AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To investigate the prevalence of human T-lymphotropic virus (HTLV) infection among blood donors in Hunan Province from 2022 to 2024. Methods: A total of 1 830 342 blood donors from 14 prefecture-level blood centers in Hunan Province over the past three years were screened for anti-HTLV-Ⅰ/Ⅱ using enzyme-linked immunosorbent assay (ELISA). Initially reactive samples were further tested with Line Immunoassay (LIA )/MP-Western blot and RT-PCR nucleic acid test for confirmation. Blood donors confirmed positive for HTLV were tracked and followed up. Results: From 2022 to 2024, the initial ELISA reactive rate for anti-HTLV-I/II among blood donors in Hunan Province was 1.36 per 10 000 (249/1 830 342). The confirmed positive rate was 0.20 per 10 000 (37/1 830 342), accounting for 14.86% of the initially reactive donors. The follow-up success rate for confirmed HTLV-positive blood donors was only 18.92%, while that for HTLV-indeterminate donors was 54.17%. Conclusion: The confirmed HTLV infection rates in Yueyang, Loudi, Shaoyang, Yiyang, and Zhuzhou cities were higher than the provincial (0.20 per 10 000). Chenzhou, Yongzhou, Zhangjiajie, and Xiangxi were identified as low prevalence areas, with an infection rate of 0. The overall follow-up success rate was low, indicating significant difficulties and bottlenecks in follow-up work. The comprehensive screening for HTLV and follow-up studies in Hunan provide valuable data to further improve blood safety testing strategies and risk warning mechanisms.

Objective To analyze the effects of activating transcription factor 3(ATF3)pathway mediated by circSLC8Al on oxidative stress and iron activity of epileptic cells.Methods An epileptic cell model was established using human neuronal-hippocampal cells through Mg2+-free method.The expression levels of circSLC8A1 and ATF3 in healthy control group and model group were detected.Plasmid transfection was used to establish circSLC8A1 knockout group,ATF3 knockout group,circSLC8A1 knockout+ATF3 overexpression group,and ATF3 knockout+circSLC8A1 overexpression group.After 6h transfection,cells were cultured in normal medium for 48h.The cell viability,iron activity,reactive oxygen species(ROS),lactate dehydrogenase(LDH)and glutathione(GSH)of the different intervention groups were detected and compared.Results The expression levels of circSLC8A1,ATF3,ROS,LDH and iron activity in model group were significantly higher than those in healthy control group,while cell activity and GSH expression were significantly lower than those in healthy control group(P＜0.05).Knocking out circSLC8A1 can significantly reduce the expression of circSLC8A1 in epileptic model cells,while knocking out ATF3 can significantly reduce the expression of ATF3 in epileptic model cells(P＜0.05).Knocking out circSLC8A1 or ATF3 will increase the cell viability,decrease the iron activity and relieve the oxidative stress in epileptic model cells.Knocking out circSLC8A1 and overexpressing ATF3 can reverse the above trend,but knocking out ATF3 and overexpressing circSLC8A1 will not lead to the above phenomenon.Conclusion circSLC8A1 can influence the cell activity,oxidative stress and iron activity process of epileptic model cells by mediating ATF3 pathway,which provides some reference for the mechanism of epilepsy and its targeted therapy.

Nucleotide-binding oligomerization domain (NOD)-like receptor protein 3 (NLRP3) is a cytosolic pattern recognition receptor that recognizes multiple pathogen-associated molecular patterns and damage-associated molecular patterns. It is a cytoplasmic immune factor that responds to cellular stress signals, and it is usually activated after infection or inflammation, forming an NLRP3 inflammasome to protect the body. Aberrant NLRP3 inflammasome activation is reportedly associated with some inflammatory diseases and metabolic diseases. Recently, there have been mounting indications that NLRP3 inflammasomes play an important role in liver injuries caused by a variety of diseases, specifically hepatic ischemia/reperfusion injury, hepatitis, and liver failure. Herein, we summarize new research pertaining to NLRP3 inflammasomes in hepatic injury, hepatitis, and liver failure. The review addresses the potential mechanisms of action of the NLRP3 inflammasome, and its regulation in these liver diseases.
Humans ; NLR Family, Pyrin Domain-Containing 3 Protein/metabolism* ; Inflammasomes/physiology* ; Animals ; Liver Diseases/metabolism* ; Liver/metabolism* ; Reperfusion Injury/metabolism*

