AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Nucleotide-binding oligomerization domain (NOD)-like receptor protein 3 (NLRP3) is a cytosolic pattern recognition receptor that recognizes multiple pathogen-associated molecular patterns and damage-associated molecular patterns. It is a cytoplasmic immune factor that responds to cellular stress signals, and it is usually activated after infection or inflammation, forming an NLRP3 inflammasome to protect the body. Aberrant NLRP3 inflammasome activation is reportedly associated with some inflammatory diseases and metabolic diseases. Recently, there have been mounting indications that NLRP3 inflammasomes play an important role in liver injuries caused by a variety of diseases, specifically hepatic ischemia/reperfusion injury, hepatitis, and liver failure. Herein, we summarize new research pertaining to NLRP3 inflammasomes in hepatic injury, hepatitis, and liver failure. The review addresses the potential mechanisms of action of the NLRP3 inflammasome, and its regulation in these liver diseases.
Humans ; NLR Family, Pyrin Domain-Containing 3 Protein/metabolism* ; Inflammasomes/physiology* ; Animals ; Liver Diseases/metabolism* ; Liver/metabolism* ; Reperfusion Injury/metabolism*

BACKGROUND: Retinal ganglion cell (RGC) death caused by acute ocular hypertension is an important characteristic of acute glaucoma. Receptor-interacting protein kinase 3 (RIPK3) that mediates necroptosis is a potential therapeutic target for RGC death. However, the current understanding of the targeting agents and mechanisms of RIPK3 in the treatment of glaucoma remains limited. Notably, artificial intelligence (AI) technologies have significantly advanced drug discovery. This study aimed to discover RIPK3 inhibitor with AI assistance. METHODS: An acute ocular hypertension model was used to simulate pathological ocular hypertension in vivo . We employed a series of AI methods, including large language and graph neural network models, to identify the target compounds of RIPK3. Subsequently, these target candidates were validated using molecular simulations (molecular docking, absorption, distribution, metabolism, excretion, and toxicity [ADMET] prediction, and molecular dynamics simulations) and biological experiments (Western blotting and fluorescence staining) in vitro and in vivo . RESULTS: AI-driven drug screening techniques have the potential to greatly accelerate drug development. A compound called HG9-91-01, identified using AI methods, exerted neuroprotective effects in acute glaucoma. Our research indicates that all five candidates recommended by AI were able to protect the morphological integrity of RGC cells when exposed to hypoxia and glucose deficiency, and HG9-91-01 showed a higher cell survival rate compared to the other candidates. Furthermore, HG9-91-01 was found to protect the retinal structure and reduce the loss of retinal layers in an acute glaucoma model. It was also observed that the neuroprotective effects of HG9-91-01 were highly correlated with the inhibition of PANoptosis (apoptosis, pyroptosis, and necroptosis). Finally, we found that HG9-91-01 can regulate key proteins related to PANoptosis, indicating that this compound exerts neuroprotective effects in the retina by inhibiting the expression of proteins related to apoptosis, pyroptosis, and necroptosis. CONCLUSION AI-enabled drug discovery revealed that HG9-91-01 could serve as a potential treatment for acute glaucoma.
Animals ; Glaucoma/metabolism* ; Neuroprotective Agents/pharmacology* ; Mice ; Receptor-Interacting Protein Serine-Threonine Kinases/metabolism* ; Artificial Intelligence ; Retinal Ganglion Cells/metabolism* ; Disease Models, Animal ; Molecular Docking Simulation ; Mice, Inbred C57BL ; Male

Objective: To investigate the prevalence of human T-lymphotropic virus (HTLV) infection among blood donors in Hunan Province from 2022 to 2024. Methods: A total of 1 830 342 blood donors from 14 prefecture-level blood centers in Hunan Province over the past three years were screened for anti-HTLV-Ⅰ/Ⅱ using enzyme-linked immunosorbent assay (ELISA). Initially reactive samples were further tested with Line Immunoassay (LIA )/MP-Western blot and RT-PCR nucleic acid test for confirmation. Blood donors confirmed positive for HTLV were tracked and followed up. Results: From 2022 to 2024, the initial ELISA reactive rate for anti-HTLV-I/II among blood donors in Hunan Province was 1.36 per 10 000 (249/1 830 342). The confirmed positive rate was 0.20 per 10 000 (37/1 830 342), accounting for 14.86% of the initially reactive donors. The follow-up success rate for confirmed HTLV-positive blood donors was only 18.92%, while that for HTLV-indeterminate donors was 54.17%. Conclusion: The confirmed HTLV infection rates in Yueyang, Loudi, Shaoyang, Yiyang, and Zhuzhou cities were higher than the provincial (0.20 per 10 000). Chenzhou, Yongzhou, Zhangjiajie, and Xiangxi were identified as low prevalence areas, with an infection rate of 0. The overall follow-up success rate was low, indicating significant difficulties and bottlenecks in follow-up work. The comprehensive screening for HTLV and follow-up studies in Hunan provide valuable data to further improve blood safety testing strategies and risk warning mechanisms.

