1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
3.Yimei Baijiang Formula Treats Colitis-associated Colorectal Cancer in Mice via NF-κB Signaling Pathway
Qian WU ; Xin ZOU ; Chaoli JIANG ; Long ZHAO ; Hui CHEN ; Li LI ; Zhi LI ; Jianqin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):119-130
ObjectiveTo explore the effects of Yimei Baijiang formula (YMBJF) on colitis-associated colorectal cancer (CAC) and the nuclear factor kappaB (NF-κB) signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups: Normal, model, capecitabine (0.83 g
4.Development and evaluation of classification system for drug-related problems in China
Shuang ZOU ; Tingting LU ; Lei BAO ; Yun LIAO ; Ling LI ; Ping ZHANG
China Pharmacy 2026;37(3):371-376
OBJECTIVE To establish a Chinese drug-related problem (DRP) classification system applicable to pharmacist-led pharmaceutical care in China, providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system, including literature review and analysis, comparison of existing classification systems, refinement of classification items and framework development, two rounds of standard case validation, expert discussion, and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ, assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem(including potential problems), DRP evaluation, cause (including possible causes of potential problems), intervention, acceptance of intervention and DRP status], with 24 primary codes and 96 secondary codes. In the first round of case validation, κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round, κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system, positive ratings (“strongly agree” or “agree”) exceeded 85% for all items. Specifically, positive ratings for“the classification system can provide appropriate category selection”,“ the classification system is comprehensive”,“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability, providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.
5.Construction and characterization of recombinant human coagulation factor Ⅶ stable transfected cell lines
Xiaoxiao LI ; Jiabin CHEN ; Jiajun LIU ; Zhifei ZHANG ; Sen ZOU ; Lihua ZHU ; Zhaoyong YANG
Acta Universitatis Medicinalis Anhui 2026;61(1):16-22
ObjectiveTo construct a stable monoclonal human embryonic kidney 293 (HEK293) cell line expressing recombinant human coagulation factor Ⅶ (rhFⅦ) and evaluate the expression level and procoagulant bioactivity of rhFⅦ. MethodsThe plasmid pCDNA3.1-EGFP-FⅦ was transfected into HEK293 cells to verify the effectiveness of the transfection system. The plasmid pCDNA3.1-FⅦ was transfected into HEK293 cells, and monoclonal stable transfected cell lines were selected using geneticin (G418). The transcription of the FⅦ gene was identified by reverse transcription polymerase chain reaction (RT-PCR). The expression level of rhFⅦ in the supernatant of the monoclonal stable transfected cell line was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot. The concentration of rhFⅦ was determined by enzyme-linked immunosorbent assay (ELISA), and the procoagulant activity of rhFⅦ was measured by human coagulation factor Ⅶ potency assay. ResultsHEK293 cells transfected with pcDNA3.1-EGFP-FⅦ showed green fluorescence, indicating that rhFⅦ was successfully expressed in the supernatant of HEK293 cells after transient transfection with pcDNA3.1-FⅦ. The monoclonal stable transfected cell line was obtained by G418 screening. RT-PCR identified that the FⅦ gene was integrated into the genome of the monoclonal stable transfected cell line. The cell viability was good as detected by Cell Counting Kit-8, and a single band of rhFⅦ was obtained by purification of the cell supernatant. The highest rhFⅦ expression was (1.27±0.09) mg/L, and the highest procoagulant activity was (380.29±13.80)%. ConclusionThe monoclonal HEK293 cell lines which can express rhFⅦ protein efficiently and stably with excellent procoagulant bioactivity is successfully screened.
