1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Survey on human T-lymphotropic virus infection among blood donors in Hunan province
Binbin ZOU ; Qing HU ; Ni SUN ; Xiangmei KANG ; Tingting HU ; Fei FAN ; Feixue ZHAO
Chinese Journal of Blood Transfusion 2025;38(8):1077-1082
Objective: To investigate the prevalence of human T-lymphotropic virus (HTLV) infection among blood donors in Hunan Province from 2022 to 2024. Methods: A total of 1 830 342 blood donors from 14 prefecture-level blood centers in Hunan Province over the past three years were screened for anti-HTLV-Ⅰ/Ⅱ using enzyme-linked immunosorbent assay (ELISA). Initially reactive samples were further tested with Line Immunoassay (LIA
)/MP-Western blot and RT-PCR nucleic acid test for confirmation. Blood donors confirmed positive for HTLV were tracked and followed up. Results: From 2022 to 2024, the initial ELISA reactive rate for anti-HTLV-I/II among blood donors in Hunan Province was 1.36 per 10 000 (249/1 830 342). The confirmed positive rate was 0.20 per 10 000 (37/1 830 342), accounting for 14.86% of the initially reactive donors. The follow-up success rate for confirmed HTLV-positive blood donors was only 18.92%, while that for HTLV-indeterminate donors was 54.17%. Conclusion: The confirmed HTLV infection rates in Yueyang, Loudi, Shaoyang, Yiyang, and Zhuzhou cities were higher than the provincial (0.20 per 10 000). Chenzhou, Yongzhou, Zhangjiajie, and Xiangxi were identified as low prevalence areas, with an infection rate of 0. The overall follow-up success rate was low, indicating significant difficulties and bottlenecks in follow-up work. The comprehensive screening for HTLV and follow-up studies in Hunan provide valuable data to further improve blood safety testing strategies and risk warning mechanisms.
3.Mechanism of action of the nucleotide-binding oligomerization domain-like receptor protein 3 inflammasome and its regulation in liver injury.
Yifan LU ; Tianyu WANG ; Bo YU ; Kang XIA ; Jiayu GUO ; Yiting LIU ; Xiaoxiong MA ; Long ZHANG ; Jilin ZOU ; Zhongbao CHEN ; Jiangqiao ZHOU ; Tao QIU
Chinese Medical Journal 2025;138(9):1061-1071
Nucleotide-binding oligomerization domain (NOD)-like receptor protein 3 (NLRP3) is a cytosolic pattern recognition receptor that recognizes multiple pathogen-associated molecular patterns and damage-associated molecular patterns. It is a cytoplasmic immune factor that responds to cellular stress signals, and it is usually activated after infection or inflammation, forming an NLRP3 inflammasome to protect the body. Aberrant NLRP3 inflammasome activation is reportedly associated with some inflammatory diseases and metabolic diseases. Recently, there have been mounting indications that NLRP3 inflammasomes play an important role in liver injuries caused by a variety of diseases, specifically hepatic ischemia/reperfusion injury, hepatitis, and liver failure. Herein, we summarize new research pertaining to NLRP3 inflammasomes in hepatic injury, hepatitis, and liver failure. The review addresses the potential mechanisms of action of the NLRP3 inflammasome, and its regulation in these liver diseases.
Humans
;
NLR Family, Pyrin Domain-Containing 3 Protein/metabolism*
;
Inflammasomes/physiology*
;
Animals
;
Liver Diseases/metabolism*
;
Liver/metabolism*
;
Reperfusion Injury/metabolism*
4.Artificial intelligence-enabled discovery of a RIPK3 inhibitor with neuroprotective effects in an acute glaucoma mouse model.
Xing TU ; Zixing ZOU ; Jiahui LI ; Simiao ZENG ; Zhengchao LUO ; Gen LI ; Yuanxu GAO ; Kang ZHANG
Chinese Medical Journal 2025;138(2):172-184
BACKGROUND:
Retinal ganglion cell (RGC) death caused by acute ocular hypertension is an important characteristic of acute glaucoma. Receptor-interacting protein kinase 3 (RIPK3) that mediates necroptosis is a potential therapeutic target for RGC death. However, the current understanding of the targeting agents and mechanisms of RIPK3 in the treatment of glaucoma remains limited. Notably, artificial intelligence (AI) technologies have significantly advanced drug discovery. This study aimed to discover RIPK3 inhibitor with AI assistance.
