AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To investigate the prevalence of human T-lymphotropic virus (HTLV) infection among blood donors in Hunan Province from 2022 to 2024. Methods: A total of 1 830 342 blood donors from 14 prefecture-level blood centers in Hunan Province over the past three years were screened for anti-HTLV-Ⅰ/Ⅱ using enzyme-linked immunosorbent assay (ELISA). Initially reactive samples were further tested with Line Immunoassay (LIA )/MP-Western blot and RT-PCR nucleic acid test for confirmation. Blood donors confirmed positive for HTLV were tracked and followed up. Results: From 2022 to 2024, the initial ELISA reactive rate for anti-HTLV-I/II among blood donors in Hunan Province was 1.36 per 10 000 (249/1 830 342). The confirmed positive rate was 0.20 per 10 000 (37/1 830 342), accounting for 14.86% of the initially reactive donors. The follow-up success rate for confirmed HTLV-positive blood donors was only 18.92%, while that for HTLV-indeterminate donors was 54.17%. Conclusion: The confirmed HTLV infection rates in Yueyang, Loudi, Shaoyang, Yiyang, and Zhuzhou cities were higher than the provincial (0.20 per 10 000). Chenzhou, Yongzhou, Zhangjiajie, and Xiangxi were identified as low prevalence areas, with an infection rate of 0. The overall follow-up success rate was low, indicating significant difficulties and bottlenecks in follow-up work. The comprehensive screening for HTLV and follow-up studies in Hunan provide valuable data to further improve blood safety testing strategies and risk warning mechanisms.

Nucleotide-binding oligomerization domain (NOD)-like receptor protein 3 (NLRP3) is a cytosolic pattern recognition receptor that recognizes multiple pathogen-associated molecular patterns and damage-associated molecular patterns. It is a cytoplasmic immune factor that responds to cellular stress signals, and it is usually activated after infection or inflammation, forming an NLRP3 inflammasome to protect the body. Aberrant NLRP3 inflammasome activation is reportedly associated with some inflammatory diseases and metabolic diseases. Recently, there have been mounting indications that NLRP3 inflammasomes play an important role in liver injuries caused by a variety of diseases, specifically hepatic ischemia/reperfusion injury, hepatitis, and liver failure. Herein, we summarize new research pertaining to NLRP3 inflammasomes in hepatic injury, hepatitis, and liver failure. The review addresses the potential mechanisms of action of the NLRP3 inflammasome, and its regulation in these liver diseases.
Humans ; NLR Family, Pyrin Domain-Containing 3 Protein/metabolism* ; Inflammasomes/physiology* ; Animals ; Liver Diseases/metabolism* ; Liver/metabolism* ; Reperfusion Injury/metabolism*

BACKGROUND: Retinal ganglion cell (RGC) death caused by acute ocular hypertension is an important characteristic of acute glaucoma. Receptor-interacting protein kinase 3 (RIPK3) that mediates necroptosis is a potential therapeutic target for RGC death. However, the current understanding of the targeting agents and mechanisms of RIPK3 in the treatment of glaucoma remains limited. Notably, artificial intelligence (AI) technologies have significantly advanced drug discovery. This study aimed to discover RIPK3 inhibitor with AI assistance. METHODS: An acute ocular hypertension model was used to simulate pathological ocular hypertension in vivo . We employed a series of AI methods, including large language and graph neural network models, to identify the target compounds of RIPK3. Subsequently, these target candidates were validated using molecular simulations (molecular docking, absorption, distribution, metabolism, excretion, and toxicity [ADMET] prediction, and molecular dynamics simulations) and biological experiments (Western blotting and fluorescence staining) in vitro and in vivo . RESULTS: AI-driven drug screening techniques have the potential to greatly accelerate drug development. A compound called HG9-91-01, identified using AI methods, exerted neuroprotective effects in acute glaucoma. Our research indicates that all five candidates recommended by AI were able to protect the morphological integrity of RGC cells when exposed to hypoxia and glucose deficiency, and HG9-91-01 showed a higher cell survival rate compared to the other candidates. Furthermore, HG9-91-01 was found to protect the retinal structure and reduce the loss of retinal layers in an acute glaucoma model. It was also observed that the neuroprotective effects of HG9-91-01 were highly correlated with the inhibition of PANoptosis (apoptosis, pyroptosis, and necroptosis). Finally, we found that HG9-91-01 can regulate key proteins related to PANoptosis, indicating that this compound exerts neuroprotective effects in the retina by inhibiting the expression of proteins related to apoptosis, pyroptosis, and necroptosis. CONCLUSION AI-enabled drug discovery revealed that HG9-91-01 could serve as a potential treatment for acute glaucoma.
Animals ; Glaucoma/metabolism* ; Neuroprotective Agents/pharmacology* ; Mice ; Receptor-Interacting Protein Serine-Threonine Kinases/metabolism* ; Artificial Intelligence ; Retinal Ganglion Cells/metabolism* ; Disease Models, Animal ; Molecular Docking Simulation ; Mice, Inbred C57BL ; Male

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

Objective To explore the prognostic impact and clinical application value of therapeutic plasma exchange(TPE)intervention timing and liver injury periodization in patients with exertional heat stroke(EHS).Methods Data of 127 EHS patients from the First Medical Center of the General Hospital of the People′s Liberation Army from January 2011 to December 2023 were collected,then divided into the death group and the survival group based on therapeutic outcomes and into 5 stages according to the dynamic changes of ALT,AST,TBIL and DBIL.According to propensity score matching analysis,11 patients in the survival group and 12 patients in the death group were included in the statistical analysis,and 20 of them were treated with TPE.The changes in indicators and clinical outcomes before and after TPE were observed,in order to evaluate the impact of intervention timing on prognosis.Results Among the 23 patients,14 had no liver injury or could progress to the repair phase,resulting in 3 deaths(with the mortality rate of 21.43%),while 9 patients failed to pro-gress to the repair phase,resulting in 9 deaths(with the mortality rate of 100%),with significant differences(P＜0.05).The mortality rate of the first TPE intervention before the third stage of liver injury was 23.08%(3/13),while that of interven-tion after reaching or exceeding the third stage was 85.71%(6/7),and the difference was statistically significant(P＜0.05).Conclusion TPE should be executed actively in EHS patients combined with liver injury before the third phase to lock its pathological and physiological processes,thereby improving prognosis and reducing mortality.

