCM research on CAP.
5.Analysis of HIV test results in blood screening laboratories and strategies for donor management
Xianyuan WANG ; Xuefeng HAN ; Yazi ZHAO ; Jie KANG ; Xi NIE ; Congya LI ; Wei HAN ; Yanbin WANG
Chinese Journal of Blood Transfusion 2026;39(4):437-443
Objective: To explore a simple, effective, and safe method for excluding false positives and identifying infections by comprehensively evaluating blood donors with reactive HIV screening results, thereby providing a basis for developing management strategies for such donors. Methods: HIV testing data of blood donors from our laboratory from January 2022 to December 2024 were collected. The results of ELISA and nucleic acid testing (NAT) were combined with confirmatory results from the CDC and analyzed. Results: A total of 605 929 samples were tested for HIV over the three-year period, with 682 reactive samples (reactive rate: 11.25 per 10 000). All were sent to the CDC for Western blot (WB) confirmation, resulting in 53 confirmed positives ((confirmed positive rate: 7.77%). Among these, 619 samples showed isolated HIV Ag&Ab reactivity with non-reactive NAT (HIV Ag&Ab+-&HIV RNA or NAT NR), with a confirmed infection rate of 0%; 9 samples showed dual HIV Ag&Ab reactivity with non-reactive NAT (HIV Ag&Ab++&HIV RNA NR or NAT NR), also with 0% confirmed infection; 52 samples showed dual HIV Ag&Ab reactivity and reactive NAT (HIV Ag&Ab++&HIV RNA R or NAT R), all confirmed as positive (100% infection rate); and 2 HIV Ag&Ab dual-reactive samples without NAT detection were also confirmed infected (100%). For all four HIV Ag&Ab assays, the S/CO values in the true positive group with dual reactivity were significantly higher than those in the false-positive groups (P<0.05). The S/CO distributions for both single-reactive false positives and dual-reactive false positives were narrow, with the upper box (Q3, 75th percentile) below optimal cutoff values in all cases (The optimal cutoff values for the four reagents were 5.00, 11.67, 8.50, and 20.90, respectively). Conclusion: Blood donors with positive NAT results in HIV blood screening are permanently deferred. Donors with dual positive HIV Ag&Ab but negative NAT results are classified and managed based on the S/CO values of HIV Ag&Ab and the optimal screening thresholds. Donors with single positive HIV Ag&Ab but negative NAT results are placed under evaluation status and retain their eligibility to donate blood. Optimizing the management measures for blood donors and establishing a scientific stratified management and assessment mechanism can effectively maintain the stability of the blood donor team.
6.Analysis of follow-up and prognosis in pediatric rheumatic diseases associated with pulmonary embolism
Tong YUE ; Yuchun YAN ; Min KANG ; Jia ZHU ; Yingjie XU ; Dan ZHANG ; Ming LI ; Min WEN ; Feifei WU ; Jianming LAI
Chinese Journal of Pediatrics 2026;64(1):89-94
Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.
7.Mitogen-activated protein kinase signaling pathway regulates the development of osteoarthritis:guiding targeted therapy with traditional Chinese medicine
Hao LI ; Hongcheng TAO ; Ping ZENG ; Jinfu LIU ; Qiang DING ; Chicheng NIU ; Kai HUANG ; Hongyu KANG
Chinese Journal of Tissue Engineering Research 2026;30(6):1476-1485
BACKGROUND:Osteoarthritis is pathologically characterized by progressive degeneration of the articular cartilage and abnormal deformation of the subchondral bone.In recent years,with the deepening of medical research,it has been found that the mitogen-activated protein kinases(MAPK)signaling pathway has a regulatory role in inflammatory cell infiltration,inflammatory factor release,and chondrocyte proliferation,which is particularly important for the treatment of osteoarthritis.OBJECTIVE:To briefly review the main research progress in the mechanism of MAPK signaling pathway regulating osteoarthritis in recent years,aiming to provide new ideas for the treatment of osteoarthritis.METHODS:CNKI,WanFang and PubMed databases were searched for relevant literature using the search terms of"mitogen-activated protein kinases,osteoarthritis,extracellular signal-regulated MAP kinases,p38 mitogen-activated protein kinases,JNK mitogen-activated protein kinase"in Chinese and English.Relevant literature published from January 2019 to November 2024 was searched,and 108 articles were finally included for summary analysis.RESULTS AND CONCLUSION:(1)Various stimuli inside and outside the cells activate the MAPK signaling pathway,regulate gene transcription and protein synthesis,and promote the release of inflammatory factors,such as tumor necrosis factor-α,interleukin-1β,and interleukin-6.The release of these inflammatory factors aggravates the progression of osteoarthritis.(2)The active ingredients of traditional Chinese medicine,mainly saponins and flavonoids,as well as Chinese herbal formulas and preparations with the main effects of activating blood circulation and removing blood stasis,tonifying the liver and kidney,can play a therapeutic role in osteoarthritis by inhibiting the MAPK signaling pathway,regulating the release of matrix metalloproteinases,balancing the homeostatic state of osteogenesis and osteoblastogenesis,attenuating the synovial inflammation,decreasing the release of inflammatory factors and inflammatory vesicles,decreasing cellular pyroptosis,promoting autophagy,and ameliorating oxidative stress.(3)Although traditional Chinese medicine has become popular in the treatment of osteoarthritis by virtue of its own advantages of multi-components,multi-targets,multi-pathways,and low side effects,the use of MAPK signaling pathway to guide the treatment of individual osteoarthritis is the difficulty of the technology,which needs to be continuously researched and explored.(4)Therefore,further development of relevant herbal inhibitors that can modulate the MAPK signaling pathway may be a potential drug strategy for the treatment of osteoarthritis in the future.
