1.Comparison of Efficacy and Mechanism in Warming Yang and Dispersing Cold of Aconiti Radix Lateralis Praeparata Processed by ZHANG Zhongjing's Method and Pharmacopoeia Method
Mingjie JIAO ; Qian CHEN ; Shuyu YAN ; Yiyan SONG ; Jia ZHANG ; Fei LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):207-217
ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata(ARLP) in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group, model group, Shengfupian(SFP) group, Paofuzi(PFZ) group, Heishunpian(HSP) group and Paofupian(PFP) group with 6 rats in each group. Except for the control group, rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days, each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg-1·d-1 for 7 d, while the control and model groups received an equivalent volume of physiological saline. After the end of administration, body weight, spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin(HE) staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol(TC), triglyceride(TG), lactic dehydrogenase(LDH) and lactate(LAC) levels in serum. Enzyme-linked immunosorbent assay(ELISA) was employed to measure the contents of 17-hydroxycorticosteroid(17-OHCS), cortisol(CORT), triiodothyronine(T3), thyroxine(T4), thyrotropin(TSH), immunoglobulin(Ig) M, IgG, cyclic adenosine monophosphate(cAMP) and cyclic guanosine monophosphate(cGMP). Western blot was used to measure the protein expression levels of protein kinase A(PKA), cAMP response element-binding protein(CREB), silent information regulator 1(Sirt1) and peroxisome proliferator-activated receptor γ coactivator-1α(PGC-1α). And high performance liquid chromatography(HPLC) was used to determine the content of major alkaloids, followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling, compare with the control group, the model rats exhibited symptoms such as lethargy and loose stools, mild abnormalities were observed in adrenal tissue structure, and both spleen and thymus indices were significantly reduced(P<0.01). Thyroid, adrenal and immune system functions were suppressed, with decreased serum cAMP level and significantly elevated cGMP level(P<0.01). Compared with the model group, the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups(P<0.05, P<0.01). The thymus index in SFP and PFZ groups were increased significantly(P<0.05). The contents of T3, TSH, 17-OHCS and CORT were increased significantly in SFP and PFZ groups(P<0.05). In addition, the content of IgG in SFP, PFZ and PFP groups were increased significantly(P<0.01), while the content of IgM in PFZ and HSP groups were also increased significantly(P<0.05). Regarding the cyclic nucleotide system, PFZ significantly elevated cAMP level while reducing cGMP level(P<0.05), exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators, PFZ significantly improved abnormal markers including TC, TG, LDH, and LAC(P<0.05). HSP showed marked improvement effects on TG, LDH, and LAC(P<0.05). Both PFZ and SFP significantly elevated the expression levels of PKA, CREB, Sirt1, and PGC-1α proteins(P<0.01). Additionally, the diester alkaloids in ARLP showed a strong positive correlation with TG, IgG, and CORT, a strong negative correlation with LAC, a moderate positive correlation with T4, and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG, strong negative correlations with LAC, moderate positive correlations with CORT and T4, and moderate negative correlations with cAMP and spleen index. However, the content of water-soluble alkaloids showed strong positive correlations with TC, LDH, 17-OHCS, T3, TSH, and thymus index, moderate positive correlations with cAMP, CORT, T4, and spleen index, and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces, PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid, adrenal, immune, cyclic nucleotide systems, and material-energy metabolism pathways. Among these, water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore, PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.
