AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Cardiovascular diseases （CVD），a group of common diseases in clinical practice，are witnessing a steady rise in both incidence and mortality rates，posing a challenge to public health. Gualou Xiebai Banxiatang，originating from Synopsis of the Golden Chamber （《金匮要略》），was initially used to treat severe cases of chest impediment. The formula consists of Trichosanthis Fructus，Allii Macrostemonis Bulbus，Pinelliae Rhizoma，and Baijiu. It has a wide range of clinical applications，with therapeutic effects including moving Qi to relieve depression，activating Yang to dissipate mass，and expelling phlegm to alleviate chest congestion. In recent years，clinical research has confirmed that Gualou Xiebai Banxiatang，with or without modification，used alone or in combination with Western medicine，has definite effects in the treatment of CVD such as hyperlipidemia，coronary atherosclerotic heart disease，hypertension，heart failure，and arrhythmia. It can alleviate disease symptoms and reduce the risk of re-hospitalization. Basic research indicates that the mechanisms of Gualou Xiebai Banxiatang include improving endothelial functions，exhibiting anti-inflammatory properties，countering oxidative stress，preventing apoptosis，inhibiting ventricular remodeling，regulating mitochondrial functions，improving hemorheology，and modulating autophagy and neurotransmitters. This article reviews relevant articles in recent years with focuses on the compatibility，clinical application，and mechanism of Gualou Xiebai Banxiatang. This review is expected to provide a theoretical basis for the mechanism research and clinical application of this formula in treating CVD and to offer ideas and reference for in-depth research.

ObjectiveTo investigate the effect of Naoqingtong decoction （NQT） on the kidney damage and the inflammatory factors NOD-like receptor protein 3 （NLRP3）， apoptosis-associated speck-like protein containing a C-terminal caspase recruitment domain （ASC）， cysteinyl aspartate-specific proteinase-1 （Caspase-1）， interleukin-6 （IL-6）， and tumor necrosis factor-α （TNF-α） in spontaneously hypertensive rats （SHRs）. MethodsTwenty-four SHRs were randomized into a model group， a low-dose （12.9 g·kg^-1·d^-1） NQT （NQT-L） group， a high-dose （25.8 g·kg^-1·d^-1） NQT group （NQT-H）， and a captopril （CTP， 20 mg·kg^-1·d^-1） group， with 6 rats in each group. In addition， 6 homozygous male Wistar-Kyoto rats were used as the control group. The control and model groups were administrated with the same amount of normal saline by gavage for 8 weeks. General behaviors of rats were observed during the intervention period， and the blood pressure was measured periodically. At the end of intervention， the body mass was weighed， and both kidneys were collected and weighed for the calculation of the renal index. Hematoxylin-eosin staining was performed to observe the pathological changes in the kidney tissue. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） and Western blot were employed to determine the expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue. ResultsDuring the experiment period， the control group had normal mental status， food intake， and activity， while the model group showed thinning of hair， loss of luster， reduced activity， loss of appetite， fecal adhesion， and irritability， and some of the skin had scratches or blood scabs. The above symptoms were alleviated to different degrees after 8 weeks of NQT administration. An intelligent non-invasive sphygmomanometer was used to measure the tail artery pressure of rats， which showed that the systolic and diastolic blood pressure of rats in the model group was higher than that in the control group （P<0.01）. Compared with the model group， drug interventions lowered the systolic and diastolic blood pressure （P<0.05， P<0.01）. Compared with the control group， the model group showed severe pathological damage in the kidney tissue， which was alleviated in each drug intervention group. Compared with the control group， the model group showed up-regulated expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue （P<0.05， P<0.01）. Compared with the model group， the drug intervention groups showed down-regulated expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue （P<0.05， P<0.01）. ConclusionNQT can lower the blood pressure in SHRs by inhibiting the activation of NLRP3 inflammasomes， suppressing renal inflammation， and ameliorating hypertensive kidney damage.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