Objective To design a precision nutrition information management system to improve clinical nutrition diagnosis and treatment.Methods A precision nutrition information management system was developed with such technologies as Internet,big data and remote diagnosis and treatment,which was composed of a hardware system and a software system.The hardware system consisted of a Web and interface server,a database server,a front-end server,a personal digital assistant,a barcode scanner and a label printer;the software system with B/S architecture encapsulated business functions into reusable and easily expandable modular components based on.NET technology stack,which was made up of three subsystems for outpatient nutrition diagnosis and treatment,inpatient nutrition diagnosis and treatment and nutrition stocking management.Results The system developed realized data sharing and interaction among multi information systems,and contributed to implementing rational,normalized and efficient outpatient nutrition diagnosis and treatment,inpatient nutrition support and nutrition stocking management.Conclusion The system developed meets the requirements for clinical nutrition diagnosis and treatment and enhances clinical nutrition service.[Chinese Medical Equipment Journal,2025,46(10):41-48]

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

Objective To understand the changing composition and antibiotic resistance of bacterial species in the clinical isolates from outpatient and emergency department(hereinafter referred to as outpatients)and inpatient children over time in various hospitals,and to provide laboratory evidence for rational antibiotic use.Methods The data on clinically isolated pathogenic bacteria and antimicrobial susceptibility of isolates from outpatients and inpatient children in the CHINET program from 2015 to 2021 were collected and analyzed.Results A total of 278 471 isolates were isolated from pediatric patients in the CHINET program from 2015 to 2021.About 17.1％of the strains were isolated from outpatients,primarily group A β-hemolytic Streptococcus,Escherichia coli,and Staphylococcus aureus.Most of the strains(82.9％)were isolated from inpatients,mainly SS.aureus,E.coli,and H.influenzae.The prevalence of methicillin-resistant S.aureus(MRSA)in outpatients(24.5％)was lower than that in inpatient children(31.5％).The MRSA isolates from outpatients showed lower resistance rates to the antibiotics tested than the strains isolated from inpatient children.The prevalence of vancomycin-resistant Enterococcus faecalis or E.faecium and penicillin-resistant S.pneumoniae was low in either outpatients or inpatient children.S.pneumoniae,β-hemolytic Streptococcus and S.viridans showed high resistance rates to erythromycin.The prevalence of erythromycin-resistant group A β-hemolytic Streptococcus was higher in outpatients than that in inpatient children.The prevalence of β-lactamase-producing H.influenzae showed an overall upward trend in children,but lower in outpatients(45.1％)than in inpatient children(59.4％).The prevalence of carbapenem-resistant Klebsiella pneumoniae(CRKpn),carbapenem-resistant Pseudomonas aeruginosa(CRPae)and carbapenem-resistant Acinetobacter baumannii(CRAba)was 14％,11.7％,47.8％in outpatients,but 24.2％,20.6％,and 52.8％in inpatient children,respectively.The prevalence of multidrug-resistant E.coli,K.pneumoniae,Proteus mirabilis,P.aeruginosa and A.baumannii strains was lower in outpatients than in inpatient children.The prevalence of fluoroquinolone-resistant E.coli,ESBLs-producing K.pneumoniae,ESBLs-producing P.mirabilis,carbapenem-resistant E.coli(CREco),CRKpn,and CRPae was lower in children in outpatients than in inpatient children,but the prevalence of CRAba in 2021 was higher than in inpatient children.Conclusions The distribution of clinical isolates from children is different between outpatients and inpatients.The prevalence of MRSA,ESBL,and CRO was higher in inpatient children than in outpatients.Antibiotics should be used rationally in clinical practice based on etiological diagnosis and antimicrobial susceptibility test results.Ongoing antimicrobial resistance surveillance and prevention and control of hospital infections are crucial to curbing bacterial resistance.

