ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics， and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography （UPLC） fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated， and 23 of them were identified and assigned. In 27 batches of Naomaili granules， the mass fractions of 14 components that were stachydrine hydrochloride， leonurine hydrochloride， calycosin-7-O-glucoside， calycosin，tanshinoneⅠ， cryptotanshinone， tanshinoneⅡ_A， ginsenoside Rb₁， notoginsenoside R₁， ginsenoside Rg₁， paeoniflorin， albiflorin， lactiflorin， and salvianolic acid B were found to be 2.902-3.498， 0.233-0.343， 0.111-0.301， 0.07-0.152， 0.136-0.228， 0.195-0.390， 0.324-0.482， 1.056-1.435， 0.271-0.397， 1.318-1.649， 3.038-4.059， 2.263-3.455， 0.152-0.232， 2.931-3.991 mg∙g^-1， respectively. Multivariate statistical analysis showed that paeoniflorin， ginsenoside Rg₁， ginsenoside Rb₁ and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them， salvianolic acid B and ginsenoside Rb₁ had strong anti-inflammatory activity， with IC₅₀ values of （36.11±0.15） mg∙L^-1 and （27.24±0.54） mg∙L^-1， respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out， and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials. Methods: The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group Results: The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group. Conclusion The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.

OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

OBJECTIVE To evaluate the cost-effectiveness of cefiderocol versus best available therapy （BAT） or standard-of- care （SOC） for the treatment of confirmed or suspected carbapenem-resistant Gram-negative bacterial （CRGNB） serious infections from the perspective of the Chinese healthcare system， and to explore its reasonable pricing. METHODS A decision tree model was constructed based on data from two phase Ⅲ clinical trials （CREDIBLE-CR and GAME CHANGER） to simulate the cost- effectiveness of cefiderocol in two scenarios： salvage therapy for confirmed CRGNB infection （scenario 1） and empirical therapy for suspected CRGNB infection （scenario 2）. The primary outcome measure was the incremental cost-effectiveness ratio （ICER）. The willingness-to-pay （WTP） was set at 1 to 3 times China’s per capita GDP in 2024. To verify the robustness of the results， one- way and probabilistic sensitivity analyses were conducted， and based on these， a reasonable price range for cefiderocol in the Chinese market was explored. RESULTS The results for scenario 1 showed that the clinical cure rate in the cefiderocol group was higher than that in the BAT group （47.50% vs. 34.21%）， but its ICER was 415 065.03 yuan per cured case， exceeding three times China’s GDP per capita. Scenario 2 revealed that the ICER for cefiderocol relative to SOC was as high as 1 362 446.16 yuan per cured case， far exceeding the WTP. Sensitivity analysis indicated that the treatment duration and price of cefiderocol were key factors affecting its cost-effectiveness. In the two scenarios described above， the unit price of cefiderocol must fall below 683.47 and 242.00 yuan/g， respectively， to be considered cost-effective. CONCLUSIONS Based on the current market price， cefiderocol lacks sufficient cost-effectiveness for treating confirmed or suspected CRGNB serious infections within China’s healthcare system. To improve its accessibility， price negotiations or a tiered medical insurance payment strategy are required.

ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis （KOA） and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization， which can effectively inhibit the progression of pathological inflammatory response， reduce the release of inflammatory pain mediators， and downregulate the protein expression level of transient receptor potential vanilloid 1 （TRPV1）， so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding， Sprague-Dawley （SD） rats were randomly divided into six groups： sham group， model group， celecoxib group， and high， medium， and low-dose synovitis granule groups （9.6， 4.8， 2.4 g·kg^-1）. The administration dose of celecoxib capsules was 20 mg·kg^-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10^th day of the experiment， each administration group was given intragastric administration at a dose of 10 mL·kg^-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold （PPT） to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay （ELISA） was performed to detect the tumor necrosis factor-α （TNF-α）， serum interleukin-1β （IL-1β）， and other pro-inflammatory cytokines in rat serum samples， as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor （NGF） and calcitonin gene-related peptide （CGRP）. Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin （HE） staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1， p38 mitogen-activated protein kinase （p38 MAPK）， and phosphorylated （p）-p38 MAPK in rat knee synovial tissues. Immunofluorescence （IF） was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group， the circumference and joint diameter of the right knee were markedly enlarged in the model group （P<0.01）， while PPTs of rats showed a significant reduction （P<0.01）. The contents of IL-1β， TNF-α， CGRP， and NGF in rats' serum were significantly elevated （P<0.01）， and the synovial Krenn score was increased （P<0.01）. The Mankin score of cartilage tissue was increased （P<0.01）， and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated （P<0.01）. The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population （P<0.01）， and the percentage of M2 macrophages was decreased （P<0.01）. The M1/M2 macrophage ratio was significantly elevated （P<0.01）. Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced （P<0.01） compared with those of the model group， and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious （P<0.05）. The contents of IL-1β， CGRP， and NGF in the rats' serum in all administration groups were significantly reduced （P<0.05， P<0.01）， and the content of TNF-α in rats' serum was significantly reduced （P<0.01）. All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score （P<0.05， P<0.01） and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues （P<0.01）. The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased （P<0.01）. The percentage of M2 macrophages was increased （P<0.05）， and the M1/M2 ratio was decreased （P<0.01）. ConclusionHuamoyan granules can alleviate the inflammatory response of KOA， reduce the release of inflammatory pain mediators， and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway， thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.

