ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics， and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography （UPLC） fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated， and 23 of them were identified and assigned. In 27 batches of Naomaili granules， the mass fractions of 14 components that were stachydrine hydrochloride， leonurine hydrochloride， calycosin-7-O-glucoside， calycosin，tanshinoneⅠ， cryptotanshinone， tanshinoneⅡ_A， ginsenoside Rb₁， notoginsenoside R₁， ginsenoside Rg₁， paeoniflorin， albiflorin， lactiflorin， and salvianolic acid B were found to be 2.902-3.498， 0.233-0.343， 0.111-0.301， 0.07-0.152， 0.136-0.228， 0.195-0.390， 0.324-0.482， 1.056-1.435， 0.271-0.397， 1.318-1.649， 3.038-4.059， 2.263-3.455， 0.152-0.232， 2.931-3.991 mg∙g^-1， respectively. Multivariate statistical analysis showed that paeoniflorin， ginsenoside Rg₁， ginsenoside Rb₁ and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them， salvianolic acid B and ginsenoside Rb₁ had strong anti-inflammatory activity， with IC₅₀ values of （36.11±0.15） mg∙L^-1 and （27.24±0.54） mg∙L^-1， respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out， and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials. Methods: The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group Results: The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group. Conclusion The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

OBJECTIVE To investigate the effects of triptolide （TP） exposure during pregnancy and lactation on the reproductive system development and function in male offspring of rats， providing a reference for medication safety during pregnancy and lactation. METHODS Pregnant rats were randomly divided into control group （12 rats， normal saline） and T1-T4 groups [12， 13， 14， 17 rats that received TP at 200， 400， 600， and 800 μg/（kg·d） respectively]. They were given relevant medicine/normal saline intragastrically， once a day， until the offspring were born and naturally weaned， the intragastric administration volume of each rat was consistently 2 mL. After 60 days of feeding， reproductive organ weights and coefficients were measured in male offspring， testicular and epididymal histology and sperm morphology were observed. Sperm motility， sperm count， and serum levels of gonadotropin-releasing hormone （GnRH）， follicle stimulating hormone （FSH）， luteinizing hormone （LH）， and testosterone （T） in the epididymides were analyzed. Protein expressions of glycogen synthase kinase 3α （GSK3α）， phosphorylated GSK3α （p-GSK3α）， and phosphatase 1γ2 （PP1γ2） in sperm were also determined. RESULTS Compared with the control group， the testicular and epididymal weights， serum levels of GnRH and T， the relative protein expression of PP1γ2 were significantly decreased in T1-T4 groups. Additionally， in the T2 to T4 groups， there were significant reductions in the weight and coefficient of the seminal vesicle， total number of sperm， sperm concentration， sperm motility as well as relative protein expressions of GSKα， p-GSK3α in the offspring rats. Furthermore， the epididymal coefficient in the T3 and T4 groups， the testicular coefficient， mean sperm track velocity and sperm curvature velocity in the T4 group were significantly decreased （P＜ 0.05）； the number of abnormal sperm， rate of sperm abnormality， and levels of FSH and LH in the offspring rats of the T1 to T4 groups were all significantly increased （P＜0.05）； in the offspring rats of the T1 to T4 groups， there was a decrease in the number of epithelial cells in the seminiferous tubules of the testes. Within the epididymal tissue， degenerative and necrotic changes in the epithelial cells were visible， accompanied by mild infiltration of inflammatory cells in the stroma. CONCLUSIONS TP exposure during pregnancy and lactation disrupts reproductive organ development， impairs spermatogenesis and sperm motility， as well as suppresses androgen synthesis in male offspring，thereby having a negative impact on the development of the reproductive system. These effects may be mechanistically linked to regulation of GSK3α， p-GSK3α and PP1γ2 protein expressions.

