1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Chinese expert consensus on postoperative follow-up for non-small cell lung cancer (version 2025)
Lunxu LIU ; Shugeng GAO ; Jianxing HE ; Jian HU ; Di GE ; Hecheng LI ; Mingqiang KANG ; Fengwei TAN ; Fan YANG ; Qiang PU ; Kaican CAI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(03):281-290
Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.
3.Principles, technical specifications, and clinical application of lung watershed topography map 2.0: A thoracic surgery expert consensus (2024 version)
Wenzhao ZHONG ; Fan YANG ; Jian HU ; Fengwei TAN ; Xuening YANG ; Qiang PU ; Wei JIANG ; Deping ZHAO ; Hecheng LI ; Xiaolong YAN ; Lijie TAN ; Junqiang FAN ; Guibin QIAO ; Qiang NIE ; Mingqiang KANG ; Weibing WU ; Hao ZHANG ; Zhigang LI ; Zihao CHEN ; Shugeng GAO ; Yilong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):141-152
With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.
4.Diagnostic value of combining the corneal stress-strain index with corneal biomechanical parameters for early keratoconus
Dian PU ; Qian KANG ; Zhiying MA ; Hongliang XU
International Eye Science 2025;25(9):1491-1494
AIM: To explore the diagnostic value of combining the corneal stress-strain index(SSI)with corneal biomechanical parameters for early keratoconus.METHODS:A retrospective study was conducted on 34 patients(53 eyes)with early keratoconus diagnosed and treated in our hospital from March 2022 to February 2024. Additionally, 112 normal volunteers(112 eyes)who underwent physical examinations in our hospital during the same period were selected as a healthy control group. The CorvisST equipment was utilized for measurement and recorded deformation with Scheimpflug camera to obtain 10 biomechanical parameters: first applanation time(A1T), first applanation length(A1L), velocity of initial applanation(Vin), second applanation time(A2T), second applanation length(A2L), velocity of outward applanation(Vout), highest concavity time(HCT), highest concavity depth of applanation(HCDA), highest concavity radius(HCR), and peak distance(PD), as well as stress-strain index(SSI), and the corneal biomechanical parameters of the two groups were compared. Furthermore, Logistic regression analysis was used to identify the risk factors for keratoconus, and ROC curves were plotted to analyze the biomechanical parameters of the cornea for early diagnosis of keratoconus.RESULTS:The SSI(0.77±0.17)in patients with keratoconus was lower than that in healthy controls(1.01±0.24; P<0.001). Patients with keratoconus had lower A1T, A1L, A2L, and HCR, and higher Vout, HCDA, and PD compared to healthy controls(all P<0.001). Logistic regression analysis showed that decreased SSI, A1T, A1L, A2L, and HCR, as well as increased Vout, HCDA, and PD, were risk factors for the development of keratoconus(P<0.001). ROC curve analysis showed that the AUC value for combined diagnosis of early keratoconus was 0.997, with a Youden's index of 0.954, sensitivity and specificity of 98.1% and 97.3%, respectively, and a 95% CI of 0.994-1.000.CONCLUSION:The combination of SSI and corneal biomechanical parameters holds diagnostic significance for early keratoconus, and the joint diagnostic value is even higher. It can be considered as a diagnostic or screening indicator for early keratoconus.
5.Short-term clinical efficacy of unilateral external fixator combined with percutaneous Kirschner wire fixation in the treatment of type C1 distal radius fractures in elderly patients.
Run-Bin SHEN ; Guo-Liang LI ; Xiao-Ping LIU ; Kang CHEN ; Guang-Pu HAN ; Jian-Yong ZHAO
China Journal of Orthopaedics and Traumatology 2025;38(1):25-30
OBJECTIVE:
To investigate the short-term clinical effect of closed reduction single arm external fixator combined with percutaneous needle fixation in the treatment of C1 distal radius fracture in elderly patients.