2.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
3.Exploration of a new model for the construction of medical institution formulation platforms from the perspective of industry-university-research collaborative innovation theory
Kana LIN ; Anle SHEN ; Yejian WANG ; Yanqiong WANG ; Hao LI ; Yanfang GUO ; Youjun WANG ; Xinyan SUN
China Pharmacy 2026;37(2):137-141
OBJECTIVE To explore a model for constructing a platform for medical institution formulation and provide insights for promoting their development. METHODS By systematically reviewing the development status and challenges of medical institution preparations in China, and based on the theory of industry-university-research collaborative innovation, the organizational structure, collaborative processes, and safeguard mechanisms of the platform were designed. RESULTS & CONCLUSIONS Medical institution formulations in China mainly faced challenges such as weak research and development (R&D) capacity, uneven quality standards, and blocked transformation pathways. This study established a full-chain, whole- industry collaborative innovation network covering the government, medical institutions, universities/research institutes, pharmaceutical enterprises, and the market, forming a new “government-industry-university-research-application” five-in-one platform model for medical institution formulations. By establishing mechanisms such as multi-entity collaborative cooperation, full- chain intellectual property management, contribution-based benefit distribution, staged risk-sharing, and third-party evaluation, the model clarified the responsibilities and collaborative pathways of all parties. The new model highlights the whole-process transformation of clinical experience-based prescriptions, enabling precise alignment between clinical needs and technological R&D, as well as between preparation achievements and industrial transformation. While breaking down the barriers of traditional platform construction, it effectively achieves optimal resource allocation and complementary advantages, addresses problems emerging in the development of medical institution preparations, and provides reference value for the formulation of relevant systems.
4.Expert consensus on neoadjuvant PD-1 inhibitors for locally advanced oral squamous cell carcinoma (2026)
LI Jinsong ; LIAO Guiqing ; LI Longjiang ; ZHANG Chenping ; SHANG Chenping ; ZHANG Jie ; ZHONG Laiping ; LIU Bing ; CHEN Gang ; WEI Jianhua ; JI Tong ; LI Chunjie ; LIN Lisong ; REN Guoxin ; LI Yi ; SHANG Wei ; HAN Bing ; JIANG Canhua ; ZHANG Sheng ; SONG Ming ; LIU Xuekui ; WANG Anxun ; LIU Shuguang ; CHEN Zhanhong ; WANG Youyuan ; LIN Zhaoyu ; LI Haigang ; DUAN Xiaohui ; YE Ling ; ZHENG Jun ; WANG Jun ; LV Xiaozhi ; ZHU Lijun ; CAO Haotian
Journal of Prevention and Treatment for Stomatological Diseases 2026;34(2):105-118
Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.
5.Principles, technical specifications, and clinical application of lung watershed topography map 2.0: A thoracic surgery expert consensus (2024 version)
Wenzhao ZHONG ; Fan YANG ; Jian HU ; Fengwei TAN ; Xuening YANG ; Qiang PU ; Wei JIANG ; Deping ZHAO ; Hecheng LI ; Xiaolong YAN ; Lijie TAN ; Junqiang FAN ; Guibin QIAO ; Qiang NIE ; Mingqiang KANG ; Weibing WU ; Hao ZHANG ; Zhigang LI ; Zihao CHEN ; Shugeng GAO ; Yilong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):141-152
With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.
6.Mechanism of Intervening with Diarrhea-predominant Irritable Bowel Syndrome in Rats with Spleen Deficiency by Xingpi Capsules Through Regulating 5-HT-RhoA/ROCK2 Pathway
Gang WANG ; Lingwen CUI ; Xiangning LIU ; Rongxin ZHU ; Mingyue HUANG ; Ying SUN ; Boyang JIAO ; Ran WANG ; Chun LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(6):60-69
ObjectiveTo investigate the efficacy of Xingpi capsules (XPC) in treating diarrhea-predominant irritable bowel syndrome (IBS-D) with spleen deficiency and elucidate its potential molecular mechanisms. MethodsA rat model of IBS-D with spleen deficiency was established by administering senna leaf in combination with restrained stress and swimming fatigue for 14 d. Ten specific pathogen free (SPF)-grade healthy rats were used as the normal control group. After successful modeling, SPF-grade rats were randomly divided into a model group, a pinaverium bromide group (1.5 mg·kg-1), and low- and high-dose XPC groups (0.135 and 0.54 g·kg-1), with 10 rats in each group. Rats in the normal control group and the model group were given distilled water by gavage, while the remaining groups were administered corresponding drug solutions by gavage once a day for 14 consecutive days. The rat body weights and fecal condition were observed every day, and the Bristol score was recorded. Enzyme-linked immunosorbent assay (ELISA) was used to determine the levels of 