AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To investigate the prevalence of human T-lymphotropic virus (HTLV) infection among blood donors in Hunan Province from 2022 to 2024. Methods: A total of 1 830 342 blood donors from 14 prefecture-level blood centers in Hunan Province over the past three years were screened for anti-HTLV-Ⅰ/Ⅱ using enzyme-linked immunosorbent assay (ELISA). Initially reactive samples were further tested with Line Immunoassay (LIA )/MP-Western blot and RT-PCR nucleic acid test for confirmation. Blood donors confirmed positive for HTLV were tracked and followed up. Results: From 2022 to 2024, the initial ELISA reactive rate for anti-HTLV-I/II among blood donors in Hunan Province was 1.36 per 10 000 (249/1 830 342). The confirmed positive rate was 0.20 per 10 000 (37/1 830 342), accounting for 14.86% of the initially reactive donors. The follow-up success rate for confirmed HTLV-positive blood donors was only 18.92%, while that for HTLV-indeterminate donors was 54.17%. Conclusion: The confirmed HTLV infection rates in Yueyang, Loudi, Shaoyang, Yiyang, and Zhuzhou cities were higher than the provincial (0.20 per 10 000). Chenzhou, Yongzhou, Zhangjiajie, and Xiangxi were identified as low prevalence areas, with an infection rate of 0. The overall follow-up success rate was low, indicating significant difficulties and bottlenecks in follow-up work. The comprehensive screening for HTLV and follow-up studies in Hunan provide valuable data to further improve blood safety testing strategies and risk warning mechanisms.

Nucleotide-binding oligomerization domain (NOD)-like receptor protein 3 (NLRP3) is a cytosolic pattern recognition receptor that recognizes multiple pathogen-associated molecular patterns and damage-associated molecular patterns. It is a cytoplasmic immune factor that responds to cellular stress signals, and it is usually activated after infection or inflammation, forming an NLRP3 inflammasome to protect the body. Aberrant NLRP3 inflammasome activation is reportedly associated with some inflammatory diseases and metabolic diseases. Recently, there have been mounting indications that NLRP3 inflammasomes play an important role in liver injuries caused by a variety of diseases, specifically hepatic ischemia/reperfusion injury, hepatitis, and liver failure. Herein, we summarize new research pertaining to NLRP3 inflammasomes in hepatic injury, hepatitis, and liver failure. The review addresses the potential mechanisms of action of the NLRP3 inflammasome, and its regulation in these liver diseases.
Humans ; NLR Family, Pyrin Domain-Containing 3 Protein/metabolism* ; Inflammasomes/physiology* ; Animals ; Liver Diseases/metabolism* ; Liver/metabolism* ; Reperfusion Injury/metabolism*

BACKGROUND: Retinal ganglion cell (RGC) death caused by acute ocular hypertension is an important characteristic of acute glaucoma. Receptor-interacting protein kinase 3 (RIPK3) that mediates necroptosis is a potential therapeutic target for RGC death. However, the current understanding of the targeting agents and mechanisms of RIPK3 in the treatment of glaucoma remains limited. Notably, artificial intelligence (AI) technologies have significantly advanced drug discovery. This study aimed to discover RIPK3 inhibitor with AI assistance. METHODS: An acute ocular hypertension model was used to simulate pathological ocular hypertension in vivo . We employed a series of AI methods, including large language and graph neural network models, to identify the target compounds of RIPK3. Subsequently, these target candidates were validated using molecular simulations (molecular docking, absorption, distribution, metabolism, excretion, and toxicity [ADMET] prediction, and molecular dynamics simulations) and biological experiments (Western blotting and fluorescence staining) in vitro and in vivo . RESULTS: AI-driven drug screening techniques have the potential to greatly accelerate drug development. A compound called HG9-91-01, identified using AI methods, exerted neuroprotective effects in acute glaucoma. Our research indicates that all five candidates recommended by AI were able to protect the morphological integrity of RGC cells when exposed to hypoxia and glucose deficiency, and HG9-91-01 showed a higher cell survival rate compared to the other candidates. Furthermore, HG9-91-01 was found to protect the retinal structure and reduce the loss of retinal layers in an acute glaucoma model. It was also observed that the neuroprotective effects of HG9-91-01 were highly correlated with the inhibition of PANoptosis (apoptosis, pyroptosis, and necroptosis). Finally, we found that HG9-91-01 can regulate key proteins related to PANoptosis, indicating that this compound exerts neuroprotective effects in the retina by inhibiting the expression of proteins related to apoptosis, pyroptosis, and necroptosis. CONCLUSION AI-enabled drug discovery revealed that HG9-91-01 could serve as a potential treatment for acute glaucoma.
Animals ; Glaucoma/metabolism* ; Neuroprotective Agents/pharmacology* ; Mice ; Receptor-Interacting Protein Serine-Threonine Kinases/metabolism* ; Artificial Intelligence ; Retinal Ganglion Cells/metabolism* ; Disease Models, Animal ; Molecular Docking Simulation ; Mice, Inbred C57BL ; Male

