AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To investigate the prevalence of human T-lymphotropic virus (HTLV) infection among blood donors in Hunan Province from 2022 to 2024. Methods: A total of 1 830 342 blood donors from 14 prefecture-level blood centers in Hunan Province over the past three years were screened for anti-HTLV-Ⅰ/Ⅱ using enzyme-linked immunosorbent assay (ELISA). Initially reactive samples were further tested with Line Immunoassay (LIA )/MP-Western blot and RT-PCR nucleic acid test for confirmation. Blood donors confirmed positive for HTLV were tracked and followed up. Results: From 2022 to 2024, the initial ELISA reactive rate for anti-HTLV-I/II among blood donors in Hunan Province was 1.36 per 10 000 (249/1 830 342). The confirmed positive rate was 0.20 per 10 000 (37/1 830 342), accounting for 14.86% of the initially reactive donors. The follow-up success rate for confirmed HTLV-positive blood donors was only 18.92%, while that for HTLV-indeterminate donors was 54.17%. Conclusion: The confirmed HTLV infection rates in Yueyang, Loudi, Shaoyang, Yiyang, and Zhuzhou cities were higher than the provincial (0.20 per 10 000). Chenzhou, Yongzhou, Zhangjiajie, and Xiangxi were identified as low prevalence areas, with an infection rate of 0. The overall follow-up success rate was low, indicating significant difficulties and bottlenecks in follow-up work. The comprehensive screening for HTLV and follow-up studies in Hunan provide valuable data to further improve blood safety testing strategies and risk warning mechanisms.

Objective:To analyze the predictive value of platelet parameters and prognostic nutritional index(PNI)in activity of ulcerative colitis(UC).Methods:This retrospective study included 158 UC patients from the Department of anorectal medicine of our hospital from January 2020 to June 2022.Mayo total score and Truelove-Witts score were used to evaluate clinical activity.Patients with Mayo score>2 was defined as clinically active UC,and patients with Mayo score≤2 was defined as clinically remission.The histological activity was evaluated by Riley score.Evaluation of endoscopic activity of UC patients by Mayo endoscopic score.Results:Among the 158 patients included in the analysis,111 were in remission phase and the remaining 47 were in clinical active phase.Compared with the remission group,the levels of albumin,lymphocytes,and PNI in the clinically active group reduced significantly(P<0.05),while the levels of CRP,fecal calprotectin,neutrophils,white blood cells,NPR,and NLR increased significantly(P<0.05).Fecal calprotectin,CRP,NPR,NLR were significantly positively correlated with Mayo endoscopic score,Riley score,Truelove Witts score,and Mayo total score(P<0.05),while PNI was significantly negatively correlated with Mayo endoscopic score,Truelove Witts score,and Mayo total score(P<0.05).The ROC curve analysis results showed that fecal calprotectin and NPR had similar performance in predicting clinical activity in UC patients(AUC=0.868,0.850),followed by PNI(AUC=0.770)and NLR(AUC=0.756);Fecal calprotectin had the highest performance in predicting endoscopic activity in UC patients(AUC=0.840),followed by NPR(AUC=0.731),NLR(AUC=0.677),and PNI(AUC=0.671).Conclusions:NPR has demonstrated sufficient diagnostic utility in identifying UC patients with clinical and endoscopic activity,and is comparable in diagnostic performance to the fecal biomarker calprotectin.However,PNI has lower performance as a monitoring tool for UC disease activity.

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

Objective To investigate the distribution and antimicrobial resistance profiles of common pathogens isolated from cerebrospinal fluid(CSF)in CHINET program from 2015 to 2021.Methods The bacterial strains isolated from CSF were identified in accordance with clinical microbiology practice standards.Antimicrobial susceptibility test was conducted using Kirby-Bauer method and automated systems per the unified CHINET protocol.Results A total of 14 014 bacterial strains were isolated from CSF samples from 2015 to 2021,including the strains isolated from inpatients(95.3％)and from outpatient and emergency care patients(4.7％).Overall,19.6％of the isolates were from children and 80.4％were from adults.Gram-positive and Gram-negative bacteria accounted for 68.0％and 32.0％,respectively.Coagulase negative Staphylococcus accounted for 73.0％of the total Gram-positive bacterial isolates.The prevalence of MRSA was 38.2％in children and 45.6％in adults.The prevalence of MRCNS was 67.6％in adults and 69.5％in children.A small number of vancomycin-resistant Enterococcus faecium(2.2％)and linezolid-resistant Enterococcus faecalis(3.1％)were isolated from adult patients.The resistance rates of Escherichia coli and Klebsiella pneumoniae to ceftriaxone were 52.2％and 76.4％in children,70.5％and 63.5％in adults.The prevalence of carbapenem-resistant E.coli and K.pneumoniae(CRKP)was 1.3％and 47.7％in children,6.4％and 47.9％in adults.The prevalence of carbapenem-resistant Acinetobacter baumannii(CRAB)and Pseudomonas aeruginosa(CRPA)was 74.0％and 37.1％in children,81.7％and 39.9％in adults.Conclusions The data derived from antimicrobial resistance surveillance are crucial for clinicians to make evidence-based decisions regarding antibiotic therapy.Attention should be paid to the Gram-negative bacteria,especially CRKP and CRAB in central nervous system(CNS)infections.Ongoing antimicrobial resistance surveillance is helpful for optimizing antibiotic use in CNS infections.