METHODS:
Between December 2022 and December 2023, a total of 60 elderly patients diagnosed with type C1 distal radius fractures were treated, comprising 9 males and 51 females. The age ranged from 65 to 84 years old, with an average of (72.69±8.14) years old. Among them, there were 18 cases on the left side and 42 cases on the right side. There were 55 cases of falling injury and 5 cases of traffic accident injury. According to the different surgical methods, the patients were divided into observation group and control group, with 30 cases in each group. The control group underwent manual reduction and unilateral external fixator fixation, consisting of 4 males and 26 females. The mean age was (72.54±8.67) years old. The body mass index (BMI) was (20.61±2.17) kg·m-2. There were 10 cases on the left side and 20 cases on the right side. Among them, there were 27 cases of falling injury and 3 cases of traffic accident injury. The observation group was treated with manual reduction and unilateral external fixator combined with percutaneous Kirschner wire fixation, including 5 males and 25 females. The mean age was (72.76±7.23) years old. BMI (20.82±2.03) kg·m-2. The left side was involved in 8 cases and the right side in 22 cases. There were 28 cases of falling injury and 2 cases of traffic accident injury. The changes in radial height, ulnar declination, palmar inclination angle parameters and patient-rated wrist evaluation (PRWE) were assessed on X-ray films before surgery, 2 days after surgery, and 12 weeks after surgery between the two groups.
RESULTS:
All surgical procedures were successfully completed in both groups without any significant complications. All patients were followed up for a duration from 12 to 20 weeks with an average of(14.50±2.78) weeks. The two groups exhibited significant differences in radial height, palmar inclination angle, and ulnar deviation angle at 2 days and 12 weeks post-operation (P<0.05). However, there was no statistically significant difference observed in radial height, palmar inclination, and ulnar deviation between the two groups at 2 days after the operation (P>0.05). There were significant differences in radial height, palmar inclination angle, and ulnar deviation between the two groups at 12 weeks after operation (P<0.05). At 2 days and 12 weeks after the operation, there were significant differences in PRWE scores of the two groups compared with preoperative scores(P<0.05). At 2 days after the operation, there was no significant difference in PRWE score between the two groups (P>0.05). The PRWE score showed a significant difference between the two groups at 12 weeks post-operation(P<0.05).
CONCLUSION
The combination of closed reduction and unilateral external fixator, along with percutaneous pin fixation provides move stable fixation for type C1 distal radius fractures. Gradual removal of external fixator further facilitatse the recovery of wrist joint function.
Humans
;
Male
;
Female
;
Radius Fractures/surgery*
;
External Fixators
;
Aged
;
Aged, 80 and over
;
Bone Wires
;
Fracture Fixation/instrumentation*
;
Wrist Fractures
6.Beneficial Effects of Dendrobium officinale Extract on Insomnia Rats Induced by Strong Light and Noise via Regulating GABA and GABAA Receptors.
Heng-Pu ZHOU ; Jie SU ; Ke-Jian WEI ; Su-Xiang WU ; Jing-Jing YU ; Yi-Kang YU ; Zhuang-Wei NIU ; Xiao-Hu JIN ; Mei-Qiu YAN ; Su-Hong CHEN ; Gui-Yuan LYU
Chinese journal of integrative medicine 2025;31(6):490-498
OBJECTIVE:
To explore the therapeutic effects and underlying mechanisms of Dendrobium officinale (Tiepi Shihu) extract (DOE) on insomnia.