Objective:To establish a three-dimensional culture and stress-loaded model of human periodontal ligament cells(hP-DLCs)in vitro and to determine the effect of static pressure on autophagy.Methods:Periodontal tissue was scraped from fresh ex-tracted tooth surfaces for culture and hPDLCs were obtained.Type Ⅰ rat tail collagen was extracted to prepare collagen-sodium algi-nate composite hydrogel,in which third-generation hPDLCs were embedded.After 72 h of culture,gene expression of autophagy-related proteins LC3,Atg-5 and Beclin-1 was detected by quantitative real-time polymerase chain reaction(qRT-PCR),and the expression of Atg-5,Beclin-1 and LC3 was detected by Western blotting.Results:Cells grew well in collagen-alginate hydrogels.After 15 min of compressive stress loading,the level of autophagy of hPDLCs increased significantly and then gradually decreased to the baseline level.Conclusion:Collagen-alginate hydrogel has good biocompatibility and safety,and can be used as an excellent scaffold for three-dimensional cell culture in vitro.Static compressive stress can accelevate autophagy,and this acceleration is rapid and short-lived.

Objective To examine the changing prevalence and antimicrobial resistance profiles of Burkholderia cepacia in 52 hospitals across China from 2015 to 2021.Methods A total of 9 261 strains of B.cepacia were collected from 52 hospitals between January 1,2015 and December 31,2021.Antimicrobial susceptibility of the strains was tested using Kirby-Bauer method or automated antimicrobial susceptibility testing systems according to a unified protocol.The results were interpreted according to the breakpoints released in the Clinical & Laboratory Standards Institute(CLSI)guidelines(2023 edition).Results A total of 9 261 strains of B.cepacia were isolated from all age groups,especially elderly patients.The proportion was 11.1％(1 032 strains)in children,significantly lower than the proportion in adults.About half(46.5％,4 310/9 261)of the strains were isolated from patients at least 60 years old and 42.3％(3 919/9 261)of the strains were isolated from young adults.Most isolates(71.1％)were isolated from sputum and respiratory secretions,followed by urine(10.7％)and blood samples(8.1％).B.cepacia isolates were highly susceptible to the five antimicrobial agents recommended in the CLSI M100 document(33rd edition,2023).B.cepacia isolates showed relatively higher resistance rates to meropenem and levofloxacin.However,the resistance rates to ceftazidime,trimethoprim-sulfamethoxazole,and minocycline remained below 8.1％.The percentage of B.cepacia strains resistant to levofloxacin was the highest compared to other antibiotics in any of the three age groups(from 12.4％in the patients＜18 years old to 20.6％in the patients aged 60 years or older).Conclusions B.cepacia is one of the clinically important non-fermenting gram-negative bacteria.Accurate and timely reporting of antimicrobial susceptibility test results and ongoing antimicrobial resistance surveillance are helpful for rational prescription of antimicrobial agents and proper prevention and control of nosocomial infections.

