AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Thyroid-associated ophthalmopathy(TAO)is a common autoimmune complication in thyroid diseases. Its pathogenesis is complex and involves the abnormal activation of multiple signaling pathways. With the rapid development of molecular biology and genomics technologies, the signal transduction mechanisms and regulatory networks related to TAO have been deeply analyzed. At present, studies have found that the interaction between the TSH receptor(TSHR)and the insulin-like growth factor-1 receptor(IGF-1R)signaling pathway, as well as immune inflammation-related pathways, oxidative stress, and calcium signaling pathways, play important roles in the pathogenesis of TAO. In addition, the research on the regulatory mechanism of non-coding RNA and fibrosis-related signaling molecules has gradually become the focus. Despite much advancement, there are still many unsolved mysteries regarding the exact pathogenesis of TAO. This article aims to systematically review the latest research progress of the main signaling pathways of TAO. By combining the latest achievements in gene expression profiles, single-cell sequencing and drug design, it analyzes potential therapeutic targets and the development directions of innovative drugs, providing a theoretical basis for the pathological mechanism of TAO and a scientific basis for the optimization of clinical treatment strategies at the same time.

OBJECTIVE: To explore the therapeutic effects and underlying mechanisms of Dendrobium officinale (Tiepi Shihu) extract (DOE) on insomnia. METHODS: Forty-two male Sprague-Dawley rats were randomly divided into 6 groups (n=7 per group): normal control, model control, melatonin (MT, 40 mg/kg), and 3-dose DOE (0.25, 0.50, and 1.00 g/kg) groups. Rats were raised in a strong-light (10,000 LUX) and -noise (>80 db) environment (12 h/d) for 16 weeks to induce insomnia, and from week 10 to week 16, MT and DOE were correspondingly administered to rats. The behavior tests including sodium pentobarbital-induced sleep experiment, sucrose preference test, and autonomous activity test were used to evaluate changes in sleep and emotions of rats. The metabolic-related indicators such as blood pressure, blood viscosity, blood glucose, and uric acid in rats were measured. The pathological changes in the cornu ammonis 1 (CA1) region of rat brain were evaluated using hematoxylin and eosin staining and Nissl staining. Additionally, the sleep-related factors gamma-aminobutyric acid (GABA), glutamate (GA), 5-hydroxytryptamine (5-HT), and interleukin-6 (IL-6) were measured using enzyme linked immunosorbent assay. Finally, we screened potential sleep-improving receptors of DOE using polymerase chain reaction (PCR) array and validated the results with quantitative PCR and immunohistochemistry. RESULTS: DOE significantly improved rats' sleep and mood, increased the sodium pentobarbital-induced sleep time and sucrose preference index, and reduced autonomic activity times (P<0.05 or P<0.01). DOE also had a good effect on metabolic abnormalities, significantly reducing triglyceride, blood glucose, blood pressure, and blood viscosity indicators (P<0.05 or P<0.01). DOE significantly increased the GABA content in hippocampus and reduced the GA/GABA ratio and IL-6 level (P<0.05 or P<0.01). In addition, DOE improved the pathological changes such as the disorder of cell arrangement in the hippocampus and the decrease of Nissel bodies. Seven differential genes were screened by PCR array, and the GABA_A receptors (Gabra5, Gabra6, Gabrq) were selected for verification. The results showed that DOE could up-regulate their expressions (P<0.05 or P<0.01). CONCLUSION DOE demonstrated remarkable potential for improving insomnia, which may be through regulating GABA_A receptors expressions and GA/GABA ratio.
Animals ; Dendrobium/chemistry* ; Rats, Sprague-Dawley ; Male ; Sleep Initiation and Maintenance Disorders/blood* ; Plant Extracts/therapeutic use* ; Receptors, GABA-A/metabolism* ; Noise/adverse effects* ; Light/adverse effects* ; gamma-Aminobutyric Acid/metabolism* ; Sleep/drug effects* ; Rats ; Receptors, GABA/metabolism*