METHODS:
Forty-two male Sprague-Dawley rats were randomly divided into 6 groups (n=7 per group): normal control, model control, melatonin (MT, 40 mg/kg), and 3-dose DOE (0.25, 0.50, and 1.00 g/kg) groups. Rats were raised in a strong-light (10,000 LUX) and -noise (>80 db) environment (12 h/d) for 16 weeks to induce insomnia, and from week 10 to week 16, MT and DOE were correspondingly administered to rats. The behavior tests including sodium pentobarbital-induced sleep experiment, sucrose preference test, and autonomous activity test were used to evaluate changes in sleep and emotions of rats. The metabolic-related indicators such as blood pressure, blood viscosity, blood glucose, and uric acid in rats were measured. The pathological changes in the cornu ammonis 1 (CA1) region of rat brain were evaluated using hematoxylin and eosin staining and Nissl staining. Additionally, the sleep-related factors gamma-aminobutyric acid (GABA), glutamate (GA), 5-hydroxytryptamine (5-HT), and interleukin-6 (IL-6) were measured using enzyme linked immunosorbent assay. Finally, we screened potential sleep-improving receptors of DOE using polymerase chain reaction (PCR) array and validated the results with quantitative PCR and immunohistochemistry.
RESULTS:
DOE significantly improved rats' sleep and mood, increased the sodium pentobarbital-induced sleep time and sucrose preference index, and reduced autonomic activity times (P<0.05 or P<0.01). DOE also had a good effect on metabolic abnormalities, significantly reducing triglyceride, blood glucose, blood pressure, and blood viscosity indicators (P<0.05 or P<0.01). DOE significantly increased the GABA content in hippocampus and reduced the GA/GABA ratio and IL-6 level (P<0.05 or P<0.01). In addition, DOE improved the pathological changes such as the disorder of cell arrangement in the hippocampus and the decrease of Nissel bodies. Seven differential genes were screened by PCR array, and the GABAA receptors (Gabra5, Gabra6, Gabrq) were selected for verification. The results showed that DOE could up-regulate their expressions (P<0.05 or P<0.01).
CONCLUSION
DOE demonstrated remarkable potential for improving insomnia, which may be through regulating GABAA receptors expressions and GA/GABA ratio.
Animals
;
Dendrobium/chemistry*
;
Rats, Sprague-Dawley
;
Male
;
Sleep Initiation and Maintenance Disorders/blood*
;
Plant Extracts/therapeutic use*
;
Receptors, GABA-A/metabolism*
;
Noise/adverse effects*
;
Light/adverse effects*
;
gamma-Aminobutyric Acid/metabolism*
;
Sleep/drug effects*
;
Rats
;
Receptors, GABA/metabolism*
7.Clinical features of patients with hepatolenticular degeneration aged above 35 years
Hongyun WO ; Chengwei KANG ; Lei ZHAN ; Xiaobing PU
Journal of Clinical Hepatology 2024;40(1):116-120
ObjectiveTo investigate the clinical features of patients with hepatolenticular degeneration (HLD) aged above 35 years. MethodsA retrospective analysis was performed for the clinical data of the patients with HLD, aged above 35 years, who attended West China School of Public Health, Sichuan University, from April 2018 to April 2023, and according to their clinical symptoms, they were divided into mixed type group with 13 patients, liver type group with 12 patients, and brain type group with 5 patients. Related data were collected, including general information (sex, clinical manifestation, age at confirmed diagnosis, time from initial symptoms to confirmed diagnosis, and family history), laboratory examination (routine blood test, liver and renal function, serum copper, serum ceruloplasmin, urinary copper, and coagulation function), and radiological examination. A one-way analysis of variance was used for comparison of normally distributed continuous data between multiple groups, and the Kruskal-Wallis H test was used for comparison of non-normally distributed continuous data between multiple groups; the Fisher’s exact test was used for comparison of categorical data between groups. ResultsFor the 30 patients with HLD, the male/female ratio was 3∶1, and the mean age was 46.13±5.88 years; the patients with positive Kayser-Fleischer ring of the cornea accounted for 43.33%, and the patients with liver cirrhosis accounted for 66.67%. There were significant differences between the three groups in globulin, albumin/globulin ratio, alanine aminotransferase, prothrombin time, international normalized ratio, and activated partial thromboplastin time (F=5.893, 4.513, 4.424, 5.029, 5.248, and 4.942, all P<0.05). ConclusionMost patients are male among the patients diagnosed with HLD after 35 years of age, with the main clinical types of mixed type and liver type, and such patients tend to have poor liver and coagulation functions. For unexplained liver function abnormalities and liver cirrhosis in this age group, the indicators such as serum ceruloplasmin and urinary copper should be screened as early as possible, and liver and kidney function and coagulation function should be monitored.
