Stroke is the leading cause of death and disability among adults in China， and its common complications include digestive system abnormalities， cognitive impairment， depression， stroke-associated pneumonia， and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang （XLCQT） is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically， XLCQT is often used to treat stroke and its complications. However， the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally， since the basic research is weak， the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis， medicinal properties， safety evaluation， and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients， resveratrol， kaempferol， luteolin， chrysoeriol， apigenin， （+）-catechin， and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex， including inflammatory response， brain-gut axis， hypothalamic-pituitary-adrenal （HPA） axis， intestinal flora， neurotrophic factors， autophagy， oxidative stress， and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.

ObjectiveTo establish a mouse model of particulate matter 2.5 （PM_2.5）-induced dry eye and investigate whether Chufeng Yisuntang can ameliorate the PM_2.5-induced ocular surface damage by regulating the reactive oxygen species （ROS）/p38 mitogen-activated protein kinase （p38 MAPK） signaling pathway. MethodsSixty 8-week-old male C57BL/6J mice were used. Ten were randomly selected as the control group. The remaining 50 mice received topical instillation of 1 drop （0.1 mL） of 5 g·L^-1 PM_2.5 suspension in both eyes， four times daily. Successfully modeled mice were randomized into four groups （n=10）： Model， p38 MAPK inhibitor， Chufeng Yisuntang， and combination （Chufeng Yisuntang at 7.3 g·kg^-1 + p38 MAPK inhibitor SB203580 at 5 mg·kg^-1）. Chufeng Yisuntang was administered via gavage， and the inhibitor group via intraperitoneal injection. The control and model groups received equal volumes of distilled water by gavage. All treatments lasted for 4 weeks. General conditions were dynamically observed. Tear secretion， tear film break-up time， and corneal fluorescein staining were assessed. After intervention for 4 weeks， hematoxylin and eosin （HE） staining was used to examine the histopathological changes. Enzyme-linked immunosorbent assay （ELISA） was adopted to measure serum levels of ROS， malondialdehyde （MDA）， superoxide dismutase （SOD） 1， and SOD2. Western blot and Real-time PCR were employed to determine the protein and gene levels， respectively， of p38 MAPK， B-cell lymphoma-2 （Bcl-2）， Bcl-2-associated X protein （Bax）， and cysteinyl aspartate-specific proteinase-3 （Caspase-3） in the corneal tissue. ResultsCompared with the control group， the model group exhibited reduced tear secretion volume and tear film breakup time， along with increased corneal fluorescein staining scores （P<0.01）. Compared with the model group， the Chufeng Yisuntang group， p38 MAPK inhibitor group， and combination group demonstrated increased tear secretion volume and tear film breakup time， along with decreased corneal fluorescein staining scores （P<0.01）. HE staining revealed that compared with the control group， the model group exhibited marked increases in corneal epithelial cell layers and epithelial thickness， along with reduced meibomian gland acini and intensely stained， densely packed nuclei around the acini. Compared with the model group， the Chufeng Yisuntang group， p38 MAPK inhibitor group， and combination group showed intact corneal structure， improved cell morphology， and reduced damage severity. ELISA revealed elevated ROS and MDA levels （P<0.01） and decreased SOD1 and SOD2 levels （P<0.01） in the model group compared with the control group. Compared with the model group， Chufeng Yisuntang， p38 MAPK inhibitor， and the combination lowered ROS and MDA levels （P<0.01）， while raising SOD1 and SOD2 levels （P<0.05， P<0.01）. Western blot revealed that compared with the control group， the model group exhibited increased protein levels of p38 MAPK， Bax， and Caspase-3 （P<0.01） and reduced protein level of Bcl-2 （P<0.01）. Compared with the model group， Chufeng Yisuntang， p38 MAPK inhibitor， and the combination down-regulated the protein levels of p38 MAPK， Bax， and Caspase-3 （P<0.01）， while up-regulating the protein level of Bcl-2 （P<0.01）. Compared with the Chufeng Yisuntang group， the combination group exhibited decreased protein levels of p38 MAPK， Bax， and Caspase-3 （P<0.01） and increased protein level of Bcl-2 （P<0.01）. Real-time PCR revealed that compared with the control group， the model group exhibited upregulated mRNA levels of p38 MAPK， Bax， and Caspase-3 （P<0.01）， and downregulated mRNA level of Bcl-2 （P<0.01）. Compared with the model group， Chufeng Yisuntang， p38 MAPK inhibitor， and the combination down-regulated the mRNA levels of p38 MAPK， Bax， and Caspase-3 （P<0.01）， while up-regulating the mRNA level of Bcl-2 （P<0.05， P<0.01）. Compared with the Chufeng Yisuntang group， the combination group exhibited decreased mRNA levels of p38 MAPK， Bax， and Caspase-3 expression （P<0.05， P<0.01） and increased mRNA level of Bcl-2 （P<0.01）. ConclusionChufeng Yisuntang may partially protect against PM_2.5-induced corneal injury by inhibiting the ROS/p38 MAPK pathway， enhancing antioxidant defense， and reducing epithelial apoptosis.