6.Zuogui Wan Improve Ovarian Inflammatory Microenvironment and Stemness of Ovarian Germline Stem Cells in Ovarian Aging via cGAS/STING Signaling Pathway
Yunling ZHENG ; Xinyi PAN ; Zuang LI ; Yixuan WANG ; Junyi AN ; Yuxin ZOU ; Mengting XIAO ; Zheng CHEN ; Ling ZHU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(7):1-10
ObjectiveTo investigate the mechanism of Zuogui Wan (ZGW) in improving ovarian inflammatory microenvironment and stemness of ovarian germline stem cells (OSCs) for treating ovarian aging via the cyclic guanosine monophosphate/adenosine monophosphate synthase (cGAS)/stimulator of interferon genes (STING) signaling pathway. MethodsForty C57BL/6 female mice were randomly divided into a blank group, a model group, a low-dose ZGW group (2.7 g·kg-1), a high-dose ZGW group (5.4 g·kg-1), and an estradiol valerate group (0.15 mg·kg-1), with 8 mice in each group. Except the blank group, all other groups received a single intraperitoneal injection of cyclophosphamide at 120 mg·kg-1 to establish an ovarian aging mouse model. After successful modeling, each group was continuously administered for 4 weeks, once daily. The physiological status of the mice was observed, and the ovarian index was calculated. The estrus cycle of the mice was monitored. Hematoxylin-eosin (HE) staining was used to observe pathological changes in ovarian tissue. Enzyme-linked immunosorbent assay (ELISA) was used to detect serum sex hormone levels. Serum inflammatory factors interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), and mouse interleukin-6 (IL-6) levels were detected using kits. Western blot was used to detect the protein expression of ovarian cGAS, STING, p-STING, TANK-binding kinase 1 (TBK1), p-TBK1, interferon-induced transmembrane protein 3 (Fragilis), and Vasa homolog protein (MVH). Quantitative real-time polymerase chain reaction (Real-time PCR) was used to detect the mRNA expression of inflammatory factors in ovarian tissue. Immunofluorescence double labeling was performed to locate OSCs in ovarian tissues, and fluorescence intensities of OSCs markers MVH and octamer binding transcription factor 4 (Oct4) were calculated. ResultsCompared with the blank group, the model group showed reduced body weight, ovarian wet weight, and ovarian index (P<0.01) and a disordered estrus cycle (P<0.01). In addition, the levels of serum follicle-stimulating hormone (FSH), TNF-α, IL-6, and IL-1β were increased (P<0.01), while anti-Müllerian hormone (AMH) and estradiol (E2) levels were decreased (P<0.01). The protein expression of cGAS, p-STING/STING, and p-TBK1/TBK1 in ovarian tissue was increased (P<0.05, P<0.01), while that of OSCs stemness factors MVH and Fragilis was reduced (P<0.01). Immunofluorescence indicated a reduction in MVH and Oct4 expression in OSCs (P<0.01). The mRNA expression of inflammatory factors TNF-α, IL-6, and IL-1β in ovarian tissue was increased (P<0.05, P<0.01). Compared with the model group, the treatment groups exhibited improved body weight, ovarian wet weight, and ovarian index (P<0.05) and a reduced rate of estrus cycle disorder (P<0.05, P<0.01). The levels of serum FSH, TNF-α, IL-6, and IL-1β were decreased (P<0.05, P<0.01), while AMH and E2 levels were increased (P<0.01). The protein expression levels of cGAS, p-STING/STING, and p-TBK1/TBK1 in ovarian tissue were decreased (P<0.05), while the protein expression of MVH and Fragilis was increased (P<0.05), and the fluorescence intensities of MVH and Oct4 were increased (P<0.05, P<0.01). The mRNA expression of inflammatory factors in ovarian tissue was decreased (P<0.05). ConclusionZGW alleviate ovarian inflammatory response, regulate ovarian microenvironment homeostasis, and maintain stemness of OSCs in ovarian aging mice probably by modulating the cGAS-STING signaling pathway, thereby improving ovarian function and delaying ovarian aging.