8.Chinese expert consensus on the diagnosis and treatment of traumatic supraorbital fissure syndrome (version 2024)
Junyu WANG ; Hai JIN ; Danfeng ZHANG ; Rutong YU ; Mingkun YU ; Yijie MA ; Yue MA ; Ning WANG ; Chunhong WANG ; Chunhui WANG ; Qing WANG ; Xinyu WANG ; Xinjun WANG ; Hengli TIAN ; Xinhua TIAN ; Yijun BAO ; Hua FENG ; Wa DA ; Liquan LYU ; Haijun REN ; Jinfang LIU ; Guodong LIU ; Chunhui LIU ; Junwen GUAN ; Rongcai JIANG ; Yiming LI ; Lihong LI ; Zhenxing LI ; Jinglian LI ; Jun YANG ; Chaohua YANG ; Xiao BU ; Xuehai WU ; Li BIE ; Binghui QIU ; Yongming ZHANG ; Qingjiu ZHANG ; Bo ZHANG ; Xiangtong ZHANG ; Rongbin CHEN ; Chao LIN ; Hu JIN ; Weiming ZHENG ; Mingliang ZHAO ; Liang ZHAO ; Rong HU ; Jixin DUAN ; Jiemin YAO ; Hechun XIA ; Ye GU ; Tao QIAN ; Suokai QIAN ; Tao XU ; Guoyi GAO ; Xiaoping TANG ; Qibing HUANG ; Rong FU ; Jun KANG ; Guobiao LIANG ; Kaiwei HAN ; Zhenmin HAN ; Shuo HAN ; Jun PU ; Lijun HENG ; Junji WEI ; Lijun HOU
Chinese Journal of Trauma 2024;40(5):385-396
Traumatic supraorbital fissure syndrome (TSOFS) is a symptom complex caused by nerve entrapment in the supraorbital fissure after skull base trauma. If the compressed cranial nerve in the supraorbital fissure is not decompressed surgically, ptosis, diplopia and eye movement disorder may exist for a long time and seriously affect the patients′ quality of life. Since its overall incidence is not high, it is not familiarized with the majority of neurosurgeons and some TSOFS may be complicated with skull base vascular injury. If the supraorbital fissure surgery is performed without treatment of vascular injury, it may cause massive hemorrhage, and disability and even life-threatening in severe cases. At present, there is no consensus or guideline on the diagnosis and treatment of TSOFS that can be referred to both domestically and internationally. To improve the understanding of TSOFS among clinical physicians and establish standardized diagnosis and treatment plans, the Skull Base Trauma Group of the Neurorepair Professional Committee of the Chinese Medical Doctor Association, Neurotrauma Group of the Neurosurgery Branch of the Chinese Medical Association, Neurotrauma Group of the Traumatology Branch of the Chinese Medical Association, and Editorial Committee of Chinese Journal of Trauma organized relevant experts to formulate Chinese expert consensus on the diagnosis and treatment of traumatic supraorbital fissure syndrome ( version 2024) based on evidence of evidence-based medicine and clinical experience of diagnosis and treatment. This consensus puts forward 12 recommendations on the diagnosis, classification, treatment, efficacy evaluation and follow-up of TSOFS, aiming to provide references for neurosurgeons from hospitals of all levels to standardize the diagnosis and treatment of TSOFS.
9.Research progress in Cup-cage reconstruction for patients with chronic pelvic discontinuity after total hip arthroplasty.
Xingxiao PU ; Qiuru WANG ; Qianhao LI ; Lijun CAI ; Guangtao HAN ; Pengde KANG
Chinese Journal of Reparative and Reconstructive Surgery 2024;38(12):1530-1536
OBJECTIVE:
To summarize research progress on application of Cup-cage reconstruction in revision of chronic pelvic discontinuity (CPD) in patients undergoing total hip arthroplasty (THA).