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Objective:To evaluate the diagnostic value of native T1 mapping in differentiating Oxford classification (MEST-C) scores in patients with IgA nephropathy.Methods:In this prospective study, patients who underwent both T1 mapping and renal biopsy at the First Medical Center of the Chinese PLA General Hospital between April 2023 and October 2024 were consecutively enrolled. Two radiologists, blinded to clinical and pathological information, measured renal T1 mapping parameters, including cortical T1 (cT1), medullary T1 (mT1), the corticomedullary difference (ΔT1), and the corticomedullary ratio (T1 ratio). Clinical and renal biopsy data based on the Oxford classification from patients with IgA nephropathy were collected. The Oxford classification includes five indicators: Mesangial hypercellularity (M), Endocapillary hypercellularity (E), Segmental glomerulosclerosis or adhesion (S), Tubular atrophy/interstitial fibrosis (T), and Cellular or fibrocellular crescents (C). Spearman correlation analysis was applied to evaluate the associations between MEST-C scores and T1 parameters. The diagnostic performance of T1 parameters for discriminating among scores of the Oxford classification was analyzed using the receiver operating characteristic (ROC) curve.Results:A total of 124 patients with IgA nephropathy were included in this study [66 males, 58 females; age 19-70 years, 39 (30, 51) years]. Except for the E indicator, M, S, T, and C were significantly correlated with renal T1 values ( ρ=0.177-0.414, all P<0.05). cT1 showed the best diagnostic efficacy for the S score, with an area under the curve (AUC) of 0.798, a sensitivity of 68.7%, and a specificity of 88.0%. The best T1 parameter for differentiating the T score was the T1 ratio, with an AUC of 0.687, a sensitivity of 57.9%, and a specificity of 79.1%. Conclusion:Native T1 mapping can be used for the non-invasive assessment of the S and T scores in the Oxford classification of patients with IgA nephropathy.

OBJECTIVE: To investigate the short-term clinical effect of closed reduction single arm external fixator combined with percutaneous needle fixation in the treatment of C1 distal radius fracture in elderly patients. METHODS: Between December 2022 and December 2023, a total of 60 elderly patients diagnosed with type C1 distal radius fractures were treated, comprising 9 males and 51 females. The age ranged from 65 to 84 years old, with an average of (72.69±8.14) years old. Among them, there were 18 cases on the left side and 42 cases on the right side. There were 55 cases of falling injury and 5 cases of traffic accident injury. According to the different surgical methods, the patients were divided into observation group and control group, with 30 cases in each group. The control group underwent manual reduction and unilateral external fixator fixation, consisting of 4 males and 26 females. The mean age was (72.54±8.67) years old. The body mass index (BMI) was (20.61±2.17) kg·m^-2. There were 10 cases on the left side and 20 cases on the right side. Among them, there were 27 cases of falling injury and 3 cases of traffic accident injury. The observation group was treated with manual reduction and unilateral external fixator combined with percutaneous Kirschner wire fixation, including 5 males and 25 females. The mean age was (72.76±7.23) years old. BMI (20.82±2.03) kg·m^-2. The left side was involved in 8 cases and the right side in 22 cases. There were 28 cases of falling injury and 2 cases of traffic accident injury. The changes in radial height, ulnar declination, palmar inclination angle parameters and patient-rated wrist evaluation (PRWE) were assessed on X-ray films before surgery, 2 days after surgery, and 12 weeks after surgery between the two groups. RESULTS: All surgical procedures were successfully completed in both groups without any significant complications. All patients were followed up for a duration from 12 to 20 weeks with an average of(14.50±2.78) weeks. The two groups exhibited significant differences in radial height, palmar inclination angle, and ulnar deviation angle at 2 days and 12 weeks post-operation (P<0.05). However, there was no statistically significant difference observed in radial height, palmar inclination, and ulnar deviation between the two groups at 2 days after the operation (P>0.05). There were significant differences in radial height, palmar inclination angle, and ulnar deviation between the two groups at 12 weeks after operation (P<0.05). At 2 days and 12 weeks after the operation, there were significant differences in PRWE scores of the two groups compared with preoperative scores(P<0.05). At 2 days after the operation, there was no significant difference in PRWE score between the two groups (P>0.05). The PRWE score showed a significant difference between the two groups at 12 weeks post-operation(P<0.05). CONCLUSION The combination of closed reduction and unilateral external fixator, along with percutaneous pin fixation provides move stable fixation for type C1 distal radius fractures. Gradual removal of external fixator further facilitatse the recovery of wrist joint function.
Humans ; Male ; Female ; Radius Fractures/surgery* ; External Fixators ; Aged ; Aged, 80 and over ; Bone Wires ; Fracture Fixation/instrumentation* ; Wrist Fractures

