AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Introduction: Capivasertib is a selective oral AKT inhibitor approved for hormone receptor-positive, HER2-negative advanced breast cancer with AKT pathway mutations. As AKT is integral to insulin signaling, its inhibition predisposes patients to hyperglycemia. We report a case of severe capivasertib-induced hyperglycemia with profound insulin resistance in a non-diabetic patient. Case: A 56-year-old female with metastatic breast cancer (ER/ PR-positive, HER2-negative, AKT1- and ESR1-mutated, TMB-high) presented with severe hyperglycemia following capivasertib initiation. She had no prior diabetes history, with a baseline hemoglobin A1c of 5.6%. Her first cycle (200 mg twice daily, 7 April 2025) was uncomplicated metabolically. The second cycle was escalated to 400 mg twice daily on 21 April 2025. By Day 3, blood glucose rose significantly. Premixed insulin 20 units failed to achieve glycemic control, necessitating intravenous insulin infusion. Despite escalation to 30 units per hour, euglycemia could not be achieved. Notably, there was no biochemical evidence of diabetic ketoacidosis or hyperosmolar hyperglycemic state, and the patient remained hemodynamically stable. No corticosteroids or other contributing medications were administered. Blood glucose normalized spontaneously approximately 36 hours after the last capivasertib dose, and all insulin was weaned and discontinued by 26 April 2025. She remained euglycemic without antidiabetic therapy thereafter. The patient and family opted for palliative care, and she passed away on 6 May 2025. Conclusion Capivasertib can precipitate severe, insulin-resistant hyperglycemia even in non-diabetic patients, without progression to overt hyperglycemic crisis. Spontaneous resolution upon drug cessation supports a direct drugmediated mechanism via AKT-disrupted insulin signaling. Clinicians should monitor glucose closely during therapy and consider drug cessation in refractory cases. Further studies are warranted to guide optimal glycemic management.
capivasertib ; Hyperglycemia ; Insulins

Local anesthetics (LAs), such as articaine (AT), exhibit limited efficacy in inflammatory environments, which constitutes a significant limitation in their clinical application within oral medicine. In our prior research, we developed AT-17, which demonstrated effective properties in chronic inflammatory conditions and appears to function as a novel oral LA that could address this challenge. In the present study, we further elucidated the beneficial effects of AT-17 in acute inflammation, particularly in oral acute inflammation, where mitochondrial-related apoptosis played a crucial role. Our findings indicated that AT-17 effectively inhibited lipopolysaccharide (LPS)-induced nerve cell apoptosis by ameliorating mitochondrial dysfunction in vitro. This process involved the inhibition of mitochondrial reactive oxygen species (mtROS) production and the subsequent activation of the NRF2 pathway. Most notably, improvements in mitochondria-related apoptosis were key contributors to AT-17's inhibition of voltage-gated sodium channels. Additionally, AT-17 was shown to reduce mtROS production in nerve cells through the Na⁺/NCLX/ETC signaling axis. In conclusion, we have developed a novel local anesthetic that exhibits pronounced anesthetic functionality under inflammatory conditions by enhancing mitochondria-related apoptosis. This advancement holds considerable promise for future drug development and deepening our understanding of the underlying mechanisms of action.