5-hydroxytryptamine (5-HT) in serum and colon tissue. Transmission electron microscopy was used to observe the microvilli and tight junctions in the colon. The integrity of the colonic barrier, intestinal motility, and expression of related pathway proteins were evaluated by hematoxylin-eosin (HE) staining, immunohistochemistry, and Western blot. ResultsCompared with those in the normal control group, rats in the model group showed a significantly decreased body weight and increased diarrhea rate, diarrhea grade, and Bristol score (P<0.01). HE staining revealed incomplete colonic mucosa in the model group, with evident congestion and edema observed. Electron microscopy results indicated decreased density and integrity of the colonic barrier, shedding and disappearance of microvilli, and significant widening of tight junctions. The expression levels of colonic tight junction proteins Occludin and Claudin-5 were downregulated (P<0.01), and the levels of 5-HT in serum and colon tissue were elevated (P<0.01). The small intestine propulsion rate significantly increased (P<0.01), and the expression of contractile proteins Ras homolog family member A (RhoA) and Rho-associated coiled-coil containing protein kinase 2 (ROCK2) in colon and phosphorylation of myosin light chain (MLC20) were upregulated (P<0.01). Compared with the model group, the treatment groups showed alleviated diarrhea, diarrhea-associated symptoms, and pathological manifestations of colon tissue to varying degrees. Specifically, high-dose XPC exhibited effectively relieved diarrhea, promoted recovery of colonic mucosal structure, significantly reduced congestion and edema, upregulated expression of Occludin and Claudin-5 (P<0.01), decreased levels of 5-HT in serum and colon tissue (P<0.05,P<0.01), significantly slowed small intestine propulsion rate (P<0.01), and significantly downregulated expression of contractile proteins RhoA and ROCK2 in colon and phosphorylation of MLC20 (P<0.05,P<0.01). ConclusionXPC effectively alleviates symptoms of spleen deficiency and diarrhea and regulates the secretion of brain-gut peptide. The characteristics of XPC are mainly manifested in alleviating IBS-D with spleen deficiency from the aspects of protecting intestinal mucosa and inhibiting smooth muscle contraction, and the mechanism is closely related to the regulation of the 5-HT-RhoA/ROCK2 pathway expression.
7.Optimization of Ovarian Tissue Vitrification Using Hydrogel Encapsulation and Magnetic Induction Nanowarming
Yu-Kun CAO ; Na YE ; Zheng LI ; Xin-Li ZHOU
Progress in Biochemistry and Biophysics 2025;52(2):464-477
ObjectiveFor prepubertal and urgently treated malignant tumor patients, ovarian tissue cryopreservation and transplantation represent more appropriate fertility preservation methods. Current clinical practices often involve freezing ovarian tissue with high concentrations of cryoprotectants (CPAs) and thawing with water baths. These processes lead to varying degrees of toxicity and devitrification damage to ovarian tissue. Therefore, this paper proposes optimized methods for vitrification of ovarian tissues based on sodium alginate hydrogel encapsulation and magnetic induction nanowarming technology. MethodsFirstly, the study investigated the effects of sodium alginate concentration, the sequence of hydrogel encapsulation and CPAs loading on vitrification efficiency of encapsulated ovarian tissue. Additionally, the capability of sodium alginate hydrogel encapsulation to reduce the required concentration of CPAs was validated. Secondly, a platform combining water bath and magnetic induction nanowarming was established to rewarm ovarian tissue under various concentrations of magnetic nanoparticles and magnetic field strengths. The post-warming follicle survival rate, antioxidant capacity, and ovarian tissue integrity were evaluated to assess the efficacy of the method. ResultsThe study found that ovarian tissue encapsulated with 2% sodium alginate hydrogel exhibited the highest follicle survival rate after vitrification. The method of loading CPAs prior to encapsulation proved more suitable for ovarian tissue cryopreservation, effectively reducing the required concentration of CPAs by 50%. A combination of 8 g/L Fe3O4 nanoparticles and an alternating magnetic field of 300 Gs showed optimal warming effectiveness for ovarian tissue. Combining water bath rewarming with magnetic induction nanowarming yielded the highest follicle survival rate, enhanced antioxidant capacity, and preserved tissue morphology. ConclusionSodium alginate hydrogel encapsulation of ovarian tissue reduces the concentration of CPAs required during the freezing process. The combination of magnetic induction nanowarming with water bath provides an efficient method ovarian tissue rewarming. This study offers novel approaches to optimize ovarian tissues vitrification.