Objective To analyze the medication law and compatibility characteristics of TCM compounds for the treatment of myocardial infarction in the national patent database.Methods TCM compounds for treating myocardial infarction were retrieved from CNIPA patent publication website.A prescription database was built using Excel 2019 software to statistically analyze the frequency of medicinal use and their properties,taste and meridian tropism;SPSS Modeler 18.0 software was used to analyze the association rules of drugs;a network of Chinese materia medica co-occurrence was constructed using Cytoscape 3.10.0,and systematic clustering analysis was performed on the Chinese materia medica in the core network.Results A total of 146 patents of TCM compounds were included,involved 440 kinds of Chinese materia medica.High frequency drugs included Salviea Miltiorrhizae Radix et Rhizoma,Chuanxiong Rhizoma,Angelicae Sinensis Radix,Glycyrrhizae Radix et Rhizoma,etc.The main property was warm,the main tastes were bitter,sweet and pungent,and the medicines mostly belongs to the liver meridian,heart meridian and spleen meridians.Commonly used medicinal pairs included Angelicae Sinensis Radix-Chuanxiong Rhizoma,Astragali Radix-Salviea Miltiorrhizae Radix et Rhizoma,Paeoniae Radix Rubra-Angelicae Sinensis Radix,etc.Commonly used tripartite combinations included Paeoniae Radix Rubra-Chuanxiong Rhizoma-Angelicae Sinensis Radix,Carthami Flos-Angelicae Sinensis Radix-Chuanxiong Rhizoma,Carthami Flos-Chuanxiong Rhizoma-Angelicae Sinensis Radix,etc.Clustering analysis showed four types of combinations.Conclusion TCM compound patents for the treatment of myocardial infarction is based on promoting blood circulation,removing blood stasis,and relieving pain,while also using methods such as eliminating phlegm,tonifying qi,warming yang,and nourishing yin.It can provide references for clinical medication.

BACKGROUND:Neuroinflammation is a major cause of exacerbation after spinal cord injury.In recent years,pyroptosis has received much attention due to its remarkable pro-inflammatory features.Some of these natural products can significantly inhibit the inflammatory response and improve the damaged nerve function by regulating the level of pyroptosis after spinal cord injury,which provides a new therapeutic idea for spinal cord injury.OBJECTIVE:To summarize the mechanism of action of natural products in regulating pyroptosis for the treatment of spinal cord injury,with a view to providing lessons and references for future research on the treatment of spinal cord injury.METHODS:The search terms"spinal cord injury,pyroptosis,inflammasome,natural products,natural compounds,traditional Chinese medicine"in Chinese and English were used to search for relevant literature since the establishment of the database up to September 2024 in the databases of PubMed,Web of Science,WanFang,and CNKI.According to the inclusion and exclusion criteria,75 relevant articles were finally obtained.RESULTS AND CONCLUSION:(1)Pyroptosis is an important pro-inflammatory pathway in spinal cord injury,and controlling pyroptosis is an effective way to improve damaged nerve function.(2)Some natural products can regulate pyroptosis via the NLRP3/Caspase-1 classical pyroptosis pathway,the NF-κB-related pathway,other upstream pathways such as Nrf2/HO-1,and autophagy,thereby affecting the level of tissue inflammation and accelerating neurological recovery after spinal cord injury.(3)The anti-pyroptosis effects of these natural products are mostly dependent on the NLRP3 classical pyroptosis pathway,and there is a lack of studies on other pyroptosis pathways.(4)There are still many problems in this field,such as the fact that these natural products are not currently supported by evidence from appropriate clinical studies.(5)The natural product has great potential in regulating pyroptosis and is expected to be a powerful weapon in the treatment of spinal cord injury.