OBJECTIVE: To explore the effectiveness of primary interventional revascularization combined with secondary perforator composite flap in the treatment of peripheral arterial disease (PAD) accompanied by soft tissue defects around the ankle. METHODS: Between January 2022 and January 2025, 12 patients with PAD and soft tissue defects around the ankle were admitted. Among them, there were 9 males and 3 females; their ages ranged from 52 to 82 years, with an average of 68.9 years. The causes of injury included 4 cases of traffic accident, 5 cases of falls, 1 case of falling from height, 1 case of foreign body puncture injury, and 1 case of electric shock injury. The infection duration ranged from 1 month to 35 years, with a median duration of 3.5 months. The wound size ranged from 5.5 cm×3.0 cm to 15.0 cm×9.0 cm. The ankle-brachial index (ABI) was 0.32±0.12. The visual analogue scale (VAS) score for pain was 3.3±0.5. Preoperative vascular stenosis assessment was performed in all patients, with primary intervention to dredge large and medium-sized arteries, followed by secondary repair of the wound using a perforator composite flap. The flap size ranged from 6.5 cm×4.0 cm to 16.0 cm×10.0 cm. The donor sites were sutured directly or repaired with skin grafts. After two stages of treatment, the effectiveness was evaluated by measuring ABI, observing flap survival and wound healing, assessing VAS scores, and American Orthopedic Foot and Ankle Society (AOFAS) scores. RESULTS: All 12 cases completed two stages of treatment; all patients were followed up after the second-stage treatment, with a follow-up period ranging from 7 to 28 months, with an average of 16.8 months. After the first-stage treatment, the skin temperature around the ankle was significantly higher than that before treatment, and the ABI increased to 0.71±0.07, with a significant difference ( t=9.918, P<0.001). After the second-stage treatment, the blisters on the distal end of the skin flap occurred in 3 cases. The flaps survived and the wounds healed, with a healing time ranging from 10 to 14 days (mean, 11.8 days). The incisions at the donor site healed by first intention, and the skin grafts survived. The VAS score was 0.5±0.5 at 3 weeks, which was significantly lower than that before treatment ( t=13.675, P<0.001). No infection recurrence occurred during follow-up. At 6 months after the second-stage treatment, the AOFAS score of the ankle joint ranged from 92 to 97, with an average of 94.7, all reaching excellent. CONCLUSION Interventional revascularization combined with perforator composite flap for staged treatment of PAD with ankle soft tissue defects can obtain good effectiveness, by unclogging the main blood vessels, improving lower limb blood supply, and improving the survival rate of the skin flap.
Humans ; Male ; Female ; Middle Aged ; Aged ; Peripheral Arterial Disease/surgery* ; Soft Tissue Injuries/surgery* ; Perforator Flap/blood supply* ; Plastic Surgery Procedures/methods* ; Aged, 80 and over ; Ankle/blood supply* ; Treatment Outcome ; Ankle Brachial Index ; Skin Transplantation/methods*

OBJECTIVE: To compare clinical efficacy of tibial transverse transport (TTT) microcirculation reconstruction and periosteal distraction in treating patients with early diabetic foot(DF). METHODS: From June 2021 to June 2024, 60 patients with DF were admitted and divided into bone transport group and stretch group according to different treatment methods. There were 30 patients in bone transport group, including 16 males and 14 females;aged from 48 to 65 years old with an average of (55.59±3.78) years old;the course of disease ranged from 2 to 9 months with an average of(5.95±1.32) months;TTT microcirculation reconstruction surgery was performed. There were 30 patients in distraction group, including 17 males and 13 females;aged from 47 to 67 years old with an average of (55.24±3.81) years old;the course of disease ranged from 2 to 10 months with an average of (5.68±1.54) months;periosteal distraction surgery was performed. The skin temperature of the affected feet, the time of getting out of bed and walking after operation, the time of full weight-bearing, the wound healing time and complications were compared between two groups;the pain was evaluated by visual analogue scale (VAS) before operation and one month after operation respectively;the changes of blood flow velocity of dorsal foot arteries, ankle brachial index(ABI), epidermal growth factor (EGF), and basic fibroblast growth factor (bFGF) before and after operation at 3 months were compared between two groups. RESULTS: All patients were followed up for 3 to 4 months with an average of (3.52±0.12) months. There were no statistically significant differences in comparison of foot skin temperature, postoperative walking time, full weight-bearing time and complications between two groups (P>0.05). The wound healing time of bone transport group (61.26±7.31) days was shorter than that of distraction group (70.17±7.15) days, and the difference was statistically significant (P<0.05). Postoperative VAS at 1 month of bone transport group (2.19±0.21) was lower than that of distraction group (2.55±0.20), and the difference was statistically significant (P<0.05). At 3 months after operation, the blood flow velocity of dorsal foot artery, ankle-brachial index, EGF and bFGF in bone transport group were(34.73±4.18) cm·s^-1, (0.95±0.13), (716.61±71.13) pg·ml^-1 and (175.69±31.28) pg·ml^-1, respectively;which were higher than that of distraction group (31.86±3.23) cm·s^-1, (0.84±0.11), (677.37±70.21) pg·ml^-1, (149.26±30.13) pg·ml^-1, and the differences were statistically significant (P<0.05). There was no recurrence of ulcers in situ or at other sites in both groups during follow-up. CONCLUSION Compared with periosteal distraction, TTT microcirculation reconstruction surgery has a definite effect in the treatment of early DF. It could effectively reduce pain level, improve blood flow indicators and vascular endothelial function of the foot, and has a relatively high safety.