Cutaneous melanoma is a malignant skin cancer with a poor prognosis.However,re-cent advances in immune checkpoint blockade and targeted therapy have significantly improved outcomes in advanced-stage resectable melanoma,which have made neoadjuvant therapy a viable option for melanoma patients.Currently,several relevant clinical trials on neoadjuvant therapy have achieved significant results.This paper reviews the recent advances in neoadjuvant therapy for cutaneous melanoma,focusing on the selection of neoadjuvant therapy,subsequent surgical considerations after neoadjuvant therapy,prognostic indicators,and baseline biomarkers.

Objective To compare the changes of brain voxel-mirrored homotopic connectivity(VMHC)of patients before and after Tai Chi Chuan training based on functional magnetic resonance imaging(fMRI)technology;To discuss the central effect mechanism of Tai Chi Chuan in treating chronic fatigue syndrome(CFS).Methods A total of 25 CFS patients(experiment group)and 27 healthy individuals(control group)were recruited to undergo a 1-month Tai Chi Chuan intervention.All receive one month of Tai Chi Chuan training.Differences in SF-36 scores and VMHC between CFS patients and HCs were compared.Results Before training,the SF-36 scores in the experimental group were significantly lower than those in the control group(P<0.001),and the VMHC in the bilateral inferior occipital gyrus,paracentral lobule,lingual gyrus,insula and superior temporal gyrus brain areas were weakened.After training,the scores of SF-36 in the experimental group significantly increased(P<0.001),and the VMHC in bilateral inferior occipital gyrus,superior temporal gyrus,anterior cuneiform lobe and paracentral lobule were significantly enhanced.The difference in whole brain VMHC was positively correlated with the difference in energy scores in SF-36(r=0.456,P=0.025);some scores of SF-36 in the control group significantly increased(P<0.05),and no significant changes in VMHC were observed in brain regions.Conclusion Tai Chi Chuan can effectively improve the quality of life of patients with CFS.This change may be related to the enhancement of functional connections in brain regions such as inferior occipital gyrus,superior temporal gyrus,precuneus,paracentral lobule,et al.

The testis,as one of the important reproductive organs in men,has two major functions of secreting androgens and producing sperm.Androgen and spermatogenesis are the key factors for the evaluation of the testicular function.The lack of androgen or the decline of spermatogenic function is both a symbolic manifestation and a"product"of testis aging.In order to gain a deeper in-sight into the relationship between testis aging and overall health,this article reviews the relevant literature based on the correlation of androgen deficiency with various systemic diseases and the belief in the impacts of testis aging on the health of the cardiovascular and nervous systems through different channels,the development and progression of metabolic diseases,orthopedic diseases,PCa,kidney disease,peptic ulcer and other diseases.All these suggest that adequate attention should be paid to the studies of male reproductive health and its impact on overall health,so as to provide some new ideas and evidence for clinical diagnosis and treatment of relevant conditions.

Objective To investigate the distribution and antimicrobial resistance profiles of the common pathogens isolated from urine from 2015 to 2021 in the CHINET Antimicrobial Resistance Surveillance Program.Methods The bacterial strains were isolated from urine and identified routinely in 51 hospitals across China in the CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021.Antimicrobial susceptibility was determined by Kirby-Bauer method,automatic microbiological analysis system and E-test according to the unified protocol.Results A total of 261 893 nonduplicate strains were isolated from urine specimen from 2015 to 2021,of which gram-positive bacteria accounted for 23.8％(62 219/261 893),and gram-negative bacteria 76.2％(199 674/261 893).The most common species were E.coli(46.7％),E.faecium(10.4％),K.pneumoniae(9.8％),E.faecalis(8.7％),P.mirabilis(3.5％),P.aeruginosa(3.4％),SS.agalactiae(2.6％),and E.cloacae(2.1％).The strains were more frequently isolated from inpatients versus outpatients and emergency patients,from females versus males,and from adults versus children.The prevalence of ESBLs-producing strains in E.coli,K.pneumoniae and P.mirabilis was 53.2％,52.8％and 37.0％,respectively.The prevalence of carbapenem-resistant strains in E.coli,K.pneumoniae,P.aeruginosa and A.baumannii was 1.7％,18.5％,16.4％,and 40.3％,respectively.Lower than 10％of the E.faecalis isolates were resistant to ampicillin,nitrofurantoin,linezolid,vancomycin,teicoplanin and fosfomycin.More than 90％of the E.faecium isolates were ressitant to ampicillin,levofloxacin and erythromycin.The percentage of strains resistant to vancomycin,linezolid or teicoplanin was＜2％.The E.coli,K.pneumoniae,P.aeruginosa and A.baumannii strains isolated from ICU inpatients showed significantly higher resistance rates than the corresponding strains isolated from outpatients and non-ICU inpatients.Conclusions E.coli,Enterococcus and K.pneumoniae are the most common pathogens in urinary tract infection.The bacterial species and antimicrobial resistance of urinary isolates vary with different populations.More attention should be paid to antimicrobial resistance surveillance and reduce the irrational use of antimicrobial agents.