8.Impact of Maxing Kugan Decoction on Inflammatory Response and Apoptosis in Oleic Acid-induced Acute Lung Injury in Rats via p38 MAPK/NF-κB Signaling Pathway
Taiqiang JIAO ; Yi NAN ; Ling YUAN ; Jiaqing LI ; Yang NIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(7):108-116
ObjectiveTo investigate the effects of Maxing Kugan decoction (MKD) on inflammatory response and apoptosis in rats with oleic acid (OA)-induced acute lung injury (ALI) and explore its mechanism of action. MethodsSixty Sprague-Dawley (SD) rats were randomly assigned into six groups: a control group, a model group, a dexamethasone-treated group (2 mg·kg-1), and three MKD-treated groups at low, medium, and high doses (3.1, 6.2,12.4 g·kg-1). Each group was administered either an equivalent volume of normal saline or the corresponding concentration of MKD by gavage for seven consecutive days. The model group and each administration group were used to establish the ALI model by tail vein injection of OA (0.2 mL·kg-1). Twelve hours after modeling, blood gas analyses were conducted, and the wet-to-dry (W/D) weight ratio of lung tissue was measured for each group. Additionally, enzyme-linked immunosorbent assay (ELISA) was employed to quantify the levels of tumor necrosis factor-alpha (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) in the bronchoalveolar lavage fluid (BALF) of the rats. Cell damage and apoptosis in lung tissue were examined via hematoxylin-eosin (HE) staining and TdT-mediated dUTP-biotin nick end labeling (TUNEL) assays, and the results were subsequently scored. The expression levels of the p38 mitogen-activated protein kinase (p38 MAPK)/nuclear factor kappa-B (NF-κB) signaling pathway and apoptosis-related proteins and mRNAs were assessed using Western blot and real-time fluorescence quantitative polymerase chain reaction (Real-time PCR). ResultsCompared with the control group, the model group exhibited a significant decrease in partial pressure of oxygen (PaO2), blood oxygen saturation (SaO2), and oxygenation index (PaO2/FiO2), along with a marked increase in partial pressure of carbon dioxide (PaCO2) and lung W/D ratio (P<0.01). Additionally, levels of TNF-α, IL-6, and IL-1β in BALF were significantly elevated (P<0.01). Histopathological analysis of lung tissue showed significant inflammatory infiltration, tissue edema, alveolar septal thickening, and apoptosis of lung tissue. Pronounced increases were observed in the mRNA expression levels of p38 MAPK, NF-κB p65, inhibitor of NF-κB (IκBα), B-cell lymphoma-2 associated x protein (Bax), and Caspases-3, as well as the protein expression levels of p-p38 MAPK, p-NF-κB p65, p-IκBα, Bax, Caspases-3, and cleaved Caspases-3, while the mRNA and protein expression of Bcl-2 was downregulated (P<0.01). Compared with the model group, MKD significantly elevated PaO2, SaO2, and PaO2/FiO2 while reducing PaCO2 and W/D ratio in rats (P<0.01). It also greatly reduced TNF-α, IL-6, and IL-1β levels in BALF (P<0.01) and alleviated inflammatory infiltration, tissue edema, alveolar septal thickening, and apoptosis of lung tissue. Additionally, it downregulated the mRNA expression of p38 MAPK, NF-κB p65, IκBα, Bax, Caspases-3, as well as protein expression of p-p38 MAPK, p-NF-κB p65, p-IκBα, Bax, Caspases-3, and cleaved Caspases-3 in lung tissue (P<0.05, P<0.01), while significantly upregulating mRNA and protein expression of Bcl-2 (P<0.01). ConclusionMKD exerts a protective effect on OA-induced ALI rats, potentially through the regulation of the p38 MAPK/NF-κB signaling pathway to inhibit inflammation and apoptosis.