7.Compilation Instruction for Pharmacovigilance Guidelines for Clinical Application of Traditional Chinese Medicine Injections
Changkuan FU ; Lianxin WANG ; Yihuai ZOU ; Mingquan LI ; Yaming LIN ; Weihong SUN ; Xu WEI ; Ming CHEN ; Yanming XIE ; Yuanyuan LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(8):238-244
The Pharmacovigilance Guidelines for Clinical Application of Traditional Chinese Medicine Injections (hereinafter referred to as the Guidelines) were released by the China Association of Chinese Medicine, with the standard number T/CACM 1563.4—2024. It is the first specialized guideline in China on the approach to pharmacovigilance activities for the clinical application of traditional Chinese medicine injections (TCMIs). The Guidelines were jointly developed by the Institute of Basic Research in Clinical Medicine, China Academy of Chinese Medical Sciences, along with 30 experts in TCM pharmacovigilance, clinical practice (TCM, as well as integrated traditional Chinese and Western medicine),and evidence-based medicine from across the country. This publication filled the gap in standard documents in this field, both domestically and internationally. The Guidelines were formulated according to GB/T1.1—2020 Directives for standardization—Part 1: Rules for the structure and drafting of standardizing documents, the WHO Handbook for Guideline Development,and other methodological norms. Based on international norms,national laws and regulations,and scientific research results in the field of pharmacovigilance, methods adopted included expert interviews,literature research,nominal group technique, and Delphi method. Then, key points for pharmacovigilance for TCM injections were summarized and clarified in the four critical sections of "monitoring","identification","assessment",and "control". The development process of the Guidelines included project initiation, international registration, expert interviews, literature search, and evaluation. Based on the research results of these steps,a draft was formed and revised through multiple rounds of in-group expert discussion and peer evaluations by 56 external experts. After revisions by the working group based on the feedback, the final version was formed. The Guidelines came into effect on January 8,2024,providing suggestions and reference norms for pharmacovigilance in the clinical application of TCMIs. To further promote the application and popularization of the Guidelines and help pharmacovigilance personnel better understand the development process,this study elucidates the background,methodological framework,and key development steps of the Guidelines.
8.Proteome-wide Mendelian randomization analysis of plasma proteins identifies biomarkers for anxiety disorders
Xuelian LI ; Min DENG ; Rongting RAN ; Yuqian HE ; Geman WANG ; Yujie LI ; Zhili ZOU
Sichuan Mental Health 2026;39(1):63-69
BackgroundAnxiety disorder is a common mental disorder, with its prevalence showing a continuous upward trend, significantly affecting the quality of life and social function of patients. Due to the lack of objective and reliable biomarkers in clinical practice, the early identification and treatment of anxiety disorder have been somewhat limited. Plasma proteins have the potential to serve as biomarkers for mental diseases, however, the causal relationship between them and anxiety disorder remains unclear. ObjectiveTo identify the plasma proteins that have a causal relationship with anxiety disorders, and to elucidate the associated biological pathways, in order to provide references for the search for biomarkers of anxiety disorders and the exploration of potential therapeutic targets. MethodsBased on the protein quantitative trait locus (pQTL) data of 4 907 plasma proteins covering 35 559 Icelandic individuals from the deCODE database, and the genome-wide association studies (GWAS) data of 50 486 patients with anxiety disorders and 330 460 healthy controls, the inverse-variance weighted (IVW) method was used as the main analysis method, supplemented by MR-Egger method, weighted median method, simple model method, and weighted model method for bidirectional Mendelian randomization analysis. Enrichment analysis of gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways was conducted for the related proteins. Sensitivity analysis was performed using Cochran's Q test, MR-Egger intercept test, MR-PRESSO test, and leave-one-out analysis to evaluate the robustness of the results. ResultsA total of 10 plasma proteins were identified as significantly associated with anxiety disorders. Among these, SPATA9 (OR=0.856, 95% CI: 0.784–0.934, P<0.01) and PDE5A (OR=0.911, 95% CI: 0.864–0.961, P<0.01) were identified as protective factors, while CRYGD (OR=1.209, 95% CI: 1.095–1.334, P<0.01), BTN3A3 (OR=1.045, 95% CI: 1.018–1.073, P<0.01), SERPINB13 (OR=1.102, 95% CI: 1.040–1.168, P<0.01), ERBB4 (OR=1.283, 95% CI: 1.109–1.484, P<0.01), LSAMP (OR=1.096, 95% CI: 1.037–1.158, P<0.01), ICOSLG (OR=1.283, 95% CI: 1.104–1.490, P<0.01), DNAJB11 (OR=1.172, 95% CI: 1.076–1.277, P<0.01), and TREML1 (OR=1.115, 95% CI: 1.054–1.179, P<0.01) were identified as risk factors. The sensitivity analysis showed that the results were robust, with no heterogeneity (Cochran's Q test P>0.05) or pleiotropy (MR-Egger intercept test P>0.05). Enrichment analysis indicated that these plasma proteins were enriched in biological processes such as T-cell signal transduction, lymphocyte proliferation, cell membrane structure and synaptic function, as well as the intestinal immune network that produces IgA and the ErbB signaling pathway. ConclusionThis study identified 10 plasma proteins associated with anxiety disorders. The functions of these plasma proteins involve multiple biological processes such as neural development and immune regulation.