METHODS:
An acute ocular hypertension model was used to simulate pathological ocular hypertension in vivo . We employed a series of AI methods, including large language and graph neural network models, to identify the target compounds of RIPK3. Subsequently, these target candidates were validated using molecular simulations (molecular docking, absorption, distribution, metabolism, excretion, and toxicity [ADMET] prediction, and molecular dynamics simulations) and biological experiments (Western blotting and fluorescence staining) in vitro and in vivo .
RESULTS:
AI-driven drug screening techniques have the potential to greatly accelerate drug development. A compound called HG9-91-01, identified using AI methods, exerted neuroprotective effects in acute glaucoma. Our research indicates that all five candidates recommended by AI were able to protect the morphological integrity of RGC cells when exposed to hypoxia and glucose deficiency, and HG9-91-01 showed a higher cell survival rate compared to the other candidates. Furthermore, HG9-91-01 was found to protect the retinal structure and reduce the loss of retinal layers in an acute glaucoma model. It was also observed that the neuroprotective effects of HG9-91-01 were highly correlated with the inhibition of PANoptosis (apoptosis, pyroptosis, and necroptosis). Finally, we found that HG9-91-01 can regulate key proteins related to PANoptosis, indicating that this compound exerts neuroprotective effects in the retina by inhibiting the expression of proteins related to apoptosis, pyroptosis, and necroptosis.
CONCLUSION
AI-enabled drug discovery revealed that HG9-91-01 could serve as a potential treatment for acute glaucoma.
Animals
;
Glaucoma/metabolism*
;
Neuroprotective Agents/pharmacology*
;
Mice
;
Receptor-Interacting Protein Serine-Threonine Kinases/metabolism*
;
Artificial Intelligence
;
Retinal Ganglion Cells/metabolism*
;
Disease Models, Animal
;
Molecular Docking Simulation
;
Mice, Inbred C57BL
;
Male
5.Occupational Hazard Factors and the Trajectory of Fasting Blood Glucose Changes in Chinese Male Steelworkers Based on Environmental Risk Scores: A Prospective Cohort Study.
Ming Xia ZOU ; Wei DU ; Qin KANG ; Yu Hao XIA ; Nuo Yun ZHANG ; Liu FENG ; Fei Yue LI ; Tian Cheng MA ; Ya Jing BAO ; Hong Min FAN
Biomedical and Environmental Sciences 2025;38(6):666-677
OBJECTIVE:
We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers.
METHODS:
The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories.
RESULTS:
FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45).
CONCLUSION
An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans
;
Male
;
Adult
;
Blood Glucose/analysis*
;
China
;
Prospective Studies
;
Occupational Exposure/adverse effects*
;
Risk Factors
;
Middle Aged
;
Steel
;
Fasting/blood*
;
Metal Workers
;
East Asian People
6.Predictive value of platelet parameters and prognostic nutritional index in activity of ulcerative colitis
Han-Li TAO ; Shu WANG ; Kang LIU ; Qin ZOU ; Wei GONG ; Feng LI
Parenteral & Enteral Nutrition 2025;32(4):223-228
Objective:To analyze the predictive value of platelet parameters and prognostic nutritional index(PNI)in activity of ulcerative colitis(UC).Methods:This retrospective study included 158 UC patients from the Department of anorectal medicine of our hospital from January 2020 to June 2022.Mayo total score and Truelove-Witts score were used to evaluate clinical activity.Patients with Mayo score>2 was defined as clinically active UC,and patients with Mayo score≤2 was defined as clinically remission.The histological activity was evaluated by Riley score.Evaluation of endoscopic activity of UC patients by Mayo endoscopic score.Results:Among the 158 patients included in the analysis,111 were in remission phase and the remaining 47 were in clinical active phase.Compared with the remission group,the levels of albumin,lymphocytes,and PNI in the clinically active group reduced significantly(P<0.05),while the levels of CRP,fecal calprotectin,neutrophils,white blood cells,NPR,and NLR increased significantly(P<0.05).Fecal calprotectin,CRP,NPR,NLR were significantly positively correlated with Mayo endoscopic score,Riley score,Truelove Witts score,and Mayo total score(P<0.05),while PNI was significantly negatively correlated with Mayo endoscopic score,Truelove Witts score,and Mayo total score(P<0.05).The ROC curve analysis results showed that fecal calprotectin and NPR had similar performance in predicting clinical activity in UC patients(AUC=0.868,0.850),followed by PNI(AUC=0.770)and NLR(AUC=0.756);Fecal calprotectin had the highest performance in predicting endoscopic activity in UC patients(AUC=0.840),followed by NPR(AUC=0.731),NLR(AUC=0.677),and PNI(AUC=0.671).Conclusions:NPR has demonstrated sufficient diagnostic utility in identifying UC patients with clinical and endoscopic activity,and is comparable in diagnostic performance to the fecal biomarker calprotectin.However,PNI has lower performance as a monitoring tool for UC disease activity.