9.Impact of Maxing Kugan Decoction on Inflammatory Response and Apoptosis in Oleic Acid-induced Acute Lung Injury in Rats via p38 MAPK/NF-κB Signaling Pathway
Taiqiang JIAO ; Yi NAN ; Ling YUAN ; Jiaqing LI ; Yang NIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(7):108-116
ObjectiveTo investigate the effects of Maxing Kugan decoction (MKD) on inflammatory response and apoptosis in rats with oleic acid (OA)-induced acute lung injury (ALI) and explore its mechanism of action. MethodsSixty Sprague-Dawley (SD) rats were randomly assigned into six groups: a control group, a model group, a dexamethasone-treated group (2 mg·kg-1), and three MKD-treated groups at low, medium, and high doses (3.1, 6.2,12.4 g·kg-1). Each group was administered either an equivalent volume of normal saline or the corresponding concentration of MKD by gavage for seven consecutive days. The model group and each administration group were used to establish the ALI model by tail vein injection of OA (0.2 mL·kg-1). Twelve hours after modeling, blood gas analyses were conducted, and the wet-to-dry (W/D) weight ratio of lung tissue was measured for each group. Additionally, enzyme-linked immunosorbent assay (ELISA) was employed to quantify the levels of tumor necrosis factor-alpha (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) in the bronchoalveolar lavage fluid (BALF) of the rats. Cell damage and apoptosis in lung tissue were examined via hematoxylin-eosin (HE) staining and TdT-mediated dUTP-biotin nick end labeling (TUNEL) assays, and the results were subsequently scored. The expression levels of the p38 mitogen-activated protein kinase (p38 MAPK)/nuclear factor kappa-B (NF-κB) signaling pathway and apoptosis-related proteins and mRNAs were assessed using Western blot and real-time fluorescence quantitative polymerase chain reaction (Real-time PCR). ResultsCompared with the control group, the model group exhibited a significant decrease in partial pressure of oxygen (PaO2), blood oxygen saturation (SaO2), and oxygenation index (PaO2/FiO2), along with a marked increase in partial pressure of carbon dioxide (PaCO2) and lung W/D ratio (P<0.01). Additionally, levels of TNF-α, IL-6, and IL-1β in BALF were significantly elevated (P<0.01). Histopathological analysis of lung tissue showed significant inflammatory infiltration, tissue edema, alveolar septal thickening, and apoptosis of lung tissue. Pronounced increases were observed in the mRNA expression levels of p38 MAPK, NF-κB p65, inhibitor of NF-κB (IκBα), B-cell lymphoma-2 associated x protein (Bax), and Caspases-3, as well as the protein expression levels of p-p38 MAPK, p-NF-κB p65, p-IκBα, Bax, Caspases-3, and cleaved Caspases-3, while the mRNA and protein expression of Bcl-2 was downregulated (P<0.01). Compared with the model group, MKD significantly elevated PaO2, SaO2, and PaO2/FiO2 while reducing PaCO2 and W/D ratio in rats (P<0.01). It also greatly reduced TNF-α, IL-6, and IL-1β levels in BALF (P<0.01) and alleviated inflammatory infiltration, tissue edema, alveolar septal thickening, and apoptosis of lung tissue. Additionally, it downregulated the mRNA expression of p38 MAPK, NF-κB p65, IκBα, Bax, Caspases-3, as well as protein expression of p-p38 MAPK, p-NF-κB p65, p-IκBα, Bax, Caspases-3, and cleaved Caspases-3 in lung tissue (P<0.05, P<0.01), while significantly upregulating mRNA and protein expression of Bcl-2 (P<0.01). ConclusionMKD exerts a protective effect on OA-induced ALI rats, potentially through the regulation of the p38 MAPK/NF-κB signaling pathway to inhibit inflammation and apoptosis.
10.Clinical practice guidelines for intraoperative cell salvage in patients with malignant tumors
Changtai ZHU ; Ling LI ; Zhiqiang LI ; Xinjian WAN ; Shiyao CHEN ; Jian PAN ; Yi ZHANG ; Xiang REN ; Kun HAN ; Feng ZOU ; Aiqing WEN ; Ruiming RONG ; Rong XIA ; Baohua QIAN ; Xin MA
Chinese Journal of Blood Transfusion 2025;38(2):149-167
Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.


Result Analysis
Print
Save
E-mail