Humans ; Male ; Female ; Middle Aged ; Aged ; Tibia/blood supply* ; Diabetic Foot/physiopathology* ; Microcirculation ; Periosteum/surgery* ; Plastic Surgery Procedures/methods* ; Osteogenesis, Distraction

Osteoporosis is a prevalent skeletal condition characterized by reduced bone mass and strength, leading to increased fragility. Buqi-Tongluo (BQTL) decoction, a traditional Chinese medicine (TCM) prescription, has yet to be fully evaluated for its potential in treating bone diseases such as osteoporosis. To investigate the mechanism by which BQTL decoction inhibits osteoclast differentiation in vitro and validate these findings through in vivo experiments. We employed MTS assays to assess the potential proliferative or toxic effects of BQTL on bone marrow macrophages (BMMs) at various concentrations. TRAcP experiments were conducted to examine BQTL's impact on osteoclast differentiation. RT-PCR and Western blot analyses were utilized to evaluate the relative expression levels of osteoclast-specific genes and proteins under BQTL stimulation. Finally, in vivo experiments were performed using an osteoporosis model to further validate the in vitro findings. This study revealed that BQTL suppressed receptor activator of NF-κB ligand (RANKL)-induced osteoclastogenesis and osteoclast resorption activity in vitro in a dose-dependent manner without observable cytotoxicity. The inhibitory effects of BQTL on osteoclast formation and function were attributed to the downregulation of NFATc1 and c-fos activity, primarily through attenuation of the MAPK, NF-κB, and Calcineurin signaling pathways. BQTL's inhibitory capacity was further examined in vivo using an ovariectomized (OVX) rat model, demonstrating a strong protective effect against bone loss. BQTL may serve as an effective therapeutic TCM for the treatment of postmenopausal osteoporosis and the alleviation of bone loss induced by estrogen deficiency and related conditions.
Animals ; NFATC Transcription Factors/genetics* ; Drugs, Chinese Herbal/pharmacology* ; Ovariectomy ; Osteoclasts/metabolism* ; Female ; Osteogenesis/drug effects* ; Rats, Sprague-Dawley ; Rats ; NF-kappa B/genetics* ; Osteoporosis/genetics* ; Signal Transduction/drug effects* ; Bone Resorption/genetics* ; Cell Differentiation/drug effects* ; Humans ; RANK Ligand/metabolism* ; Mitogen-Activated Protein Kinases/genetics* ; Transcription Factors

Objective To explore the acceptability of routine biochemical test results for serum samples with varying degrees of chylous high triglyceride(TG).Methods Blood samples of 69 patients with different degrees of lipids were collected,including 33 patients with mild to moderate lipids(1.7 mmol/L≤TG<5.6 mmol/L)and 36 patients with severe lipids(TG≥5.6 mmol/L).Twenty-nine biochemical tests were detected before and after high-speed centrifugation.The result acceptability before high speed centrifugation of serum was compared with the results after high speed centrifugation as the gold standard[TG and total cholesterol(TC)before centrifugation].The acceptable criteria were subject to the following three conditions at the same time.Firstly,correlation coefficient(R2)was greater than or equal to 0.95.Secondly,the slope of linear re-gression equation was 1.00±0.05.Thirdly,for the same index,the number of samples whose result bias be-fore and after centrifugation was less than 1/2 total allowable error(TEa)in more than 90%of the total sam-ple numbers.Results Firstly,in the mild to moderate lipemia group,22 tests met the criteria,7 tests did not,including total protein(TP),albumin(ALB),TG,aspartate aminotransferase(AST),carbon dioxide(CO2),α-L-fucosidase(AFU),lactate dehydrogenase(LDH)(bias<10%),and the coincidence rate was 75.9%.In the severe lipemia group,12 tests met the criteria,17 tests did not,including pre-albumin(PA),AFU,γ-glu-tamyltransferase(γ-GT),LDH,AST,TC,direct bilirubin(DBIL),CO2,5'-nucleotidase(5'-NT),small and low-density lipoprotein cholesterol(sd-LDL-C),high density lipoprotein cholesterol(HDL-C),low-density lipoprotein cholesterol(LDL-C),adenosine deaminase(ADA),cystatin C(CysC),glycosylated albumin(GA),total bilirubin(TBIL)(bias>10%),the coincidence rate was 41.4%,and there was a statistically sig-nificant difference in the coincidence rate between the two groups(P<0.05).Secondly,there was no statisti-cally significant difference in the acceptability of results between continuous monitoring method and endpoint method detection methods(P>0.05).Conclusion Most test results of direct determination with mild or moderate lipemia samples are acceptable,and the bias of unacceptable tests is small(<10%),so it is recom-mended to issue a test report without further sample treatment.However,due to the large number of unacceptable tests and larger bias(>10%),severe lipemia samples should be determined after high-speed centrifugation.