8.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
9.Action Mechanism of Huamoyan Granules in Treatment of Knee Osteoarthritis Based on TRPV1/p38 MAPK Pathway
Jin ZHANG ; Lili YANG ; Canwen ZHENG ; Jing KANG ; Yanlei MA ; Yue SHI ; Lei LI ; Hongxu MENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):79-89
ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis (KOA) and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization, which can effectively inhibit the progression of pathological inflammatory response, reduce the release of inflammatory pain mediators, and downregulate the protein expression level of transient receptor potential vanilloid 1 (TRPV1), so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding, Sprague-Dawley (SD) rats were randomly divided into six groups: sham group, model group, celecoxib group, and high, medium, and low-dose synovitis granule groups (9.6, 4.8, 2.4 g·kg-1). The administration dose of celecoxib capsules was 20 mg·kg-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10th day of the experiment, each administration group was given intragastric administration at a dose of 10 mL·kg-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold (PPT) to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay (ELISA) was performed to detect the tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and other pro-inflammatory cytokines in rat serum samples, as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor (NGF) and calcitonin gene-related peptide (CGRP). Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin (HE) staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1, p38 mitogen-activated protein kinase (p38 MAPK), and phosphorylated (p)-p38 MAPK in rat knee synovial tissues. Immunofluorescence (IF) was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group, the circumference and joint diameter of the right knee were markedly enlarged in the model group (P<0.01), while PPTs of rats showed a significant reduction (P<0.01). The contents of IL-1β, TNF-α, CGRP, and NGF in rats' serum were significantly elevated (P<0.01), and the synovial Krenn score was increased (P<0.01). The Mankin score of cartilage tissue was increased (P<0.01), and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated (P<0.01). The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population (P<0.01), and the percentage of M2 macrophages was decreased (P<0.01). The M1/M2 macrophage ratio was significantly elevated (P<0.01). Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced (P<0.01) compared with those of the model group, and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious (P<0.05). The contents of IL-1β, CGRP, and NGF in the rats' serum in all administration groups were significantly reduced (P<0.05, P<0.01), and the content of TNF-α in rats' serum was significantly reduced (P<0.01). All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score (P<0.05, P<0.01) and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues (P<0.01). The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased (P<0.01). The percentage of M2 macrophages was increased (P<0.05), and the M1/M2 ratio was decreased (P<0.01). ConclusionHuamoyan granules can alleviate the inflammatory response of KOA, reduce the release of inflammatory pain mediators, and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway, thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.
10.Research progress on the comorbidity mechanism of dry eye and depression
Yunfan ZHANG ; Kang WANG ; Jing LI
International Eye Science 2026;26(4):629-635
Dry eye disease(DED)and depression(DEP), though anatomically and clinically distinct, show significant epidemiological, pathophysiological, and prognostic interplay. Their co-occurrence has risen sharply in recent years, yet the mechanisms driving this comorbidity remain under-investigated. This review systematically synthesizes current evidence, highlighting that pro-inflammatory cytokines, neuro-regulatory imbalance, mitochondrial dysfunction, and gut-microbiota dysbiosis constitute a shared molecular network, while sleep deprivation and antidepressant use further amplify the vicious cycle. By identifying limitations in existing studies, this review proposes future research directions to offer new theoretical and clinical insights for managing DED-DEP comorbidity.

Result Analysis
Print
Save
E-mail