9.Compilation Instruction for Pharmacovigilance Guidelines for Clinical Application of Traditional Chinese Medicine Injections
Changkuan FU ; Lianxin WANG ; Yihuai ZOU ; Mingquan LI ; Yaming LIN ; Weihong SUN ; Xu WEI ; Ming CHEN ; Yanming XIE ; Yuanyuan LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(8):238-244
The Pharmacovigilance Guidelines for Clinical Application of Traditional Chinese Medicine Injections (hereinafter referred to as the Guidelines) were released by the China Association of Chinese Medicine, with the standard number T/CACM 1563.4—2024. It is the first specialized guideline in China on the approach to pharmacovigilance activities for the clinical application of traditional Chinese medicine injections (TCMIs). The Guidelines were jointly developed by the Institute of Basic Research in Clinical Medicine, China Academy of Chinese Medical Sciences, along with 30 experts in TCM pharmacovigilance, clinical practice (TCM, as well as integrated traditional Chinese and Western medicine),and evidence-based medicine from across the country. This publication filled the gap in standard documents in this field, both domestically and internationally. The Guidelines were formulated according to GB/T1.1—2020 Directives for standardization—Part 1: Rules for the structure and drafting of standardizing documents, the WHO Handbook for Guideline Development,and other methodological norms. Based on international norms,national laws and regulations,and scientific research results in the field of pharmacovigilance, methods adopted included expert interviews,literature research,nominal group technique, and Delphi method. Then, key points for pharmacovigilance for TCM injections were summarized and clarified in the four critical sections of "monitoring","identification","assessment",and "control". The development process of the Guidelines included project initiation, international registration, expert interviews, literature search, and evaluation. Based on the research results of these steps,a draft was formed and revised through multiple rounds of in-group expert discussion and peer evaluations by 56 external experts. After revisions by the working group based on the feedback, the final version was formed. The Guidelines came into effect on January 8,2024,providing suggestions and reference norms for pharmacovigilance in the clinical application of TCMIs. To further promote the application and popularization of the Guidelines and help pharmacovigilance personnel better understand the development process,this study elucidates the background,methodological framework,and key development steps of the Guidelines.
10.Expert Consensus on Clinical Application of Pingxuan Capsules
Yuer HU ; Yanming XIE ; Yaming LIN ; Yuanqi ZHAO ; Yihuai ZOU ; Mingquan LI ; Xiaoming SHEN ; Wei PENG ; Changkuan FU ; Yuanyuan LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(1):201-210
As a patented characteristic medicine of Yi ethnic minority, Pingxuan capsules have the effects of nourishing the liver and kidney, pacifying the liver, and subduing Yang. With the main indications of dizziness, headache, palpitations, tinnitus, insomnia, dreaminess, waist and knee soreness caused by liver-kidney deficiency and liver Yang upward disturbance, Pingxuan capsules are widely used in the treatment of posterior circulation ischemic vertigo, vestibular migraine, benign paroxysmal positional vertigo. However, the current knowledge is limited regarding the efficacy, syndrome differentiation, and safety of this medicine. On the basis of summarizing the experience of clinicians and the existing evidence, this study invites clinical experts of traditional Chinese and Western medicine, pharmaceutical experts, and methodological experts from relevant fields across China to conduct evidence-based evaluation of Pingxuan capsules. The evaluation follows the Specifications for the Development of Clinical Expert Consensus on Chinese Patent Medicines issued by the Standardization Office of the China Association of Chinese Medicine, and reaches 5 recommendations and 16 consensus suggestions. The consensus clarifies the clinical applications, efficacy, dose, course of treatment, combination of medicines, precautions, and contraindications of Pingxuan capsules in the treatment of vertigo and explains the safety of clinical application. This consensus is applicable to clinicians (traditional Chinese medicine, Western medicine, and integrated traditional Chinese and Western medicine) and pharmacists in tertiary hospitals, secondary hospitals, and community-level medical and health institutions across China, providing a reference for the rational use of Pingxuan capsules in the treatment of vertigo. It is hoped that the promotion of this consensus can facilitate the rational use of drugs in clinical practice, reduce the risk of drug use, and give full play to the advantages of Pingxuan capsules in the treatment of vertigo diseases. This consensus has been reviewed and published by the China Association of Chinese Medicine, with the number GS/CACM330-2023.

Result Analysis
Print
Save
E-mail