Objective To investigate the antimicrobial resistance of clinical isolates from elderly patients(≥65 years)in major medical institutions across China.Methods Bacterial strains were isolated from elderly patients in 52 hospitals participating in the CHINET Antimicrobial Resistance Surveillance Program during the period from 2015 to 2021.Antimicrobial susceptibility test was carried out by disk diffusion method and automated systems according to the same CHINET protocol.The data were interpreted in accordance with the breakpoints recommended by the Clinical and Laboratory Standards Institute(CLSI)in 2021.Results A total of 514 715 nonduplicate clinical isolates were collected from elderly patients in 52 hospitals from January 1,2015 to December 31,2021.The number of isolates accounted for 34.3％of the total number of clinical isolates from all patients.Overall,21.8％of the 514 715 strains were gram-positive bacteria,and 78.2％were gram-negative bacteria.Majority(90.9％)of the strains were isolated from inpatients.About 42.9％of the strains were isolated from respiratory specimens,and 22.9％were isolated from urine.More than half(60.7％)of the strains were isolated from male patients,and 39.3％isolated from females.About 51.1％of the strains were isolated from patients aged 65-＜75 years.The prevalence of methicillin-resistant strains(MRSA)was 38.8％in 32 190 strains of Staphylococcus aureus.No vancomycin-or linezolid-resistant strains were found.The resistance rate of E.faecalis to most antibiotics was significantly lower than that of Enterococcus faecium,but a few vancomycin-resistant strains(0.2％,1.5％)and linezolid-resistant strains(3.4％,0.3％)were found in E.faecalis and E.faecium.The prevalence of penicillin-susceptible S.pneumoniae(PSSP),penicillin-intermediate S.pneumoniae(PISP),and penicillin-resistant S.pneumoniae(PRSP)was 94.3％,4.0％,and 1.7％in nonmeningitis S.pneumoniae isolates.The resistance rates of Klebsiella spp.(Klebsiella pneumoniae 93.2％)to imipenem and meropenem were 20.9％and 22.3％,respectively.Other Enterobacterales species were highly sensitive to carbapenem antibiotics.Only 1.7％-7.8％of other Enterobacterales strains were resistant to carbapenems.The resistance rates of Acinetobacter spp.(Acinetobacter baumannii 90.6％)to imipenem and meropenem were 68.4％and 70.6％respectively,while 28.5％and 24.3％of P.aeruginosa strains were resistant to imipenem and meropenem,respectively.Conclusions The number of clinical isolates from elderly patients is increasing year by year,especially in the 65-＜75 age group.Respiratory tract isolates were more prevalent in male elderly patients,and urinary tract isolates were more prevalent in female elderly patients.Klebsiella isolates were increasingly resistant to multiple antimicrobial agents,especially carbapenems.Antimicrobial resistance surveillance is helpful for accurate empirical antimicrobial therapy in elderly patients.

Objective To summarize the changing prevalence of carbapenem resistance in Enterobacterales based on the data of CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021 for improving antimicrobial treatment in clinical practice.Methods Antimicrobial susceptibility testing was performed using a commercial automated susceptibility testing system according to the unified CHINET protocol.The results were interpreted according to the breakpoints of the Clinical & Laboratory Standards Institute(CLSI)M100 31st ed in 2021.Results Over the seven-year period(2015-2021),the overall prevalence of carbapenem-resistant Enterobacterales(CRE)was 9.43％(62 342/661 235).The prevalence of CRE strains in Klebsiella pneumoniae,Citrobacter freundii,and Enterobacter cloacae was 22.38％,9.73％,and 8.47％,respectively.The prevalence of CRE strains in Escherichia coli was 1.99％.A few CRE strains were also identified in Salmonella and Shigella.The CRE strains were mainly isolated from respiratory specimens(44.23±2.80)％,followed by blood(20.88±3.40)％and urine(18.40±3.45)％.Intensive care units(ICUs)were the major source of the CRE strains(27.43±5.20)％.CRE strains were resistant to all the β-lactam antibiotics tested and most non-β-lactam antimicrobial agents.The CRE strains were relatively susceptible to tigecycline and polymyxins with low resistance rates.Conclusions The prevalence of CRE strains was increasing from 2015 to 2021.CRE strains were highly resistant to most of the antibacterial drugs used in clinical practice.Clinicians should prescribe antimicrobial agents rationally.Hospitals should strengthen antibiotic stewardship in key clinical settings such as ICUs,and take effective infection control measures to curb CRE outbreak and epidemic in hospitals.