In the context of the digital-intelligent era of traditional Chinese medicine （TCM）， the lack of clinical thinking is a pressing issue that limits the overall effectiveness of TCM and talent cultivation. The "disease-pulse-syndrome-treatment differentiation" thinking model， originally developed by ZHANG Zhongjing in the Treatise on Cold Damage and Miscellaneous Diseases （Shang Han Za Bing Lun）， has served as a guideline and paradigm followed by generations of medical practitioners. This study aims to construct a digitalized "disease-pulse-syndrome-treatment differentiation" thinking system， develop a digital assessment system， and implement it for practical application. The goal is to recommend a digitalized assessment model for TCM and provide a reference for the integrated innovation of talent cultivation in medicine， education， and research. First， based on the complex diagnostic and treatment framework of the Treatise on Cold Damage Diseases （Shang Han Lun）， the research team previously established a "process" + "result" thinking model that included four processes and ten steps. This study integrates knowledge unit theory and digital technology to create a digital system for "disease-pulse-syndrome-treatment differentiation" with a dual-control model of "process control" and "result control". The system consists of 46 items across three categories： knowledge body （W=20%）， knowledge element （W=30%）， and knowledge element associations （W=50%）. Second， a mixed-methods research design was employed， combining qualitative and quantitative approaches. The Delphi method was used to establish hierarchical levels and screen items， while the analytic hierarchy process （AHP） was used to assign weights. Expert surveys were conducted to reach a consensus and further validate the rationale and necessity of the system. Finally， based on the system architecture and integrating key computer technologies， a digital assessment system for "disease-pulse-syndrome-treatment differentiation" was developed. The Treatise on Cold Damage Diseases （Shang Han Lun） was used as a case study to validate the system's feasibility. Statistical results showed that the difficulty level of the assessment question bank was moderate （DL ranging from 0.65 to 0.89）， with good discrimination （D>0.4）， and reasonable reliability and validity （Cronbach's α=0.84， KMO=0.72， Bartlett's test P<0.01）. The system can perform process-oriented evaluations of candidates' thinking in "disease-pulse-syndrome-treatment differentiation" and effectively achieve the goal of clinical thinking assessment through a combination of "process control" and "result control". The examination system offers three major advantages. It standardizes， objectifies， and streamlines the assessment of thought processes， facilitates the organic transformation of TCM education from outcome-based education to thinking-based education， and from exam-oriented education to competency-oriented education， and promotes the practical transformation of TCM assessments from qualitative to quantitative evaluation， as well as from theory to practice. In summary， this system not only represents a technological upgrade to traditional examinations but also empowers the cultivation and assessment of clinical talent in the digital-intelligent era， demonstrating broad application prospects.

Thyroid-associated ophthalmopathy(TAO)is a common autoimmune complication in thyroid diseases. Its pathogenesis is complex and involves the abnormal activation of multiple signaling pathways. With the rapid development of molecular biology and genomics technologies, the signal transduction mechanisms and regulatory networks related to TAO have been deeply analyzed. At present, studies have found that the interaction between the TSH receptor(TSHR)and the insulin-like growth factor-1 receptor(IGF-1R)signaling pathway, as well as immune inflammation-related pathways, oxidative stress, and calcium signaling pathways, play important roles in the pathogenesis of TAO. In addition, the research on the regulatory mechanism of non-coding RNA and fibrosis-related signaling molecules has gradually become the focus. Despite much advancement, there are still many unsolved mysteries regarding the exact pathogenesis of TAO. This article aims to systematically review the latest research progress of the main signaling pathways of TAO. By combining the latest achievements in gene expression profiles, single-cell sequencing and drug design, it analyzes potential therapeutic targets and the development directions of innovative drugs, providing a theoretical basis for the pathological mechanism of TAO and a scientific basis for the optimization of clinical treatment strategies at the same time.