7.Immediate Effects of Acupuncture at Yanglingquan on Functional Connectivity of Brain Network in Patients with Stroke and Hemiplegia
Chen CHEN ; Kuangshi LI ; Xin YU ; Linlu WU ; Tianzhu CHEN ; Kang WU ; Yuanyuan LI ; Xinyue SHI ; Yihuai ZOU
Chinese Journal of Information on Traditional Chinese Medicine 2024;31(3):149-154
Objective To compare the immediate effects of acupuncture at the true and false acupoints of Yanglingquan on functional connectivity in sensorimotor network(SMN)and dorsal attentional network(DAN)of stroke patients based on functional magnetic resonance imaging(fMRI)technology;To explore the central regulatory mechanism and acupoint specificity of acupuncture in stroke patients with hemiplegia.Methods Totally 20 patients with stroke and hemiplegia were included in the study.fMRI scans of acupuncture at the true and false acupoints of Yanglingquan were performed once every 2 weeks,and motion-related SMN and DAN were extracted by independent component analysis to compare the differences in functional connectivity.Results In SMN,after acupuncture at the Yanglingquan true acupoint,the functional connectivity was enhanced compared with before acupuncture.The enhanced brain areas included the right anterior central gyrus,superior temporal gyrus,inferior frontal gyrus,cuneiform lobe,and anterior cuneiform lobe,as well as the left middle temporal gyrus,occipital gyrus,superior temporal gyrus,parahippocampal gyrus,inferior frontal gyrus,and superior temporal gyrus.After acupuncture at the Yanglingquan false acupoint,the functional connectivity was enhanced compared with before acupuncture.The enhanced brain areas included the right anterior central gyrus,superior frontal gyrus,middle frontal gyrus,and cingulate gyrus,as well as the left medial frontal gyrus,anterior cingulate gyrus,lentiform nucleus,and caudate nucleus.In DAN,after acupuncture at the Yanglingquan true acupoint,the functional connectivity was enhanced compared with before acupuncture.The enhanced brain areas included the right anterior cingulate lobe,superior temporal gyrus,middle temporal gyrus,and occipital gyrus,as well as the left cingulate gyrus,posterior cingulate gyrus,and anterior cingulate lobe.After acupuncture at the Yanglingquan false acupoint,the functional connectivity was enhanced compared with before acupuncture,and the enhanced brain areas included the right anterior cingulate gyrus,left anterior cingulate gyrus,and medial frontal gyrus.Conclusion Acupuncture at Yanglingquan can activate SMN and DAN bilateral related brain regions in patients with hemiplegia,which may promote the recovery of motor function by regulating the initiation and execution of motor activities,and has more acupoint specificity compared with false acupoint.
8.Risk factors and mortality for carbapenem-resistant Acinetobacter baumannii bloodstream infection in elderly patients:a 10-year retrospective study
Ye XUE ; Chao-Shi ZOU ; Tai-Jie LI ; Mei-Xiang QIN ; Chan LIANG ; Kang-Hai LIU ; Dan-Ping QIU
Chinese Journal of Infection Control 2024;23(2):155-161
Objective To assess the risk factors for carbapenem-resistant Acinetobacter baumannii(CRAB)bloodstream infection(BSI)and 28-day short-term mortality in elderly patients,and provide reference for the pre-vention and treatment of CRAB BSI.Methods Clinical data of patients aged ≥60 years and diagnosed with AB BSI in a hospital in Yulin City from January 2013 to December 2022 were retrospectively analyzed,including demogra-phic and microbiological characteristics,as well as clinical outcomes of the patients.Variables which were significant in univariate analysis were selected for multivariate analysis using binary logistic regression model and Cox propor-tional hazards model.Independent risk factors for infection were further determined,and survival analysis was per-formed using Kaplan-Meier curve.Results A total of 150 patients were included in the study,out of which 16 pa-tients(10.7%)had CRAB BSI and 134 had carbapenem-sensitive AB(CSAB)BSI.The 28-day short-term mortali-ty of AB BSI in elderly patients was 15.3%(23/150,95%CI:9.6%-21.1%),and the short-term mortality of CRAB BSI was higher than that of CSAB([56.3%,9/16]vs[10.4%,14/134]).Deep venous catheterization(OR:15.598,95%CI:1.831-132.910)and combined infections of other sites(OR:15.449,95%CI:1.497-159.489)were related to CRAB BSI in elderly patients.The independent risk factors for 28-day mortality in elderly patients with AB BSI were hemodialysis(OR:11.856,95%CI:2.924-48.076),intensive care unit admission(OR:9.387,95%CI:1.941-45.385),and pulmonary infection being suspected source of bacteremia(OR:7.019,95%CI:1.345-36.635).Conclusion The occurrence of CRAB BSI in elderly patients is related to the combined infection of other sites and deep vein catheterization.Hemodialysis,admission to ICU,and pulmonary infection being suspected source of bacteremia are independent risk factors for the prognosis of AB BSI in elderly patients.