Objective To summarize the changing prevalence of carbapenem resistance in Enterobacterales based on the data of CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021 for improving antimicrobial treatment in clinical practice.Methods Antimicrobial susceptibility testing was performed using a commercial automated susceptibility testing system according to the unified CHINET protocol.The results were interpreted according to the breakpoints of the Clinical & Laboratory Standards Institute(CLSI)M100 31st ed in 2021.Results Over the seven-year period(2015-2021),the overall prevalence of carbapenem-resistant Enterobacterales(CRE)was 9.43％(62 342/661 235).The prevalence of CRE strains in Klebsiella pneumoniae,Citrobacter freundii,and Enterobacter cloacae was 22.38％,9.73％,and 8.47％,respectively.The prevalence of CRE strains in Escherichia coli was 1.99％.A few CRE strains were also identified in Salmonella and Shigella.The CRE strains were mainly isolated from respiratory specimens(44.23±2.80)％,followed by blood(20.88±3.40)％and urine(18.40±3.45)％.Intensive care units(ICUs)were the major source of the CRE strains(27.43±5.20)％.CRE strains were resistant to all the β-lactam antibiotics tested and most non-β-lactam antimicrobial agents.The CRE strains were relatively susceptible to tigecycline and polymyxins with low resistance rates.Conclusions The prevalence of CRE strains was increasing from 2015 to 2021.CRE strains were highly resistant to most of the antibacterial drugs used in clinical practice.Clinicians should prescribe antimicrobial agents rationally.Hospitals should strengthen antibiotic stewardship in key clinical settings such as ICUs,and take effective infection control measures to curb CRE outbreak and epidemic in hospitals.

Objective To characterize the changing species distribution and antibiotic resistance profiles of respiratory isolates in hospitals participating in the CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021.Methods Commercial automated antimicrobial susceptibility testing systems and disk diffusion method were used to test the susceptibility of respiratory bacterial isolates to antimicrobial agents following the standardized technical protocol established by the CHINET program.Results A total of 589 746 respiratory isolates were collected from 2015 to 2021.Overall,82.6％of the isolates were Gram-negative bacteria and 17.4％were Gram-positive bacteria.The bacterial isolates from outpatients and inpatients accounted for(6.0±0.9)％and(94.0±0.1)％,respectively.The top microorganisms were Klebsiella spp.,Acinetobacter spp.,Pseudomonas aeruginosa,Staphylococcus aureus,Haemophilus spp.,Stenotrophomonas maltophilia,Escherichia coli,and Streptococcus pneumoniae.Each microorganism was isolated from significantly more males than from females(P＜0.05).The overall prevalence of methicillin-resistant S.aureus(MRSA)was 39.9％.The prevalence of penicillin-resistant S.pneumoniae was 1.4％.The prevalence of extended-spectrum β-lactamase(ESBL)-producing E.coli and K.pneumoniae was 67.8％and 41.3％,respectively.The overall prevalence of carbapenem-resistant E.coli,K.pneumoniae,Enterobacter cloacae,Pseudomonas aeruginosa,and Acinetobacter baumannii was 3.7％,20.8％,9.4％,29.8％,and 73.3％,respectively.The prevalence of β-lactamase was 96.1％in Moraxella catarrhalis and 60.0％in Haemophilus influenzae.The H.influenzae isolates from children(＜18 years)showed significantly higher resistance rates to β-lactam antibiotics than the isolates from adults(P＜0.05).Conclusions Gram-negative bacteria are still predominant in respiratory isolates associated with serious antibiotic resistance.Antimicrobial resistance surveillance should be strengthened in clinical practice to support accurate etiological diagnosis and appropriate antimicrobial therapy based on antimicrobial susceptibility testing results.

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

Objective To design a precision nutrition information management system to improve clinical nutrition diagnosis and treatment.Methods A precision nutrition information management system was developed with such technologies as Internet,big data and remote diagnosis and treatment,which was composed of a hardware system and a software system.The hardware system consisted of a Web and interface server,a database server,a front-end server,a personal digital assistant,a barcode scanner and a label printer;the software system with B/S architecture encapsulated business functions into reusable and easily expandable modular components based on.NET technology stack,which was made up of three subsystems for outpatient nutrition diagnosis and treatment,inpatient nutrition diagnosis and treatment and nutrition stocking management.Results The system developed realized data sharing and interaction among multi information systems,and contributed to implementing rational,normalized and efficient outpatient nutrition diagnosis and treatment,inpatient nutrition support and nutrition stocking management.Conclusion The system developed meets the requirements for clinical nutrition diagnosis and treatment and enhances clinical nutrition service.[Chinese Medical Equipment Journal,2025,46(10):41-48]