Pulmonary hypertension (PH), marked by sustained elevation of pulmonary artery pressure, imposes a heavy burden on the right ventricle and may culminate in right heart failure. Its pathogenesis is multifaceted, encompassing endothelial dysfunction, vascular smooth muscle proliferation, inflammation, thrombosis, and genetic factors. Animal models serve as core tools for exploring PH mechanisms and therapies, each with unique strengths and limitations. The single-dose monocrotaline (MCT) model is one of the most commonly used experimental animal models of PH and is widely applied in mechanistic studies, drug screening, and efficacy evaluation; it offers simplicity and cost-effectiveness, can induce PH within a short period, yet its pathophysiology differs to some extent from human idiopathic PH. In contrast, the Sugen5416 combined with chronic hypoxia model better mimics PH progression by placing animals under hypoxic conditions to induce pulmonary vasoconstriction and vascular remodeling, but it requires a longer modelling time, and the degree of hypoxia has a substantial impact on experimental outcomes. Beyond these two commonly used modeling approaches, a variety of emerging techniques have been applied in PH research; gene-editing technologies enable precise investigation of specific gene functions in PH. Additionally, induced pluripotent stem cell-based 3D organoid technology allows for individualized modelling while preserving patients' genetic information for precise clinical translation. Each model or technology can simulate different aspects of the pathological processes of human PH, and their findings provide key insights into the nature of the disease and serve as an important platform for the development of novel therapeutic targets. This paper comprehensively describes various animal models and emerging technologies used in PH research, analyzing their characteristics, applications, and limitations, with the aim of providing experimental and technical support for the development of new therapeutic strategies and drugs.

ObjectiveTo investigate the mechanism of Xiezhuo Jiedu prescription in the treatment of ulcerative colitis （UC） by inhibiting ferroptosis and alleviating intestinal mucosal injury based on the nuclear factor E₂ related factor 2/solute carrier family 7 member/glutathione peroxidase 4 （Nrf2/SLC7A11/GPX4） signaling pathway. MethodsA total of 60 male SD rats were divided into a normal group， a model group， high- and low-dose Xiezhuo Jiedu prescription groups （26.64 and 13.32 g·kg^-1， respectively）， a ferroptosis inhibitor group （Ferrostatin-1， 0.005 g·kg^-1）， and a mesalazine group （0.27 g·kg^-1）， with 10 rats in each group. A UC rat model was established by intrarectal administration of trinitrobenzene sulfonic acid （TNBS）-ethanol. The normal group and the model group were intragastrically administered normal saline. The other groups were given intragastric administration according to the corresponding dosage for 7 d. The general condition， disease activity index （DAI） score， colon length， and mucosal injury index （CDMI） score were observed in each group. The pathological changes of colon tissue in each group were observed by hematoxylin-eosin （HE） staining. The intestinal mucosa and mitochondrial morphology in each group were observed by transmission electron microscopy. The expression levels of Occludin， Claudin-1， mucin 2 （MUC2）， and E-cadherin in intestinal tissue were detected by immunofluorescence （IF）. Enzyme-linked immunosorbent assay （ELISA） was used to detect the expression levels of serum tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， and interleukin-10 （IL-10） in each group， and a lactic acid assay kit or ELISA was employed to detect the expression levels of reactive oxygen species （ROS）， ferrous ions （Fe²⁺）， glutathione （GSH）， malondialdehyde （MDA）， 4-hydroxynonenal （4-HNE）， diamine oxidase （DAO）， and D-lactate （D-LA）. Real-time quantitative polymerase chain reaction （Real-time PCR） was applied to detect the mRNA expression levels of Nrf2， SLC7A11， GPX4， Occludin， Claudin-1， MUC2， and E-cadherin in each group， and Western blot was adopted to detect the protein expression levels of Nrf2， p-Nrf2， SLC7A11， and GPX4 in each group. ResultsCompared with the normal group， rats in the model group exhibited listlessness， sluggish response， and mucopurulent and bloody stools. The model group also showed significantly increased DAI score， colon length， CDMI score， and expression levels of TNF-α， IL-6， ROS， Fe²⁺， MDA， 4-HNE， DAO， and D-LA （P<0.01）. In addition， it presented significantly decreased IF values of Occludin， Claudin-1， MUC2， and E-cadherin and mRNA and protein expression levels of IL-10， GSH， Nrf2， p-Nrf2， SLC7A11， and GPX4 （P<0.01）. There were different degrees of improvement in each administration group after treatment， and the improvement was the most significant in the high-dose Xiezhuo Jiedu prescription group （P<0.01）. ConclusionXiezhuo Jiedu prescription may alleviate intestinal mucosal injury by inhibiting ferroptosis of intestinal epithelial cells via regulating the Nrf2/SLC7A11/GPX4 signaling pathway， thereby exhibiting efficacy in the treatment of UC.