BACKGROUND: Retinal ganglion cell (RGC) death caused by acute ocular hypertension is an important characteristic of acute glaucoma. Receptor-interacting protein kinase 3 (RIPK3) that mediates necroptosis is a potential therapeutic target for RGC death. However, the current understanding of the targeting agents and mechanisms of RIPK3 in the treatment of glaucoma remains limited. Notably, artificial intelligence (AI) technologies have significantly advanced drug discovery. This study aimed to discover RIPK3 inhibitor with AI assistance. METHODS: An acute ocular hypertension model was used to simulate pathological ocular hypertension in vivo . We employed a series of AI methods, including large language and graph neural network models, to identify the target compounds of RIPK3. Subsequently, these target candidates were validated using molecular simulations (molecular docking, absorption, distribution, metabolism, excretion, and toxicity [ADMET] prediction, and molecular dynamics simulations) and biological experiments (Western blotting and fluorescence staining) in vitro and in vivo . RESULTS: AI-driven drug screening techniques have the potential to greatly accelerate drug development. A compound called HG9-91-01, identified using AI methods, exerted neuroprotective effects in acute glaucoma. Our research indicates that all five candidates recommended by AI were able to protect the morphological integrity of RGC cells when exposed to hypoxia and glucose deficiency, and HG9-91-01 showed a higher cell survival rate compared to the other candidates. Furthermore, HG9-91-01 was found to protect the retinal structure and reduce the loss of retinal layers in an acute glaucoma model. It was also observed that the neuroprotective effects of HG9-91-01 were highly correlated with the inhibition of PANoptosis (apoptosis, pyroptosis, and necroptosis). Finally, we found that HG9-91-01 can regulate key proteins related to PANoptosis, indicating that this compound exerts neuroprotective effects in the retina by inhibiting the expression of proteins related to apoptosis, pyroptosis, and necroptosis. CONCLUSION AI-enabled drug discovery revealed that HG9-91-01 could serve as a potential treatment for acute glaucoma.
Animals ; Glaucoma/metabolism* ; Neuroprotective Agents/pharmacology* ; Mice ; Receptor-Interacting Protein Serine-Threonine Kinases/metabolism* ; Artificial Intelligence ; Retinal Ganglion Cells/metabolism* ; Disease Models, Animal ; Molecular Docking Simulation ; Mice, Inbred C57BL ; Male

Objective:To analyze the predictive value of platelet parameters and prognostic nutritional index(PNI)in activity of ulcerative colitis(UC).Methods:This retrospective study included 158 UC patients from the Department of anorectal medicine of our hospital from January 2020 to June 2022.Mayo total score and Truelove-Witts score were used to evaluate clinical activity.Patients with Mayo score>2 was defined as clinically active UC,and patients with Mayo score≤2 was defined as clinically remission.The histological activity was evaluated by Riley score.Evaluation of endoscopic activity of UC patients by Mayo endoscopic score.Results:Among the 158 patients included in the analysis,111 were in remission phase and the remaining 47 were in clinical active phase.Compared with the remission group,the levels of albumin,lymphocytes,and PNI in the clinically active group reduced significantly(P<0.05),while the levels of CRP,fecal calprotectin,neutrophils,white blood cells,NPR,and NLR increased significantly(P<0.05).Fecal calprotectin,CRP,NPR,NLR were significantly positively correlated with Mayo endoscopic score,Riley score,Truelove Witts score,and Mayo total score(P<0.05),while PNI was significantly negatively correlated with Mayo endoscopic score,Truelove Witts score,and Mayo total score(P<0.05).The ROC curve analysis results showed that fecal calprotectin and NPR had similar performance in predicting clinical activity in UC patients(AUC=0.868,0.850),followed by PNI(AUC=0.770)and NLR(AUC=0.756);Fecal calprotectin had the highest performance in predicting endoscopic activity in UC patients(AUC=0.840),followed by NPR(AUC=0.731),NLR(AUC=0.677),and PNI(AUC=0.671).Conclusions:NPR has demonstrated sufficient diagnostic utility in identifying UC patients with clinical and endoscopic activity,and is comparable in diagnostic performance to the fecal biomarker calprotectin.However,PNI has lower performance as a monitoring tool for UC disease activity.