AIM: To evaluate the postoperative clinical efficacy of non-diffractive extended depth of focus intraocular lens(EDOF IOL)in patients with highly myopic cataract(HMC).METHODS:A retrospective analysis was conducted on the clinical data of patients diagnosed with HMC at the hospital from January 2022 to December 2024. Patients were divided into an observation group [undergoing femtosecond laser-assisted cataract surgery(FLACS)combined with non-diffractive EDOF IOL implantation] and a control group(undergoing FLACS combined with aspheric monofocal IOL implantation)according to the type of implanted IOL. Postoperative visual acuity(LogMAR), visual quality, and patient satisfaction were compared between the two groups.RESULTS: A total of 33 patients(47 eyes)were finally included in this study, including 10 patients(17 eyes)in the observation group and 23 patients(30 eyes)in the control group. The observation group had a median age of 59.0(52.8, 63.8)y, with 8 males(13 eyes)and 2 females(4 eyes). The control group had a median age of 56.0(53.5, 60.0)y, with 13 males(17 eyes)and 10 females(13 eyes). At 3 mo postoperatively, the best-corrected distance visual acuity(BCDVA)was 0.10(0.08, 0.12)in the observation group and 0.20(0.10, 0.40)in the control group(P=0.586). However, the best-corrected intermediate visual acuity(BCIVA)[0.10(0.10, 0.10)vs 0.50(0.40, 0.90), P=0.032] and best-corrected near visual acuity(BCNVA)[0.20(0.18, 0.20)vs 0.60(0.45, 1.45), P=0.044] in the observation group were significantly better than those in the control group. The defocus curve showed that the uncorrected visual acuity(UCVA)in the observation group was relatively stable within the range of -2.00 to +1.00 D, which was superior to that in the control group. Postoperative questionnaires showed that the spectacle independence rate(76%)and overall satisfaction(88%)in the observation group were significantly higher than those in the control group(10% and 60%, respectively).CONCLUSION: Non-diffractive EDOF IOL significantly improves intermediate and near visual acuity, reduces spectacle dependence, and maintains distance visual acuity by extending the depth of focus, providing better postoperative visual quality and life satisfaction for HMC patients.

Traditional Chinese medicine （TCM） diagnostics is a discipline that studies the basic theories and fundamental skills of diagnostic methods， disease diagnosis， and differentiation in accordance with the theories of TCM. The artificial intelligence （AI） technology has gained remarkable achievements in the intelligentization of the four diagnostic methods in TCM and the standardization of differentiation and diagnosis. However， it still faces many challenges. The standardization of clinical data collection is difficult， and the data quality is uneven， which affects the usability of the data. The integration of the four diagnostic information is insufficient. Most instruments can only collect data from a single diagnostic method， lacking overall integrity. The scientific nature of the diagnostic model needs to be improved. The existing models lack dynamics and the reasoning logic of TCM differentiation. The accuracy of intelligent methods needs to be improved， and the existing evaluation indicators cannot fully reflect the practical application effect of the model. Furthermore， the relevant laws and regulations are still not perfect， and data security and patient privacy lack guarantees. The cultivation of compound talents is insufficient， and there is a lack of interdisciplinary talents who are proficient in both TCM and AI. On this basis， this paper expounded on the current development status， difficulties， and bottlenecks of AI in TCM diagnosis and then explored the development trend of AI in the field of TCM diagnosis. It proposed solutions such as optimizing the data collection process， constructing multimodal diagnostic models， facilitating multi-disciplinary exchanges and cooperation， improving laws and regulations， and cultivating compound talents. It is hoped that modern， standardized， normalized， and intelligent TCM diagnosis can be further promoted， thereby providing new impetus and methods for the inheritance and innovation of TCM.

The comorbidity rate of gastroesophageal reflux disease （GERD） and sleep disorders is high， and the two form a vicious circle through the “brain-gut axis”， which seriously impacts the patients’ quality of life. Traditional Chinese medicine （TCM）， guided by the core principles of “holistic concept” and “syndrome differentiation and treatment”， features multi-targeted therapeutic effects with minimal side effects， offering diverse intervention options for clinical practice. From the perspective of the “brain-gut axis”， this article reviews the relationship between the comorbidity of GERD and sleep disorders and systematically examines relevant research findings on how TCM regulates the “brain-gut axis” to intervene in this comorbid condition. The study reveals that the “brain-gut axis” may participate in the pathological progress of GERD accompanied by sleep disorders through pathways such as abnormalities in the secretion of brain-gut peptides （including gastrointestinal secretin）， as well as intestinal dysbiosis. By closely focusing on core pathogenic mechanisms such as “disharmony between the liver and stomach” and “insomnia due to stomach disharmony”， various approaches can be employed， including TCM formulas （e.g.， modified Sini powder combined with Zuojin pills）， external TCM therapies （e.g.， back-shu point digital acupressure）， and integrated traditional Chinese and Western medicine treatments （e.g.， modified Chaihu guizhi ganjiang decoction combined with proton pump inhibitors）. These methods can regulate the levels of neurotransmitters， gastrointestinal hormones， inflammatory factors， and the composition of intestinal microbiota associated with the “brain-gut axis”， thereby achieving simultaneous improvement in both GERD and sleep disorders.