Poloxamer， as a non-ionic surfactant， exhibits a unique triblock [polyethylene oxide-poly （propylene oxide）-polyethylene oxide] structure， which endows it with broad application potential in various fields， including solid dispersion technology， nanotechnology， gel technology， biologics， gene engineering and 3D printing. As a carrier， it enhances the solubility and bioavailability of poorly soluble drugs. In the field of nanotechnology， it serves as a stabilizer etc.， enriching preparation methods. In gel technology， its self-assembly behavior and thermosensitive properties facilitate controlled drug release. In biologics， it improves targeting efficiency and reduces side effects. In gene engineering， it enhances delivery efficiency and expression levels. In 3D printing， it provides novel strategies for precise drug release control and the production of high-quality biological products. As a versatile material， poloxamer holds promising prospects in the pharmaceutical field.

BACKGROUND:In recent years,numerous studies have found that long non-coding RNA is involved in the occurrence and development of osteoporosis.p38MAPK signaling pathway is involved in the differentiation of bone marrow mesenchymal stem cells,osteoblasts and osteoclasts,and participates in the development of osteoporosis.LncRNA can directly or indirectly participate in the occurrence and development of osteoporosis by affecting the p38MAPK signaling pathway. OBJECTIVE:To review the effect of long non-coding RNA directly or indirectly on the progression of osteoporosis through the p38MAPK signaling pathway,and to provide a new idea for long non-coding RNA in the prevention and treatment of osteoporosis. METHODS:PubMed,CNKI,and Wanfang databases were searched with"long non-coding RNA,osteoporosis,mesenchymal stem cells,osteoblasts,osteoclasts,p38 signaling pathway"as the Chinese and English search terms.Old,repeated and low-credibility views were excluded.The retrieved literature was summarized,summed up,and analyzed.Seventy-six representative articles were selected. RESULTS AND CONCLUSION:(1)Long non-coding RNA participates in the prevention and treatment of osteoporosis through a variety of ways,including promoting the osteogenic differentiation of bone marrow mesenchymal stem cells,promoting the differentiation and secretion activity of osteoblasts,inhibiting the proliferation and bone resorption of osteoclasts,and regulating the activation or inhibition of osteoblast-related cellular pathways.Activation of p38MAPK signaling pathway can delay the progression of osteoporosis,and inhibition of p38MAPK signaling pathway can inhibit the absorption of osteoclasts,thereby affecting the occurrence and development of osteoporosis.(2)The overexpression or low expression of the corresponding long non-coding RNA can affect the proliferation or differentiation of osteoblasts and osteoclasts through the p38MAPK signaling pathway,regulate the process of bone remodeling,and then affect the occurrence and development of osteoporosis.A large number of basic research results show that long non-coding RNA and p38MAPK signaling pathway may be potential application and clinical translation value in the treatment of osteoporosis.Moreover,the corresponding long non-coding RNA overexpression or low expression lentivirus,transfection plasmid,and the corresponding p38MAPK signaling pathway inhibitor have been confirmed to have targeted regulatory effects in vitro cell experiments and animal models.(3)Therefore,targeting long non-coding RNA and p38MAPK signaling pathways to regulate the differentiation and function of bone marrow mesenchymal stem cells or inhibiting the proliferation and differentiation of osteoclasts may provide an innovative therapeutic strategy to delay the progression of osteoporosis.