OBJECTIVE: To explore the methods, fixation points, and effectiveness of staged therapy using external fixation frame in treatment of infectious nonunion near knee joint. METHODS: A retrospective analysis was conducted on the clinical data of 60 patients with infectious nonunion near knee joint, who underwent staged therapy using external fixation frame between June 2021 and June 2024 and were followed up. There were 48 males and 12 females with an average age of 47.9 years (range, 16-70 years). The disease duration ranged from 9 months to 20 years, with a median of 14 months. Among them, 21 cases of infectious nonunion located in the distal femur, 36 cases in the proximal tibia, and 3 cases in the patella; 12 cases exhibited segmental bone defects (≥4 cm), while 48 cases presented with localized bone defects (<4 cm). Osteomyelitis was classified using the Cierny-Mader system, with 3 cases classified as type Ⅰ, 6 cases as type Ⅱ, 35 cases as type Ⅲ, and 16 cases as type Ⅳ. Preoperative C-reactive protein levels ranged from 15.1 to 55.8 mg/L (mean, 36.4 mg/L). The erythrocyte sedimentation rate was 35-80 mm/1 h (mean, 56.9 mm/1 h). The Hospital for Special Surgery (HSS) score for knee joint was 69.3±17.7 and the range of motion was (70.61±40.60)°. After debridement and placement of antibiotic carriers at the first-stage operation, unilateral orbital frames ( n=14), combined frames ( n=27), or Ilizarov frames ( n=19) were used for cross joint fixation ( n=9) or joint preservation fixation ( n=51). After 6-8 weeks of infection control, the bone grafting or bone transport was performed at the second-stage operation based on the type of bone defect, with internal fixation employed as an adjunct if necessary. After operation, the infection control and fracture healing were observed and the bone healing time was recorded. The knee joint function was assessed using the HSS score, and the knee joint range of motion was measured as well as the angle of motion loss. Patients were grouped according to the site of nonunion, type of external fixation frame, and fixation method. The bone healing time, change value of HSS score, and knee joint range of motion loss (difference between pre- and post-operation) were compared between groups. RESULTS: All infection markers returned to the normal range within 6 weeks after the first-stage operation. All patients were followed up 12-48 months (mean, 22.0 months) after the second-stage operation. There were 5 cases of needle tract infection during the external fixation period, and 3 cases of infection recurrence after the second-stage operation, all of which were cured after symptomatic treatment. The bone healing time was 6-18 months (mean, 11.0 months). At last follow-up, the HSS score was 88.5±7.9 and the range of motion was (61.84±40.59)°, with significant differences compared to preoperative values ( P<0.05); the knee joint range of motion loss was (8.77±11.07)°. The bone healing time was significantly longer in the distal femur group than in the proximal tibia group ( P<0.05), and in the unilateral orbital frames group than in the Ilizarov frames group and the combined frames group ( P<0.05). The angle of motion loss was significantly larger in the Ilizarov frames group than in the unilateral orbital frames group and the combined frames group ( P<0.05). The change value of HSS score was significantly higher in the cross joint fixation group than in the joint preservation fixation group ( P<0.05). CONCLUSION During the first-stage operation, debridement is performed and antibiotic carriers are placed to control infection. External fixation frames are then precisely positioned based on the distance between the lesion and the joint surface, avoiding the infected wound while ensuring mechanical balance. During the second-stage operation, bone grafting options are selected according to the extent of bone defects to enhance the bone union. Postoperative early functional exercises of the knee joint are permitted to improve joint function.
