AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Introduction: Capivasertib is a selective oral AKT inhibitor approved for hormone receptor-positive, HER2-negative advanced breast cancer with AKT pathway mutations. As AKT is integral to insulin signaling, its inhibition predisposes patients to hyperglycemia. We report a case of severe capivasertib-induced hyperglycemia with profound insulin resistance in a non-diabetic patient. Case: A 56-year-old female with metastatic breast cancer (ER/ PR-positive, HER2-negative, AKT1- and ESR1-mutated, TMB-high) presented with severe hyperglycemia following capivasertib initiation. She had no prior diabetes history, with a baseline hemoglobin A1c of 5.6%. Her first cycle (200 mg twice daily, 7 April 2025) was uncomplicated metabolically. The second cycle was escalated to 400 mg twice daily on 21 April 2025. By Day 3, blood glucose rose significantly. Premixed insulin 20 units failed to achieve glycemic control, necessitating intravenous insulin infusion. Despite escalation to 30 units per hour, euglycemia could not be achieved. Notably, there was no biochemical evidence of diabetic ketoacidosis or hyperosmolar hyperglycemic state, and the patient remained hemodynamically stable. No corticosteroids or other contributing medications were administered. Blood glucose normalized spontaneously approximately 36 hours after the last capivasertib dose, and all insulin was weaned and discontinued by 26 April 2025. She remained euglycemic without antidiabetic therapy thereafter. The patient and family opted for palliative care, and she passed away on 6 May 2025. Conclusion Capivasertib can precipitate severe, insulin-resistant hyperglycemia even in non-diabetic patients, without progression to overt hyperglycemic crisis. Spontaneous resolution upon drug cessation supports a direct drugmediated mechanism via AKT-disrupted insulin signaling. Clinicians should monitor glucose closely during therapy and consider drug cessation in refractory cases. Further studies are warranted to guide optimal glycemic management.
capivasertib ; Hyperglycemia ; Insulins

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Cardiovascular diseases （CVD），a group of common diseases in clinical practice，are witnessing a steady rise in both incidence and mortality rates，posing a challenge to public health. Gualou Xiebai Banxiatang，originating from Synopsis of the Golden Chamber （《金匮要略》），was initially used to treat severe cases of chest impediment. The formula consists of Trichosanthis Fructus，Allii Macrostemonis Bulbus，Pinelliae Rhizoma，and Baijiu. It has a wide range of clinical applications，with therapeutic effects including moving Qi to relieve depression，activating Yang to dissipate mass，and expelling phlegm to alleviate chest congestion. In recent years，clinical research has confirmed that Gualou Xiebai Banxiatang，with or without modification，used alone or in combination with Western medicine，has definite effects in the treatment of CVD such as hyperlipidemia，coronary atherosclerotic heart disease，hypertension，heart failure，and arrhythmia. It can alleviate disease symptoms and reduce the risk of re-hospitalization. Basic research indicates that the mechanisms of Gualou Xiebai Banxiatang include improving endothelial functions，exhibiting anti-inflammatory properties，countering oxidative stress，preventing apoptosis，inhibiting ventricular remodeling，regulating mitochondrial functions，improving hemorheology，and modulating autophagy and neurotransmitters. This article reviews relevant articles in recent years with focuses on the compatibility，clinical application，and mechanism of Gualou Xiebai Banxiatang. This review is expected to provide a theoretical basis for the mechanism research and clinical application of this formula in treating CVD and to offer ideas and reference for in-depth research.

ObjectiveTo investigate the effect of Naoqingtong decoction （NQT） on the kidney damage and the inflammatory factors NOD-like receptor protein 3 （NLRP3）， apoptosis-associated speck-like protein containing a C-terminal caspase recruitment domain （ASC）， cysteinyl aspartate-specific proteinase-1 （Caspase-1）， interleukin-6 （IL-6）， and tumor necrosis factor-α （TNF-α） in spontaneously hypertensive rats （SHRs）. MethodsTwenty-four SHRs were randomized into a model group， a low-dose （12.9 g·kg^-1·d^-1） NQT （NQT-L） group， a high-dose （25.8 g·kg^-1·d^-1） NQT group （NQT-H）， and a captopril （CTP， 20 mg·kg^-1·d^-1） group， with 6 rats in each group. In addition， 6 homozygous male Wistar-Kyoto rats were used as the control group. The control and model groups were administrated with the same amount of normal saline by gavage for 8 weeks. General behaviors of rats were observed during the intervention period， and the blood pressure was measured periodically. At the end of intervention， the body mass was weighed， and both kidneys were collected and weighed for the calculation of the renal index. Hematoxylin-eosin staining was performed to observe the pathological changes in the kidney tissue. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） and Western blot were employed to determine the expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue. ResultsDuring the experiment period， the control group had normal mental status， food intake， and activity， while the model group showed thinning of hair， loss of luster， reduced activity， loss of appetite， fecal adhesion， and irritability， and some of the skin had scratches or blood scabs. The above symptoms were alleviated to different degrees after 8 weeks of NQT administration. An intelligent non-invasive sphygmomanometer was used to measure the tail artery pressure of rats， which showed that the systolic and diastolic blood pressure of rats in the model group was higher than that in the control group （P<0.01）. Compared with the model group， drug interventions lowered the systolic and diastolic blood pressure （P<0.05， P<0.01）. Compared with the control group， the model group showed severe pathological damage in the kidney tissue， which was alleviated in each drug intervention group. Compared with the control group， the model group showed up-regulated expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue （P<0.05， P<0.01）. Compared with the model group， the drug intervention groups showed down-regulated expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue （P<0.05， P<0.01）. ConclusionNQT can lower the blood pressure in SHRs by inhibiting the activation of NLRP3 inflammasomes， suppressing renal inflammation， and ameliorating hypertensive kidney damage.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.

Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.

Robot-assisted surgery with its advantages such as three-dimensional high-definition vision, dexterous robotic arms, and tremor filtration, is increasingly being applied to complex radical gastrectomy. However, the role of the surgical assistant remains crucial during the procedure. The assistant is responsible for tasks outside the console, including adjusting robotic arms, changing instruments, exposing the surgical field, and addressing unexpected situations. The technical proficiency of the assistant and their collaboration efficiency with the primary surgeon directly impact the smoothness of surgery and patients' outcomes. With the expansion of robot-assisted surgical indications, the establishment of a standardized training system and the optimization of team collaboration models have become urgent challenges to address. This article draws on the author's practical experience as an assistant in robot-assisted gastric cancer surgeries, conducting an in-depth analysis of the responsibilities and operational skills of surgical assistants in robot-assisted procedures. The aim is to develop a relatively comprehensive set of operational guidelines for surgical assistants in robot-assisted radical gastrectomy, providing valuable references for enhancing the overall efficiency of surgical teams and improving surgical outcomes.