Objective To investigate the effect of ultra-low dose of dimethyl sulfoxide(DMSO)on the proliferation of skin fibroblasts and to explore its underlying molecular mechanism.Methods MTT assay was used to determine the effect of different concentrations of DMSO on the proliferation of skin fibroblasts.Pull-down assay with 7-methylguanosine triphosphate(7mGTP)and Western blotting was employed to detect the changes in eukaryotic initiation factor 4E(eIF4E)and its binding protein,4E-BP1,and eukaryotic translation initiation factor 4G(eIF4G).After intervention with mTOR inhibitor,rapamycin,the alterations in the expression and phosphorylation levels of proteins within the PI3K/Akt/mTOR signaling pathway were examined with Western blotting.Results Treatment with 11.0 nmol/L DMSO significantly increased both the cell proliferation rate(P<0.05)and the activity of the cap-dependent translation initiation luciferase reporter gene(P<0.05).Results from 7mGTP pull-down assay and Western blotting demonstrated that 11.0 nmol/L DMSO notably inhibited the binding of 4E-BP1 to eIF4E(P<0.05)while promoting the binding of eIF4G to eIF4E(P<0.05).Compared with the control group,the phosphorylation levels of p-Akt(S473),p-mTOR(S2448),p-4E-BP1(T37/46),and p-p70S6K(T421/424)were upregulated(P<0.05);the total protein expressions of Akt,mTOR,p70S6K,S6,eIF4E,and 4E-BP1 were increased to varying degrees(P<0.05).In the RAPA intervention group,the phosphorylation levels of p-Akt(S473),p-mTOR(S2448),p-p70S6K(T421/424),and p-S6(S235/236)were significantly lower than those in the control group(P<0.05).When comparing the RA+DMSO group with the RA group,the phosphorylation levels of all aforementioned proteins were significantly upregulated except for p-eIF4E(S209)(P<0.05).For protein expression analysis:relative to the control group,the DMSO group exhibited increased expressions of Akt,p70S6K,and mTOR(P<0.05)except for 4E-BP1;the RAPA group showed significant downregulation in all these proteins(P<0.05);compared with the RA group,the RA+DMSO group displayed significantly higher expressions of all these proteins except for p70S6K(P<0.05).Conclusion Ultra-low dose of DMSO(11.0 nmol/L)promotes the proliferation of mouse skin fibroblasts by mediating the PI3K/Akt/mTOR signaling pathway,thereby potentially accelerating wound healing.

Objective To explore the acceptability of routine biochemical test results for serum samples with varying degrees of chylous high triglyceride(TG).Methods Blood samples of 69 patients with different degrees of lipids were collected,including 33 patients with mild to moderate lipids(1.7 mmol/L≤TG<5.6 mmol/L)and 36 patients with severe lipids(TG≥5.6 mmol/L).Twenty-nine biochemical tests were detected before and after high-speed centrifugation.The result acceptability before high speed centrifugation of serum was compared with the results after high speed centrifugation as the gold standard[TG and total cholesterol(TC)before centrifugation].The acceptable criteria were subject to the following three conditions at the same time.Firstly,correlation coefficient(R2)was greater than or equal to 0.95.Secondly,the slope of linear re-gression equation was 1.00±0.05.Thirdly,for the same index,the number of samples whose result bias be-fore and after centrifugation was less than 1/2 total allowable error(TEa)in more than 90%of the total sam-ple numbers.Results Firstly,in the mild to moderate lipemia group,22 tests met the criteria,7 tests did not,including total protein(TP),albumin(ALB),TG,aspartate aminotransferase(AST),carbon dioxide(CO2),α-L-fucosidase(AFU),lactate dehydrogenase(LDH)(bias<10%),and the coincidence rate was 75.9%.In the severe lipemia group,12 tests met the criteria,17 tests did not,including pre-albumin(PA),AFU,γ-glu-tamyltransferase(γ-GT),LDH,AST,TC,direct bilirubin(DBIL),CO2,5'-nucleotidase(5'-NT),small and low-density lipoprotein cholesterol(sd-LDL-C),high density lipoprotein cholesterol(HDL-C),low-density lipoprotein cholesterol(LDL-C),adenosine deaminase(ADA),cystatin C(CysC),glycosylated albumin(GA),total bilirubin(TBIL)(bias>10%),the coincidence rate was 41.4%,and there was a statistically sig-nificant difference in the coincidence rate between the two groups(P<0.05).Secondly,there was no statisti-cally significant difference in the acceptability of results between continuous monitoring method and endpoint method detection methods(P>0.05).Conclusion Most test results of direct determination with mild or moderate lipemia samples are acceptable,and the bias of unacceptable tests is small(<10%),so it is recom-mended to issue a test report without further sample treatment.However,due to the large number of unacceptable tests and larger bias(>10%),severe lipemia samples should be determined after high-speed centrifugation.