BACKGROUND:Cervical disc herniation can cause pain in the neck and shoulder area,as well as radiating pain in the upper limbs.The incidence rate is increasing year by year and tends to affect younger individuals.Fully understanding the biomechanical characteristics of the cervical spine in adolescents is of great significance for preventing and delaying the onset of cervical disc herniation in this age group. OBJECTIVE:To reconstruct cervical spine models for both healthy adolescents and adolescent patients with cervical disc herniation utilizing finite element analysis techniques,to analyze the motion range of the C1-T1 cervical vertebrae as well as the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and the cartilage of the small joints. METHODS:A normal adolescent's cervical spine and an adolescent patient with cervical disc herniation were selected in this study.The continuous scan cervical spine CT raw image data were imported into Mimics 21.0 in DICOM format.The C1-T1 vertebrae were reconstructed separately.Subsequently,the established models were imported into the 3-Matic software for disc reconstruction.The perfected models were then imported into Hypermesh software for meshing of the vertebrae,nucleus pulposus,annulus fibrosus,and ligaments,creating valid geometric models.After assigning material properties,the final models were imported into ABAQUS software to observe the joint motion range of the C1-C7 cervical vertebrae segments under different conditions,and to analyze the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and small joint cartilage of each cervical spine segment. RESULTS AND CONCLUSION:(1)In six different conditions,the joint motion range of the C1 vertebra in the cervical spine models of both normal adolescent and adolescent patient with cervical disc herniation was higher than that of the other vertebrae.Additionally,the joint motion range of each cervical spine segment in normal adolescent was greater than that in adolescent patient with cervical disc herniation.(2)In the cervical spine model of normal adolescent,the maximum stress values in the annulus fibrosus and nucleus pulposus were found on the left side during C2-3 flexion conditions(0.43 MPa and 0.17 MPa,respectively).In the cervical spine model of adolescent patient with cervical disc herniation,the maximum stress values were found on the left side during C7-T1 flexion conditions(0.54 MPa and 0.18 MPa,respectively).(3)In the cervical spine model of normal adolescent,the maximum stress value on the endplate was found on the left side of the upper endplate of C3 during flexion conditions(1.46 MPa).In the model of adolescent patient with cervical disc herniation,the maximum stress value on the endplate was found on the left side of the lower endplate of C7 during flexion conditions(1.32 MPa).(4)In the cervical spine model of normal adolescent,the maximum stress value in the small joint cartilage was found in the C2-3 left rotation conditions(0.98 MPa).In adolescent patient with cervical disc herniation,the stress in the small joint cartilage significantly increased under different conditions,especially in C1-2,with the maximum stress found during left flexion(3.50 MPa).(5)It is concluded that compared to normal adolescent,adolescent patient with cervical disc herniation exhibits altered cervical curvature and a decrease in overall joint motion range in the cervical spine.In adolescent with cervical disc herniation,there is a significant increase in stress on the annulus fibrosus,nucleus pulposus,and endplates in the C7-T1 segment.The stress on the left articular cartilage of the C1-2 is notable.Abnormal cervical curvature may be the primary factor causing these stress changes.

BACKGROUND:For thoracolumbar spine fractures with developmental stenosis of the vertebral arch,accurate nail placement is difficult using traditional fluoroscopy-assisted techniques.O-arm navigation assistance systems offer higher precision in general vertebral arch nail placement,but there is scarce literature on the application of O-arm navigation-assisted nail placement in thoracolumbar spine fractures with developmental stenosis of the vertebral arch both domestically and abroad. OBJECTIVE:To explore the accuracy of percutaneous vertebral arch nail placement assisted by O-arm navigation in patients with thoracolumbar spine fractures complicated by developmental stenosis of the vertebral arch. METHODS:A retrospective analysis was conducted on 53 patients who underwent percutaneous vertebral arch screw fixation surgery at Department of Orthopedics,General Hospital of Central Theater Command of PLA for thoracolumbar spine fractures complicated by developmental stenosis of the vertebral arch from January 2021 to March 2023.Totally 208 cases of vertebral arch developmental stenosis were found(cases with multiple vertebral arch developmental stenosis were counted separately).Based on the surgical approach,the patients were divided into two groups:O-arm navigation group(n=98)and C-arm fluoroscopy group(n=110).Postoperative imaging data were compared between the two groups,including anatomical perforation score,functional perforation score,actual vs.expected nail trajectory in the horizontal plane,and sagittal plane angle differences. RESULTS AND CONCLUSION:(1)There was no significant difference in the narrowest width of the pedicle isthmus(pow)between the two groups of patients(P>0.05).The proportions of different degrees of narrowing(mild:6 mm≤pow<7 mm,moderate:5 mm≤pow<6 mm,severe:pow<5 mm)were also not significantly different between the two groups(P>0.05).(2)The overall grade and scores of anatomical perforation and functional perforation were lower in the O-arm group compared to the C-arm group,and these differences were statistically significant(P<0.001).In terms of the angular deviation between the actual and planned screw trajectories,the O-arm group had smaller deviations,and these differences were statistically significant(P<0.05).(3)In the mild and moderate narrowing groups,the O-arm group showed significant advantages in anatomical perforation,functional perforation,and angular deviation between actual and planned screw trajectories,and these differences were statistically significant(P<0.001).(4)The O-arm group demonstrated better performance in anatomical perforation and functional perforation,especially in the T12-L2 segment,with more significant advantages.Additionally,the O-arm group had better angular deviations in actual and planned screw trajectories in all segments compared to the C-arm group.(5)Therefore,the use of O-arm navigation-assisted percutaneous screw placement for the treatment of thoracolumbar fractures with developmental pedicle isthmal narrowing provides higher accuracy and safer surgery.

