ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics， and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography （UPLC） fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated， and 23 of them were identified and assigned. In 27 batches of Naomaili granules， the mass fractions of 14 components that were stachydrine hydrochloride， leonurine hydrochloride， calycosin-7-O-glucoside， calycosin，tanshinoneⅠ， cryptotanshinone， tanshinoneⅡ_A， ginsenoside Rb₁， notoginsenoside R₁， ginsenoside Rg₁， paeoniflorin， albiflorin， lactiflorin， and salvianolic acid B were found to be 2.902-3.498， 0.233-0.343， 0.111-0.301， 0.07-0.152， 0.136-0.228， 0.195-0.390， 0.324-0.482， 1.056-1.435， 0.271-0.397， 1.318-1.649， 3.038-4.059， 2.263-3.455， 0.152-0.232， 2.931-3.991 mg∙g^-1， respectively. Multivariate statistical analysis showed that paeoniflorin， ginsenoside Rg₁， ginsenoside Rb₁ and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them， salvianolic acid B and ginsenoside Rb₁ had strong anti-inflammatory activity， with IC₅₀ values of （36.11±0.15） mg∙L^-1 and （27.24±0.54） mg∙L^-1， respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out， and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials. Methods: The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group Results: The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group. Conclusion The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.

The Medical Cases of WU Jutong （《吴鞠通医案》） proposes the principle of "treating all Bi （痹） diseases through taiyin"， which forms the basis for analyzing WU Jutong's understanding of the causes， mechanisms， and treatments of Bi （痹） diseases， providing a reference for clinical diagnosis and treatment. Through an interpretation of the phrase "treating all Bi （痹） diseases through taiyin"， it is suggested that Bi （痹） diseases is primarily caused by dampness， necessitating a focus on spleen and lung in treatment. WU emphasized four main causes of Bi （痹） diseases （wind， cold， dampness， and heat）， with dampness being the predominant factor. The disease location is initially in lung， for which external dampness invades lung first， and internal dampness obstructs the source of water metabolism， impeding lung qi and qi failing to disperse， then dampness further accumulates in the joints， leading to Bi （痹） diseases. WU Jutong proposed the modified Mufangji Decoction （木防己汤） as the foundational prescription for treating Bi （痹） diseases. By comparing the similarities and differences between the modified and original Mufangji Decoction， and analyzing the adjustments in herbal prescriptions， the clinical characteristic of "treating all Bi （痹） diseases through taiyin" is further substantiated.

ObjectiveTo explore the clinical efficacy and safety of Da Chaihutang （DCH） for the treatment of sepsis with Yang syndrome. MethodsA total of 70 patients suffering from sepsis with Yang syndrome were randomly divided into an observation group and a control group， with 35 cases in each group. They both received standard Western medicine treatment. The observation group was additionally given a dose of DCH， which was boiled into 100 mL and taken twice. The control group was additionally given an equal volume and dosage of warm water. The intervention lasted for three days. The 28-day all-cause mortality and the changes in the following indicators before and after intervention were compared between the two groups， including sequential organ failure assessment （SOFA）， acute physiology and chronic health evaluation Ⅱ （APACHE Ⅱ） score，white blood cell （WBC），the percentage of neutrophils （NEU%），C-reactive protein （CRP），procalcitonin （PCT），alanine transaminase （ALT），aspartate transaminase （AST），total bilirubin （TBil），creatinine （Cr），blood urea nitrogen （BUN），acute gastrointestinal injury （AGI） grade，gastrointestinal dysfunction score （GDS），serum intestinal fatty acid-binding protein （iFABP）， citrulline （CR），platelet （PLT），prothrombin time（PT），activated partial thromboplastin time （APTT），fibrinogen （Fib），international normalized ratio （INR），and D-dimer （D-D）. ResultsThere was no significant difference between the two groups regarding 28-day all-cause mortality. After the intervention，SOFA，WBC，PCT，and Cr were significantly decreased， and PLT was significantly increased in the control group （P<0.05）. SOFA，APACHE Ⅱ，NEU%，CRP，PCT，ALT，AST，Cr，BUN，AGI grade，GDS，and serum iFABP and CR were significantly improved in the observation group （P<0.05）. After the intervention，APACHE Ⅱ，PCT，AGI grade，GDS，and serum iFABP in the observation group were significantly lower than those in the control group ，while CR and PLT were higher （P<0.05，P<0.01）. There were significant differences regarding the gap of SOFA，APACHE Ⅱ，AST，TBil，AGI grade，GDS，iFABP，CR， and PLT between the two groups （P<0.05，P<0.01）. There were slight differences regarding PT，APTT，Fib，INR，and D-D between the two groups，which were in the clinical normal range. ConclusionOn the basis of Western medicine， DCH helped to reduce sepsis severity and improved multiple organ dysfunction with high clinical efficacy and safety， but further research on its impact on the prognosis of patients with sepsis is still required.