METHODS:
Relevant literature at home and abroad in recent years was reviewed to summarize the principles of the Cup-cage reconstruction, preoperative patient assessment, intraoperative skills, clinical and radiological effectiveness, limitations, and postoperative complications.
RESULTS:
For the treatment of CPD, the Cup-cage reconstruction achieved long-term acetabular cup bone ingrowth, CPD healing, and biologic fixation of the prosthesis by restoring pelvic continuity. Preoperative evaluation of the surgical site and general condition is necessary. The main intraoperative objectives are to reconstruct pelvic continuity, restore the center of rotation of the hip, and avoid neurovascular injury. Current studies have demonstrated significant clinical and radiological effectiveness as well as acceptable prosthesis survival rates after operation. Nevertheless, there is a lack of evidence regarding the staging of CPD, the optimal surgical approach and internal fixation, and the factors influencing postoperative prosthesis survival remain undefined.
CONCLUSION
Cup-cage reconstruction can be an effective treatment for CPD after THA, but there is still a need to explore CPD staging, Cup-cage approach and internal fixation, and influencing factors on prosthesis survival.
Humans
;
Arthroplasty, Replacement, Hip/methods*
;
Hip Prosthesis
;
Acetabulum/surgery*
;
Reoperation
;
Plastic Surgery Procedures/methods*
;
Prosthesis Failure
;
Postoperative Complications/etiology*
;
Hip Joint/surgery*
10.Phenotype-genotype analysis of the autosomal recessive hereditary hearing loss caused by OTOA variations.
Jin Yuan YANG ; Qiu Quan WANG ; Ming Yu HAN ; Sha Sha HUANG ; Dong Yang KANG ; Xin ZHANG ; Su Yan YANG ; Pu DAI ; Yong Yi YUAN
Chinese Journal of Otorhinolaryngology Head and Neck Surgery 2023;58(5):460-469
Objective: To analyze the phenotypic-genotypic characteristics of hereditary deafness caused by OTOA gene variations. Methods: Family histories, clinical phenotypes and gene variations of six pedigrees were analyzed, which were diagnosed with hearing loss caused by OTOA gene variations at the PLA General Hospital from September 2015 to January 2022. The sequence variations were verified by Sanger sequencing and the copy number variations were validated by multiplex ligation-dependent probe amplification (MLPA) in the family members. Results: The hearing loss phenotype caused by OTOA variations ranged from mild to moderate in the low frequencies, and from moderate to severe in the high frequencies in the probands, which came from six sporadic pedigrees, among which a proband was diagnosed as congenital deafness and five were diagnosed as postlingual deafness. One proband carried homozygous variations and five probands carried compound heterozygous variations in OTOA gene. Nine pathogenic variations (six copy number variations, two deletion variations and one missense variation) and two variations with uncertain significance in OTOA were identified in total, including six copy number variations and five single nucleotide variants, and three of the five single nucleotide variants were firstly reported [c.1265G>T(p.Gly422Val),c.1534delG(p.Ala513Leufs*11) and c.3292C>T(p.Gln1098fs*)]. Conclusions: OTOA gene variations can lead to autosomal recessive nonsyndromic hearing loss. In this study, the hearing loss caused by OTOA defects mostly presents as bilateral, symmetrical, and postlingual, and that of a few presents as congenital. The pathogenic variations of OTOA gene are mainly copy number variations followed by deletion variations and missense variations.
Humans
;
DNA Copy Number Variations
;
Hearing Loss, Sensorineural/genetics*
;
Deafness/genetics*
;
Hearing Loss/genetics*
;
Phenotype
;
Genotype
;
Nucleotides
;
Pedigree
;
Mutation
;
GPI-Linked Proteins/genetics*

Result Analysis
Print
Save
E-mail