BACKGROUND:Neurotrophins represent a novel therapeutic approach for spinal cord injury,showing promising clinical applicability.Autophagy modulation is one of the mechanisms by which neurotrophins exert their effects,yet the specific signaling pathways involved remain unclear. OBJECTIVE:To explore how neurotrophin-3(NT-3)modulates autophagy in oligodendrocytes via switching between P75NTR and TrkC receptors and promotes neurological function recovery after spinal cord injury,aiming to further clarify the specific molecular mechanisms involved. METHODS:Twenty-four Sprague-Dawley rats were randomly divided into three groups:sham operation,spinal cord injury,and NT-3 groups.The therapeutic effect of NT-3 on spinal cord injury in rats was evaluated using the Basso,Beattie,and Bresnahan locomotor rating scale.The expression levels of NT-3,Olig1,myelin basic protein,and the autophagy marker LC3B in rat spinal cord tissue were detected by western blot.In a cellular experiment,oligodendrocytes were cultured in vitro and divided into six groups:oxygen-glucose deprivation(OGD),OGD+NT-3,OGD+NT-3+P75NTR plasmid,OGD+NT-3+TrkC plasmid,OGD+3-methyladenine(an autophagy inhibitor),and OGD+rapamycin(an autophagy activator).Oligodendrocyte morphology was observed under a light microscope,cell apoptosis was assessed by TUNEL staining,and the expression of TrkC receptor,P75NTR,LC3B,and the phosphorylation status of the PI3K/AKT/mTOR and AMPK/mTOR signaling pathways were evaluated by western blot. RESULTS AND CONCLUSION:Animal experiments demonstrated that compared with the sham operation group,NT-3 expression significantly increased after spinal cord injury(P<0.05);exogenous NT-3 treatment accelerated neurological function recovery in rats post spinal cord injury(P<0.05)and increased the expression of Olig1 and myelin basic proteins(P<0.05).Cellular experiments revealed that 3 hours marked the early to middle/late phase transition.Compared with the OGD group,oligodendrocytes in the OGD+NT-3 group could maintain their morphology for a longer period of time,TrkC receptor expression was lower in the early phase and significantly upregulated in the middle/late phase(P<0.05),whereas P75NTR protein expression was upregulated in the early phase and downregulated in the middle/late phase(P<0.05),and autophagy levels showed an initial increase followed by a decrease(P<0.05).By comparing the morphology and TUNEL staining results of cells in the OGD+NT-3,OGD+rapamycin,and OGD+3-methyladenine groups,we found that either promoting or inhibiting autophagy alone had adverse effects on oligodendrocyte survival,whereas modulating autophagy in a manner similar to NT-3 could maximally maintain cell survival.NT-3 could promote autophagy in the early phase via the P75NTR/AMPK/mTOR signaling pathway and inhibit autophagy in the later phase through the TrkC/PI3K/AKT/mTOR signaling pathway.Based on these findings,it is concluded that NT-3 can bidirectionally regulate autophagy in oligodendrocytes through the switching of P75NTR/TrkC receptors,thereby maintaining cell survival and facilitating the recovery of neurological functions in rats after spinal cord injury.