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Objective To analyze the effects of activating transcription factor 3(ATF3)pathway mediated by circSLC8Al on oxidative stress and iron activity of epileptic cells.Methods An epileptic cell model was established using human neuronal-hippocampal cells through Mg2+-free method.The expression levels of circSLC8A1 and ATF3 in healthy control group and model group were detected.Plasmid transfection was used to establish circSLC8A1 knockout group,ATF3 knockout group,circSLC8A1 knockout+ATF3 overexpression group,and ATF3 knockout+circSLC8A1 overexpression group.After 6h transfection,cells were cultured in normal medium for 48h.The cell viability,iron activity,reactive oxygen species(ROS),lactate dehydrogenase(LDH)and glutathione(GSH)of the different intervention groups were detected and compared.Results The expression levels of circSLC8A1,ATF3,ROS,LDH and iron activity in model group were significantly higher than those in healthy control group,while cell activity and GSH expression were significantly lower than those in healthy control group(P＜0.05).Knocking out circSLC8A1 can significantly reduce the expression of circSLC8A1 in epileptic model cells,while knocking out ATF3 can significantly reduce the expression of ATF3 in epileptic model cells(P＜0.05).Knocking out circSLC8A1 or ATF3 will increase the cell viability,decrease the iron activity and relieve the oxidative stress in epileptic model cells.Knocking out circSLC8A1 and overexpressing ATF3 can reverse the above trend,but knocking out ATF3 and overexpressing circSLC8A1 will not lead to the above phenomenon.Conclusion circSLC8A1 can influence the cell activity,oxidative stress and iron activity process of epileptic model cells by mediating ATF3 pathway,which provides some reference for the mechanism of epilepsy and its targeted therapy.

Objective To examine the changing prevalence and antimicrobial resistance profiles of Burkholderia cepacia in 52 hospitals across China from 2015 to 2021.Methods A total of 9 261 strains of B.cepacia were collected from 52 hospitals between January 1,2015 and December 31,2021.Antimicrobial susceptibility of the strains was tested using Kirby-Bauer method or automated antimicrobial susceptibility testing systems according to a unified protocol.The results were interpreted according to the breakpoints released in the Clinical & Laboratory Standards Institute(CLSI)guidelines(2023 edition).Results A total of 9 261 strains of B.cepacia were isolated from all age groups,especially elderly patients.The proportion was 11.1％(1 032 strains)in children,significantly lower than the proportion in adults.About half(46.5％,4 310/9 261)of the strains were isolated from patients at least 60 years old and 42.3％(3 919/9 261)of the strains were isolated from young adults.Most isolates(71.1％)were isolated from sputum and respiratory secretions,followed by urine(10.7％)and blood samples(8.1％).B.cepacia isolates were highly susceptible to the five antimicrobial agents recommended in the CLSI M100 document(33rd edition,2023).B.cepacia isolates showed relatively higher resistance rates to meropenem and levofloxacin.However,the resistance rates to ceftazidime,trimethoprim-sulfamethoxazole,and minocycline remained below 8.1％.The percentage of B.cepacia strains resistant to levofloxacin was the highest compared to other antibiotics in any of the three age groups(from 12.4％in the patients＜18 years old to 20.6％in the patients aged 60 years or older).Conclusions B.cepacia is one of the clinically important non-fermenting gram-negative bacteria.Accurate and timely reporting of antimicrobial susceptibility test results and ongoing antimicrobial resistance surveillance are helpful for rational prescription of antimicrobial agents and proper prevention and control of nosocomial infections.