Objective To characterize the changing species distribution and antibiotic resistance profiles of respiratory isolates in hospitals participating in the CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021.Methods Commercial automated antimicrobial susceptibility testing systems and disk diffusion method were used to test the susceptibility of respiratory bacterial isolates to antimicrobial agents following the standardized technical protocol established by the CHINET program.Results A total of 589 746 respiratory isolates were collected from 2015 to 2021.Overall,82.6％of the isolates were Gram-negative bacteria and 17.4％were Gram-positive bacteria.The bacterial isolates from outpatients and inpatients accounted for(6.0±0.9)％and(94.0±0.1)％,respectively.The top microorganisms were Klebsiella spp.,Acinetobacter spp.,Pseudomonas aeruginosa,Staphylococcus aureus,Haemophilus spp.,Stenotrophomonas maltophilia,Escherichia coli,and Streptococcus pneumoniae.Each microorganism was isolated from significantly more males than from females(P＜0.05).The overall prevalence of methicillin-resistant S.aureus(MRSA)was 39.9％.The prevalence of penicillin-resistant S.pneumoniae was 1.4％.The prevalence of extended-spectrum β-lactamase(ESBL)-producing E.coli and K.pneumoniae was 67.8％and 41.3％,respectively.The overall prevalence of carbapenem-resistant E.coli,K.pneumoniae,Enterobacter cloacae,Pseudomonas aeruginosa,and Acinetobacter baumannii was 3.7％,20.8％,9.4％,29.8％,and 73.3％,respectively.The prevalence of β-lactamase was 96.1％in Moraxella catarrhalis and 60.0％in Haemophilus influenzae.The H.influenzae isolates from children(＜18 years)showed significantly higher resistance rates to β-lactam antibiotics than the isolates from adults(P＜0.05).Conclusions Gram-negative bacteria are still predominant in respiratory isolates associated with serious antibiotic resistance.Antimicrobial resistance surveillance should be strengthened in clinical practice to support accurate etiological diagnosis and appropriate antimicrobial therapy based on antimicrobial susceptibility testing results.

Objective To design a precision nutrition information management system to improve clinical nutrition diagnosis and treatment.Methods A precision nutrition information management system was developed with such technologies as Internet,big data and remote diagnosis and treatment,which was composed of a hardware system and a software system.The hardware system consisted of a Web and interface server,a database server,a front-end server,a personal digital assistant,a barcode scanner and a label printer;the software system with B/S architecture encapsulated business functions into reusable and easily expandable modular components based on.NET technology stack,which was made up of three subsystems for outpatient nutrition diagnosis and treatment,inpatient nutrition diagnosis and treatment and nutrition stocking management.Results The system developed realized data sharing and interaction among multi information systems,and contributed to implementing rational,normalized and efficient outpatient nutrition diagnosis and treatment,inpatient nutrition support and nutrition stocking management.Conclusion The system developed meets the requirements for clinical nutrition diagnosis and treatment and enhances clinical nutrition service.[Chinese Medical Equipment Journal,2025,46(10):41-48]

Objective To examine the changing prevalence and antimicrobial resistance profiles of Burkholderia cepacia in 52 hospitals across China from 2015 to 2021.Methods A total of 9 261 strains of B.cepacia were collected from 52 hospitals between January 1,2015 and December 31,2021.Antimicrobial susceptibility of the strains was tested using Kirby-Bauer method or automated antimicrobial susceptibility testing systems according to a unified protocol.The results were interpreted according to the breakpoints released in the Clinical & Laboratory Standards Institute(CLSI)guidelines(2023 edition).Results A total of 9 261 strains of B.cepacia were isolated from all age groups,especially elderly patients.The proportion was 11.1％(1 032 strains)in children,significantly lower than the proportion in adults.About half(46.5％,4 310/9 261)of the strains were isolated from patients at least 60 years old and 42.3％(3 919/9 261)of the strains were isolated from young adults.Most isolates(71.1％)were isolated from sputum and respiratory secretions,followed by urine(10.7％)and blood samples(8.1％).B.cepacia isolates were highly susceptible to the five antimicrobial agents recommended in the CLSI M100 document(33rd edition,2023).B.cepacia isolates showed relatively higher resistance rates to meropenem and levofloxacin.However,the resistance rates to ceftazidime,trimethoprim-sulfamethoxazole,and minocycline remained below 8.1％.The percentage of B.cepacia strains resistant to levofloxacin was the highest compared to other antibiotics in any of the three age groups(from 12.4％in the patients＜18 years old to 20.6％in the patients aged 60 years or older).Conclusions B.cepacia is one of the clinically important non-fermenting gram-negative bacteria.Accurate and timely reporting of antimicrobial susceptibility test results and ongoing antimicrobial resistance surveillance are helpful for rational prescription of antimicrobial agents and proper prevention and control of nosocomial infections.