Humans ; Male ; Female ; Middle Aged ; Adult ; Fractures, Ununited/surgery* ; Retrospective Studies ; External Fixators ; Aged ; Knee Joint/surgery* ; Adolescent ; Young Adult ; Treatment Outcome ; Osteomyelitis/surgery* ; Fracture Fixation/instrumentation* ; Bone Transplantation ; Tibial Fractures/surgery*

Objective:To explore the application value of three-dimensional visualization reconstruction technology in robot-assisted laparoscopic partial nephrectomy（RAPN）for the treatment of highly complex（R.E.N.A.L. score≥10）renal hilar tumors.Methods:The clinical data of 87 patients with highly complex renal hilar tumors with R.E.N.A.L. scores ≥10 who were treated in First Affiliated Hospital of Nanchang University from January 2021 to December 2024 were retrospectively analyzed，of which 36 underwent 3D visualization reconstruction and 51 underwent conventional CT. The 3D visualization reconstruction method was to import the patient’s enhanced CT images in DICOM format into the 3D reconstruction image data processing software to produce a 3D visualization model. There were 22 males and 14 females in the 3D visualization group，with an average age of（54.2 ± 9.5）years，a body mass index of（24.8 ± 4.5）kg/m 2，and a tumor size of（4.3 ± 1.0）cm. Tumors were located on the left side in 16 cases and on the right side in 20 cases. Tumor stages were classified as T 1a in 11 cases，T 1b in 21 cases，and T 2a in 4 cases. The R.E.N.A.L. scores were distributed as follows：10 points in 21 cases，11 points in 12 cases，and 12 points in 3 cases. The estimated glomerular filtration rate（eGFR）before operation was（78.2±9.6）ml/（min·1.73 m 2）. There were 35 males and 16 females in the conventional CT group，with an average age of（51.3±8.9）years，a body mass index of（25.4 ± 3.9）kg/m 2，and a tumor size of（4.1 ± 1.2）cm. Tumors were located on the left side in 25 cases and on the right side in 26 cases. Tumor stages were classified as T 1a in 12 cases，T 1b in 33 cases，and T 2a in 6 cases. The R.E.N.A.L. scores were distributed as follows：10 points in 31 cases，11 points in 18 cases，and 12 points in 2 cases . The preoperative eGFR was（80.6 ± 8.8）ml/（min·1.73 m 2）. There was no statistical difference in general data and preoperative renal function between the two groups（ P > 0.05）. Both groups underwent RAPN. The two groups were analyzed and compared in terms of operation time，warm ischemia time，intraoperative blood loss，postoperative hospital stay，postoperative complications，and changes in renal function 3 months after surgery. Results:There were no cases of conversion to radical treatment or open surgery in both the 3D visualization group and the conventional CT group. The 3D visualization group had shorter operation time［（94.6 ± 18.5）min vs.（110.2 ± 17.2）min， P < 0.001］，shorter renal artery occlusion time［（23.3 ± 4.0）min vs.（27.2 ± 3.3）min， P < 0.001］，less intraoperative blood loss［120（100，250）ml vs. 150（120，300）ml， P = 0.018］，and a lower proportion of intraoperative collecting system incision（19/36 vs. 38/51， P = 0.042）than the conventional CT group. There was no significant statistical difference in the time of postoperative drainage tube removal and postoperative hospital stay between the two groups（ P > 0.05）. One case in the 3D visualization group had postoperative fever，and two cases in the conventional CT group had postoperative obvious macroscopic hematuria. Postoperative pathological diagnosis of the patients was clear cell carcinoma in 78 cases，papillary cell carcinoma in 6 cases，chromophobe cell carcinoma in 2 cases，and oncocytoma in 1 case. No positive resection margin was found in both groups. Three months after surgery，there was no significant statistical difference in eGFR between the two groups［（70.6 ± 8.5）ml/（min·1.73 m 2）vs.（71.4 ± 9.2）ml/（min·1.73 m 2）， P = 0.681］. During the median follow-up of 17.8 months，no tumor recurrence or metastasis was observed in either group. Conclusions:RAPN has good safety and feasibility in the treatment of highly complex（R.E.N.A.L. score ≥10）renal hilar tumors. Preoperative three-dimensional visualization reconstruction technology helps to reduce RAPN operation time，renal artery occlusion time and intraoperative blood loss，and has good clinical application value.