OBJECTIVE: To explore the genetic etiology of 46 Chinese pedigrees affected with Hereditary multiple exostoses (HME) and provide genetic counseling and reproductive intervention. METHODS: Whole-exome sequencing and Sanger sequencing were carried out on 87 patients from the 46 pedigrees to analyze the variants of EXT1 and EXT2 genes. Pathogenicity of the variants was assessed based on the guidelines from the American College of Medical Genetics and Genomics and Association for Molecular Pathology (ACMG/AMP). Prenatal diagnosis and preimplantation genetic testing (PGT) were provided for couples with identified pathogenic mutations. This study was approved by the Medical Ethics Committee of the hospital (Ethics No.: LL-SC-SG-2014-010). RESULTS: In total 17 and 22 pathogenic variants were respectively identified in the EXT1 and EXT2 genes, among which 5 EXT1 and 12 EXT2 variants were unreported previously. Three patients with no family history were found to harbor de novo variants of the EXT1 gene. Twenty nine couples had opted for PGT or underwent prenatal diagnosis following natural conception, and 17 healthy babies were born. CONCLUSION This study has clarified the genetic etiology of 45 HME pedigrees and identified 17 novel variants, which has enriched the mutational spectrum of the EXT1 and EXT2 genes. Reproductive intervention through PGT and prenatal diagnosis have prevented the recurrence of HME in these families.
Humans ; Female ; Male ; Pedigree ; Exostoses, Multiple Hereditary/diagnosis* ; N-Acetylglucosaminyltransferases/genetics* ; Adult ; Exostosin 1 ; Asian People/genetics* ; Genetic Testing ; Exostosin 2 ; Mutation ; China ; Prenatal Diagnosis ; Pregnancy ; Genetic Counseling ; Preimplantation Diagnosis ; Exome Sequencing ; East Asian People

ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy （DCM） of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group （186 cases） and non-exposure group （185 cases） according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months， and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events （MACE） in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE， and subgroup analysis was performed. Changes in traditional Chinese medicine （TCM） syndrome score， left ventricular ejection fraction （LVEF）， left ventricular fractional shortening （LVFS）， left ventricular end-diastolic diameter （LVEDD）， and Minnesota Living with Heart Failure Questionnaire （MLHFQ） score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy （before treatment） and 1 year after receiving the therapy （after treatment）. ResultsMACE occurred in 31 cases （16.67%） in the exposure group and 47 cases （25.41%） in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group ［HR=0.559， 95%CI（0.361，0.895）， P=0.014］. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients ［HR=0.623， 95%CI（0.396，0.980）， P=0.041］， and consistent results were observed in different subgroups. Compared with pre-treatment， the exposure group showed decreased TCM syndrome score and MLHFQ score， reduced LVEDD， and increased LVEF and LVFS after treatment （P＜0.05）； in the non-exposure group， TCM syndrome score decreased， LVEF and LVFS increased， and LVEDD reduced after treatment （P＜0.05）. After treatment， the exposure group had higher LVEF and LVFS， smaller LVEDD， and lower TCM syndrome score and MLHFQ score compared with the non-exposure group （P＜0.05）. ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome， meanwhile improving their clinical symptoms， cardiac function， and quality of life.

ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To investigate the depressive state of patients with Parkinson's disease (PD), and to analyze the correlation of depressive state with autonomic dysfunction. Methods A total of 327 patients with PD in the hospital were selected from March 2022 to March 2024. The depressive state was evaluated by Hamilton Depression Scale (HAMD). The autonomic nerve function was assessed using the Scale for Outcomes in PD for Autonomic Symptoms (SCOPA-AUT) and heart rate variability [standard deviation of sinus RR interval (SDNN), standard deviation of average sinus RR interval (SDANN), and percentage of successive NN interval differences above 50 ms (pNN50)]. According to the positive depression (HAMD>20 points), the patients were divided into a depression group and a non-depression group. The clinical data and autonomic nerve function indicators were compared between the two groups. Pearson correlation coefficient analysis was performed to analyze the correlation between depressive state and autonomic dysfunction in PD patients. Results The positive rate of depression in patients with PD was 31.19%. There were 102 patients in the depression group and 225 patients in the non-depression group. The years of education and the proportion of mild Hoehn-Yahr stage (H-Y stage) in the depression group were lower than those in the non-depression group, while the disease course was longer, and the Unified Parkinson's Disease Rating Scale (UPDRS) II score and UPDRS III score were higher than those in the non-depression group (P<0.05). The SCOPA-AUT score in the depression group was higher while the SDNN, SDANN and pNN50 were lower compared to the non-depression group (P<0.05). HAMD score was positively correlated with SCOPA-AUT score (r=0.685), and was negatively correlated with SDNN, SDANN and pNN50 (r=-0.578, -0.685, and -0.439) (P<0.05). Conclusion Depression is a common state among patients with PD, and its level is positively correlated with the severity of autonomic dysfunction in patients.