Objective:To explore the application value of three-dimensional visualization reconstruction technology in robot-assisted laparoscopic partial nephrectomy（RAPN）for the treatment of highly complex（R.E.N.A.L. score≥10）renal hilar tumors.Methods:The clinical data of 87 patients with highly complex renal hilar tumors with R.E.N.A.L. scores ≥10 who were treated in First Affiliated Hospital of Nanchang University from January 2021 to December 2024 were retrospectively analyzed，of which 36 underwent 3D visualization reconstruction and 51 underwent conventional CT. The 3D visualization reconstruction method was to import the patient’s enhanced CT images in DICOM format into the 3D reconstruction image data processing software to produce a 3D visualization model. There were 22 males and 14 females in the 3D visualization group，with an average age of（54.2 ± 9.5）years，a body mass index of（24.8 ± 4.5）kg/m 2，and a tumor size of（4.3 ± 1.0）cm. Tumors were located on the left side in 16 cases and on the right side in 20 cases. Tumor stages were classified as T 1a in 11 cases，T 1b in 21 cases，and T 2a in 4 cases. The R.E.N.A.L. scores were distributed as follows：10 points in 21 cases，11 points in 12 cases，and 12 points in 3 cases. The estimated glomerular filtration rate（eGFR）before operation was（78.2±9.6）ml/（min·1.73 m 2）. There were 35 males and 16 females in the conventional CT group，with an average age of（51.3±8.9）years，a body mass index of（25.4 ± 3.9）kg/m 2，and a tumor size of（4.1 ± 1.2）cm. Tumors were located on the left side in 25 cases and on the right side in 26 cases. Tumor stages were classified as T 1a in 12 cases，T 1b in 33 cases，and T 2a in 6 cases. The R.E.N.A.L. scores were distributed as follows：10 points in 31 cases，11 points in 18 cases，and 12 points in 2 cases . The preoperative eGFR was（80.6 ± 8.8）ml/（min·1.73 m 2）. There was no statistical difference in general data and preoperative renal function between the two groups（ P > 0.05）. Both groups underwent RAPN. The two groups were analyzed and compared in terms of operation time，warm ischemia time，intraoperative blood loss，postoperative hospital stay，postoperative complications，and changes in renal function 3 months after surgery. Results:There were no cases of conversion to radical treatment or open surgery in both the 3D visualization group and the conventional CT group. The 3D visualization group had shorter operation time［（94.6 ± 18.5）min vs.（110.2 ± 17.2）min， P < 0.001］，shorter renal artery occlusion time［（23.3 ± 4.0）min vs.（27.2 ± 3.3）min， P < 0.001］，less intraoperative blood loss［120（100，250）ml vs. 150（120，300）ml， P = 0.018］，and a lower proportion of intraoperative collecting system incision（19/36 vs. 38/51， P = 0.042）than the conventional CT group. There was no significant statistical difference in the time of postoperative drainage tube removal and postoperative hospital stay between the two groups（ P > 0.05）. One case in the 3D visualization group had postoperative fever，and two cases in the conventional CT group had postoperative obvious macroscopic hematuria. Postoperative pathological diagnosis of the patients was clear cell carcinoma in 78 cases，papillary cell carcinoma in 6 cases，chromophobe cell carcinoma in 2 cases，and oncocytoma in 1 case. No positive resection margin was found in both groups. Three months after surgery，there was no significant statistical difference in eGFR between the two groups［（70.6 ± 8.5）ml/（min·1.73 m 2）vs.（71.4 ± 9.2）ml/（min·1.73 m 2）， P = 0.681］. During the median follow-up of 17.8 months，no tumor recurrence or metastasis was observed in either group. Conclusions:RAPN has good safety and feasibility in the treatment of highly complex（R.E.N.A.L. score ≥10）renal hilar tumors. Preoperative three-dimensional visualization reconstruction technology helps to reduce RAPN operation time，renal artery occlusion time and intraoperative blood loss，and has good clinical application value.