ObjectiveTo explore the potential mechanism of Xiezhuo Jiedu prescription in regulating autophagy in the treatment of ulcerative colitis （UC） by bioinformatics and animal experiments. MethodsThe differentially expressed genes （DEGs） in the colonic mucosal tissue of UC patients was obtained from the Gene Expression Omnibus （GEO）， and those overlapped with autophagy genes were obtained as the differentially expressed autophagy-related genes （DEARGs）. DEARGs were imported into Metascape and STRING， respectively， for gene ontology/Kyoto Encyclopedia of Genes and Genomics （GO/KEGG） enrichment analysis and protein-protein interaction （PPI） analysis. Finally， 15 key DEARGs were obtained. The core DEARGs were obtained by least absolute shrinkage and selection operator （LASSO） regression and receiver operating characteristic curve （ROC） analysis. The CIBERSORT deconvolution algorithm was used to analyze the immunoinfiltration of UC patients and the correlations between core DEARGs and immune cells. C57BL/6J mice were assigned into a normal group and a modeling group. The mouse model of UC was established by free drinking of 2.5% dextran sulfate sodium. The modeled mice were assigned into low-， medium-， and high-dose Xiezhuo Jiedu prescription and mesalazine groups according to the random number table method and administrated with corresponding agents by gavage for 7 days. The colonic mucosal morphology was observed by hematoxylin-eosin staining. The protein and mRNA levels of cysteinyl aspartate-specific proteinase 1 （Caspase-1）， cathepsin B （CTSB）， C-C motif chemokine-2 （CCL2）， CXC motif receptor 4 （CXCR4）， and hypoxia-inducing factor-1α （HIF-1α） in the colon tissue were determined by Western blot and real-time fluorescence quantitative polymerase chain reaction， respectively. ResultsThe dataset GSE87466 was screened from GEO and interlaced with autophagy genes. After PPI analysis， LASSO regression， and ROC analysis， the core DEARGs （Caspase-1， CCL2， CTSB， and CXCR4） were obtained. The results of immunoinfiltration analysis showed that the counts of NK cells， M0 macrophages， M1 macrophages， and dendritic cells in the colonic mucosal tissue of UC patients had significant differences， and core DEARGs had significant correlations with these immune cells. This result， combined with the prediction results of network pharmacology， suggested that the HIF-1α signaling pathway may play a key role in the regulation of UC by Xiezhuo Jiedu prescription. The animal experiments showed that Xiezhuo Jiedu prescription significantly alleviated colonic mucosal inflammation in UC mice. Compared with the normal group， the model group showed up-regulated protein and mRNA levels of caspase-1， CCL2， CTSB， CXCR4， and HIF-1α， which were down-regulated after treatment with Xiezhuo Jiedu prescription or mesalazine. ConclusionCaspase-1， CCL2， CTSB， and CXCR4 are autophagy genes that are closely related to the onset of UC. Xiezhuo Jiedu prescription can down-regulate the expression of core autophagy genes to alleviate the inflammation in the colonic mucosa of mice.

Cardiovascular diseases （CVD），a group of common diseases in clinical practice，are witnessing a steady rise in both incidence and mortality rates，posing a challenge to public health. Gualou Xiebai Banxiatang，originating from Synopsis of the Golden Chamber （《金匮要略》），was initially used to treat severe cases of chest impediment. The formula consists of Trichosanthis Fructus，Allii Macrostemonis Bulbus，Pinelliae Rhizoma，and Baijiu. It has a wide range of clinical applications，with therapeutic effects including moving Qi to relieve depression，activating Yang to dissipate mass，and expelling phlegm to alleviate chest congestion. In recent years，clinical research has confirmed that Gualou Xiebai Banxiatang，with or without modification，used alone or in combination with Western medicine，has definite effects in the treatment of CVD such as hyperlipidemia，coronary atherosclerotic heart disease，hypertension，heart failure，and arrhythmia. It can alleviate disease symptoms and reduce the risk of re-hospitalization. Basic research indicates that the mechanisms of Gualou Xiebai Banxiatang include improving endothelial functions，exhibiting anti-inflammatory properties，countering oxidative stress，preventing apoptosis，inhibiting ventricular remodeling，regulating mitochondrial functions，improving hemorheology，and modulating autophagy and neurotransmitters. This article reviews relevant articles in recent years with focuses on the compatibility，clinical application，and mechanism of Gualou Xiebai Banxiatang. This review is expected to provide a theoretical basis for the mechanism research and clinical application of this formula in treating CVD and to offer ideas and reference for in-depth research.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Neoadjuvant therapy has become the standard treatment for locally advanced resectable esophageal cancer, significantly improving long-term survival compared to surgery alone. Neoadjuvant therapy has evolved to include various strategies, such as concurrent chemoradiotherapy, chemotherapy, immunotherapy, or targeted combination therapy. This enriches clinical treatment options and provides a more personalized and scientific treatment approach for patients. This article aims to comprehensively summarize current academic research hot topics, review the rationale and evaluation measures of neoadjuvant therapy, discuss challenges in restaging methods after neoadjuvant therapy, and identify the advantages and disadvantages of various neoadjuvant therapeutic strategies.

This comprehensive review systematically explores the multifaceted applications, inherent challenges, and promising future directions of artificial intelligence (AI) within the medical domain. It meticulously examines AI's specific contributions to basic medical research, disease prevention, intelligent diagnosis, treatment, rehabilitation, nursing, and health management. Furthermore, the review delves into AI's innovative practices and pivotal roles in clinical trials, hospital administration, medical education, as well as the realms of medical ethics and policy formulation. Notably, the review identifies several key challenges confronting AI in healthcare, encompassing issues such as inadequate algorithm transparency, data privacy concerns, absent regulatory standards, and incomplete risk assessment frameworks. Looking ahead, the future trajectory of AI in healthcare encompasses enhancing algorithm interpretability, propelling generative AI applications, establishing robust data-sharing mechanisms, refining regulatory policies and standards, nurturing interdisciplinary talent, fostering collaboration among industry, academia, and medical institutions, and advancing inclusive, personalized precision medicine. Emphasizing the synergy between AI and emerging technologies like 5G, big data, and cloud computing, this review anticipates a new era of intelligent collaboration and inclusive sharing in healthcare. Through a multidimensional analysis, it presents a holistic overview of AI's medical applications and development prospects, catering to researchers, practitioners, and policymakers in the healthcare sector. Ultimately, this review aims to catalyze the deep integration and innovative deployment of AI technology in healthcare, thereby driving the sustainable advancement of smart healthcare.