Objective To investigate the changing antibiotic resistance profiles of E.coli isolated from patients in the 52 hospitals participating in the CHINET program from 2015 to 2021.Methods Antimicrobial susceptibility was tested for clinical isolates of E.coli according to the unified protocol of CHINET program.WHONET 5.6 and SPSS 20.0 software were used for data analysis.Results Atotal of 289 760 nonduplicate clinical strains ofE.coli were isolated from 2015 to 2021,mainly from urine samples(44.7±3.2)％.The proportion of E.coli strains isolated from urine samples was higher in females than in males(59.0％vs 29.5％).The proportion of E.coli strains isolated from respiratory tract and cerebrospinal fluid samples was significantly higher in children than in adults(16.7％vs 7.8％,0.8％vs 0.1％,both P＜0.05).The isolates from internal medicine department accounted for the largest proportion(28.9±2.8)％with an increasing trend over years.Overall,the prevalence of ESBLs-producing E.coli and carbapenem resistant E.coli(CREco)was 55.9％and 1.8％,respectively during the 7-year period.The prevalence of ESBLs-producing E.coli was the highest in tertiary hospitals each year from 2015 to 2021 compared to secondary hospitals.The prevalence of CREco was higher in children's hospitals compared to secondary and tertiary hospitals each year from 2015 to 2021.The prevalence of ESBLs-producing E.coli in tertiary hospitals and children's hospitals and the prevalence of CREco in children's hospitals showed a decreasing trend over the 7-year period.The prevalence of CREco in secondary and tertiary hospitals increased slowly.Antibiotic resistance rates changed slowly from 2015 to 2021.Carbapenem drugs(imipenem,meropenem)were the most active drugs amongβ-lactams against E.coli(resistance rate≤2.1％).The resistance rates of E.coli to β-lactam/β-lactam inhibitor combinations(piperacillin-tazobactam,cefoperazone-sulbactam),aminoglycosides(amikacin),nitrofurantoin and fosfomycin(for urinary isolates only)were all less than 10％.The resistance rate of E.coli strains to antibiotics varied with the level of hospitals and the departments where the strains were isolated,especially for cefazolin and ciprofloxacin,to which the resistance rate of E.coli strains from children in non-ICU departments was significantly lower than that of the strains isolated from other departments(P＜0.05).The E.coli isolates from ICU showed higher resistance rate to most antimicrobial agents tested(excluding tigecycline)than the strains isolated from other departments.The E.coli strains isolated from tertiary hospitals showed higher resistance rates to the antimicrobial agents tested(excluding tigecycline,polymyxin B,cefepime and carbapenems)than the strains from secondary hospitals and children's hospitals.Conclusions E.coli is an important pathogen causing clinical infection.More than half of the clinical isolates produced ESBL.The prevalence of CREco is increasing in secondary and tertiary hospitals over the 7-year period even though the overall prevalence is still low.This is an issue of concern.

Objective:To establish a three-dimensional culture and stress-loaded model of human periodontal ligament cells(hP-DLCs)in vitro and to determine the effect of static pressure on autophagy.Methods:Periodontal tissue was scraped from fresh ex-tracted tooth surfaces for culture and hPDLCs were obtained.Type Ⅰ rat tail collagen was extracted to prepare collagen-sodium algi-nate composite hydrogel,in which third-generation hPDLCs were embedded.After 72 h of culture,gene expression of autophagy-related proteins LC3,Atg-5 and Beclin-1 was detected by quantitative real-time polymerase chain reaction(qRT-PCR),and the expression of Atg-5,Beclin-1 and LC3 was detected by Western blotting.Results:Cells grew well in collagen-alginate hydrogels.After 15 min of compressive stress loading,the level of autophagy of hPDLCs increased significantly and then gradually decreased to the baseline level.Conclusion:Collagen-alginate hydrogel has good biocompatibility and safety,and can be used as an excellent scaffold for three-dimensional cell culture in vitro.Static compressive stress can accelevate autophagy,and this acceleration is rapid and short-lived.

Objective To investigate the distribution and antimicrobial resistance profiles of common pathogens isolated from cerebrospinal fluid(CSF)in CHINET program from 2015 to 2021.Methods The bacterial strains isolated from CSF were identified in accordance with clinical microbiology practice standards.Antimicrobial susceptibility test was conducted using Kirby-Bauer method and automated systems per the unified CHINET protocol.Results A total of 14 014 bacterial strains were isolated from CSF samples from 2015 to 2021,including the strains isolated from inpatients(95.3％)and from outpatient and emergency care patients(4.7％).Overall,19.6％of the isolates were from children and 80.4％were from adults.Gram-positive and Gram-negative bacteria accounted for 68.0％and 32.0％,respectively.Coagulase negative Staphylococcus accounted for 73.0％of the total Gram-positive bacterial isolates.The prevalence of MRSA was 38.2％in children and 45.6％in adults.The prevalence of MRCNS was 67.6％in adults and 69.5％in children.A small number of vancomycin-resistant Enterococcus faecium(2.2％)and linezolid-resistant Enterococcus faecalis(3.1％)were isolated from adult patients.The resistance rates of Escherichia coli and Klebsiella pneumoniae to ceftriaxone were 52.2％and 76.4％in children,70.5％and 63.5％in adults.The prevalence of carbapenem-resistant E.coli and K.pneumoniae(CRKP)was 1.3％and 47.7％in children,6.4％and 47.9％in adults.The prevalence of carbapenem-resistant Acinetobacter baumannii(CRAB)and Pseudomonas aeruginosa(CRPA)was 74.0％and 37.1％in children,81.7％and 39.9％in adults.Conclusions The data derived from antimicrobial resistance surveillance are crucial for clinicians to make evidence-based decisions regarding antibiotic therapy.Attention should be paid to the Gram-negative bacteria,especially CRKP and CRAB in central nervous system(CNS)infections.Ongoing antimicrobial resistance surveillance is helpful for optimizing antibiotic use in CNS infections.