AIM: To explore the diagnostic value of combining the corneal stress-strain index(SSI)with corneal biomechanical parameters for early keratoconus.METHODS:A retrospective study was conducted on 34 patients(53 eyes)with early keratoconus diagnosed and treated in our hospital from March 2022 to February 2024. Additionally, 112 normal volunteers(112 eyes)who underwent physical examinations in our hospital during the same period were selected as a healthy control group. The CorvisST equipment was utilized for measurement and recorded deformation with Scheimpflug camera to obtain 10 biomechanical parameters: first applanation time(A1T), first applanation length(A1L), velocity of initial applanation(Vin), second applanation time(A2T), second applanation length(A2L), velocity of outward applanation(Vout), highest concavity time(HCT), highest concavity depth of applanation(HCDA), highest concavity radius(HCR), and peak distance(PD), as well as stress-strain index(SSI), and the corneal biomechanical parameters of the two groups were compared. Furthermore, Logistic regression analysis was used to identify the risk factors for keratoconus, and ROC curves were plotted to analyze the biomechanical parameters of the cornea for early diagnosis of keratoconus.RESULTS:The SSI(0.77±0.17)in patients with keratoconus was lower than that in healthy controls(1.01±0.24; P<0.001). Patients with keratoconus had lower A1T, A1L, A2L, and HCR, and higher Vout, HCDA, and PD compared to healthy controls(all P<0.001). Logistic regression analysis showed that decreased SSI, A1T, A1L, A2L, and HCR, as well as increased Vout, HCDA, and PD, were risk factors for the development of keratoconus(P<0.001). ROC curve analysis showed that the AUC value for combined diagnosis of early keratoconus was 0.997, with a Youden's index of 0.954, sensitivity and specificity of 98.1% and 97.3%, respectively, and a 95% CI of 0.994-1.000.CONCLUSION:The combination of SSI and corneal biomechanical parameters holds diagnostic significance for early keratoconus, and the joint diagnostic value is even higher. It can be considered as a diagnostic or screening indicator for early keratoconus.

Toxoplasmosis is a zoonotic disease caused by infection with Toxoplasma gondii. Congenital toxoplasmosis is a common form of intrauterine infection and is associated with severe neurological sequelae such as cerebral palsy and cognitive impairment. This report presented the magnetic resonance imaging (MRI) features of a fetal intracranial toxoplasmosis case, including bilateral ventriculomegaly, multiple intracranial cystic lesions, and parenchymal calcifications, without concurrent retinal abnormalities or hepatosplenomegaly. Post-termination analyses confirmed the presence of T.gondii DNA in amniotic fluid and umbilical venous blood, with histopathology revealing necrosis and eosinophilic infiltration. MRI demonstrates superior soft-tissue resolution in evaluating the extent of cerebral lesions and parenchymal damage, underscoring its diagnostic value in fetal toxoplasmic encephalopathy.

Objective:To investigate the effect of altitude on the risk of pre-eclampsia (PE).Methods:This cross-sectional study included 19 246 pregnant women who delivered in Gansu Provincial Hospital from January 2016 to December 2020. General clinical data, pregnancy outcomes and neonatal outcomes were collected. The diagnosis of PE was based on the disease diagnosis coding of medical record information system and the Chinese guidelines for the diagnosis and treatment of hypertensive disorders in pregnancy (2020). According to the altitude of residence, the subjects were divided into low altitude group (9 931 cases), middle altitude group (9 068 cases) and high altitude group (247 cases). Univariate and multivariate logistic regression analyses were used to evaluate the relationship between altitude and the risk of PE, after adjusting for confounding factors such as age, ethnicity, mode of conception, gestational diabetes mellitus, and hemoglobin level.Results:(1) Among the 19 246 pregnant women, 752 (3.91%, 752/19 246) were diagnosed with PE. The incidence of PE in the low altitude group, middle altitude group and high altitude group was 2.95% (293/9 931), 4.91% (445/9 068) and 5.67% (14/247), respectively. With the increase of living altitude, the incidence of PE increased significantly ( P<0.001). (2) The results of univariate logistic analysis showed that compared with the low altitude area, the risk of PE in pregnant women living in the middle altitude area and high altitude area increased by 70% ( OR=1.70, 95% CI: 1.46-1.97; P<0.001) and 98% ( OR=1.98, 95% CI: 1.14-3.43; P=0.016). (3) The results of multivariate logistic regression analysis showed that after fully adjusting for confounding factors, the risk of PE increased by 40% for every 500 meters of elevation ( OR=1.40, 95% CI: 1.25-1.57; P<0.001). Compared with those living in low altitude areas, the risk of PE in pregnant women living in middle altitude and high altitude areas increased by 72% ( OR=1.72, 95% CI: 1.47-2.00; P<0.001) and 100% ( OR=2.00, 95% CI: 1.07-3.74; P=0.030). Conclusion:In the high-altitude environment of Gansu Province, the risk of PE gradually increases with the increase of altitude.