9.The theoretical research on Yi He rehabilitation in staging treatment of post-stroke hemiplegia
Tianzhu CHEN ; Tianyan CHEN ; Yong ZHANG ; Kang WU ; He JIN ; Yihuai ZOU
Journal of Beijing University of Traditional Chinese Medicine 2024;47(1):24-29
Yi He Rehabilitation,which is based on traditional Chinese rehabilitation treatments and rehabilitation principles from modern medicine,is effective in staging treatment of post-stroke hemiplegia.This paper systematically discusses the origin and annotation of Yi and He from the perspectives of traditional Chinese medicine and modern medicine.The medicinal connection between Yi and the body and its function is related to unobstructed attunement.Based on the connotation of Yi and He,we believe that the pathogenesis of post-stroke hemiplegia is the comprehensive result of abnormal effects of Yi on the organism at the microscopic level and abnormal effects of He on function at the macroscopic level,featured as tense muscle movement and a pathological process of abnormal motion,including the disturbance of yang qi with body dysfunction,the disorder of spirit with sinews and vessels with diversion,and the variation of brain collateral with physical and mental inconsistency.By inducing relaxation and calmness,Yi He rehabilitation takes effect in staging treatment of post-stroke hemiplegia with characteristic mechanisms.First,by calming ascending yang and relaxing the disordered body in periods of relaxation,it can achieve the maintenance function of the kinematic chain peripherally with passive rehabilitation.Second,by calming the disordered spirit and relaxing the inhibited meridian sinews in spasmodic periods,it can reconstruct the neural plasticity of motor function centrally with assistive rehabilitation.Third,by calming damaged brain collateral and relaxing the impassable zang organs in the recovery period,it can close the central-peripheral-central loop of rehabilitation with active rehabilitation.
10.Impact of therapeutic plasma exchange intervention timing and liver injury periodization on the prognosis of pa-tients with exertional heat stroke
Zongzhong HE ; Min WANG ; Yuan ZHUANG ; Jie LIN ; Leiying ZHANG ; Liyang ZOU ; Lingling LI ; Chunya MA ; Xiaomin LIU ; Xiang QUAN ; Ying JIANG ; Mou ZHOU ; Hongjun KANG ; Yang YU
Chinese Journal of Blood Transfusion 2024;37(7):728-733
Objective To explore the prognostic impact and clinical application value of therapeutic plasma exchange(TPE)intervention timing and liver injury periodization in patients with exertional heat stroke(EHS).Methods Data of 127 EHS patients from the First Medical Center of the General Hospital of the People′s Liberation Army from January 2011 to December 2023 were collected,then divided into the death group and the survival group based on therapeutic outcomes and into 5 stages according to the dynamic changes of ALT,AST,TBIL and DBIL.According to propensity score matching analysis,11 patients in the survival group and 12 patients in the death group were included in the statistical analysis,and 20 of them were treated with TPE.The changes in indicators and clinical outcomes before and after TPE were observed,in order to evaluate the impact of intervention timing on prognosis.Results Among the 23 patients,14 had no liver injury or could progress to the repair phase,resulting in 3 deaths(with the mortality rate of 21.43%),while 9 patients failed to pro-gress to the repair phase,resulting in 9 deaths(with the mortality rate of 100%),with significant differences(P<0.05).The mortality rate of the first TPE intervention before the third stage of liver injury was 23.08%(3/13),while that of interven-tion after reaching or exceeding the third stage was 85.71%(6/7),and the difference was statistically significant(P<0.05).Conclusion TPE should be executed actively in EHS patients combined with liver injury before the third phase to lock its pathological and physiological processes,thereby improving prognosis and reducing mortality.

Result Analysis
Print
Save
E-mail