ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics， and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography （UPLC） fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated， and 23 of them were identified and assigned. In 27 batches of Naomaili granules， the mass fractions of 14 components that were stachydrine hydrochloride， leonurine hydrochloride， calycosin-7-O-glucoside， calycosin，tanshinoneⅠ， cryptotanshinone， tanshinoneⅡ_A， ginsenoside Rb₁， notoginsenoside R₁， ginsenoside Rg₁， paeoniflorin， albiflorin， lactiflorin， and salvianolic acid B were found to be 2.902-3.498， 0.233-0.343， 0.111-0.301， 0.07-0.152， 0.136-0.228， 0.195-0.390， 0.324-0.482， 1.056-1.435， 0.271-0.397， 1.318-1.649， 3.038-4.059， 2.263-3.455， 0.152-0.232， 2.931-3.991 mg∙g^-1， respectively. Multivariate statistical analysis showed that paeoniflorin， ginsenoside Rg₁， ginsenoside Rb₁ and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them， salvianolic acid B and ginsenoside Rb₁ had strong anti-inflammatory activity， with IC₅₀ values of （36.11±0.15） mg∙L^-1 and （27.24±0.54） mg∙L^-1， respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out， and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials. Methods: The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group Results: The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group. Conclusion The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors （DTIs） in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital （the Affiliated Hospital of UESTC）， a multidisciplinary working group was established. Through literature review and the Delphi method， clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework； systematic searches were conducted in CNKI， Medline， Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment，Development and Evaluation （GRADE） approach， and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations （each with an expert consensus rate exceeding 90%） on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection， dosing ranges， key monitoring points， and safety management strategies for parenteral DTIs in various scenarios， including the perioperative period of ventricular assist device implantation， the perioperative period of cardiac surgery， perioperative patients with lower-extremity atherosclerotic disease， the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome， the perioperative period of carotid artery stenting in patients with carotid stenosis， the perioperative period of patients with right heart thrombosis， and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition， warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus， which is formulated based on the best available evidence， provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.

Background Work-related musculoskeletal disorders (WMSDs) are a major occupational health concern, particularly among workers exposed to adverse ergonomic conditions. Manganese production involves heavy physical demands, yet research on WMSDs among manganese workers remains limited. Objective To investigate the prevalence and influencing factors of WMSDs among manganese workers in a manganese enterprise in Guangxi. Methods A cross-sectional survey was conducted from May to June 2024 on workers at a manganese factory in Guangxi. The Chinese Musculoskeletal Disorders Questionnaire was used to collect information on demographic characteristics, distribution of musculoskeletal symptoms, and work-related exposures. χ² test was applied to compare differences in positive WMSDs rates across groups, and logistic regression analysis was performed to identify associated factors. Results A total of 1476 workers were enrolled in the study after pre-determined inclusion and exclusion criteria. The overall prevalence of WMSDs was 34.15%. The most commonly affected body regions were the lower back (17.28%), neck (16.67%), and shoulders (13.82%). The results of logistic regression analysis indicated that female, older age, and education level of college or above were associated with a higher risk of WMSDs (P<0.05). Awkward working postures were significantly associated with WMSDs in corresponding body regions; in particular, awkward postures of the neck, upper limbs, trunk, and lower limbs were related to an increased risk of WMSDs in multiple body sites (P<0.05). In addition, poor lighting conditions, high workplace temperature, frequent or sustained arm support during work, and high job demands were associated with an increased risk of overall or site-specific WMSDs (P<0.05). Conclusion The high prevalence of WMSDs among manganese workers is closely associated with demographic characteristics, working postures, and work environment and organizational factors. Targeted ergonomic interventions focusing on high-risk body regions and key ergonomic exposures are warranted to reduce the risk of WMSDs among manganese workers.

ObjectiveTo analyze the characteristics of 150 patients with spinal cord injury complicated with spasticity. MethodsA cross-sectional survey was conducted on 150 patients with spinal cord injury accompanied by spasticity from September, 2019 to December, 2024. Their age, gender, cause of injury, injury site, severity of injury, spasticity severity and other indicators were recorded. The relationships between different characteristics were analyzed, and a correlation analysis of disease duration, spasticity grade, injury level, injury severity and age were conducted. ResultsThere was no significant difference in age distribution between patients with tetraplegia and paraplegia (Z = 0.806, P = 0.420). The proportions of trauma (χ² = 3.982, P = 0.046) and tetraplegia (χ² = 10.559, P = 0.010) were higher in males than in females. Trauma was the main cause of injury in both tetraplegia and paraplegia patients; the proportion of tetraplegia was higher than paraplegia in trauma patients, while paraplegia was higher than tetraplegia in non-trauma patients (χ² = 11.885, P < 0.001). Patients with tetraplegia was dominated by incomplete injury, whereas patients with paraplegia was dominated by complete injury (χ² = 10.885, P = 0.012). Grade A injury was predominant in trauma patients (P = 0.003). Spasticity grade showed a very weak positive correlation with disease duration (r = 0.175, P = 0.032) and age (r = 0.168, P = 0.040). Injury severity showed a very weak positive correlation with age (r = 0.183, P = 0.025). ConclusionCharacteristics of patients with spinal cord injury complicated with spasticity is different with gender, cause of injury, injury level, injury severity.

ObjectivePost-ischemic acute inflammation and the subsequent persistent dysregulation of the immune microenvironment represent major pathological drivers that aggravate neuronal injury and severely restrict functional recovery following ischemic stroke. Although current reperfusion therapies partially restore blood flow, they fail to effectively modulate the secondary inflammatory cascade and oxidative stress, which remain critical barriers to neurological restoration. To address this challenge, this study aimed to engineer and systematically evaluate a biomimetic nanosystem composed of transforming growth factor-β1 (TGF-β1)-loaded platelet membrane-camouflaged lipid nanoparticles (PLP). This nanosystem was designed to achieve dual lesion-targeted delivery and immune microenvironment remodeling. By verifying its spatiotemporal accumulation, anti-inflammatory activity, and neuroprotective efficacy, we sought to establish an integrated therapeutic strategy that simultaneously enables lesion targeting, immune regulation, and functional recovery after ischemic injury. MethodsThe physicochemical properties of PLP, including hydrodynamic particle size, zeta potential, structural stability, and morphology, were characterized using dynamic light scattering, zeta potential analysis, and transmission electron microscopy. The preservation of platelet membrane-derived adhesion and immunoregulatory proteins was confirmed by SDS-PAGE through comparative analysis of protein band profiles between PLP and native platelet membranes. The in vitro biological activities of PLP were evaluated using two complementary cellular models. LPS-induced M1-polarized RAW264.7 macrophages were employed to assess inflammatory modulation, while oxygen glucose deprivation/reperfusion (OGD/R)-induced BV2 microglial cells and SH-SY5Y neuronal cells were utilized to investigate neuroinflammatory regulation and neuronal protection. For in vivo validation, a transient middle cerebral artery occlusion (tMCAO) mouse model was established to mimic ischemia-reperfusion injury. The spatiotemporal biodistribution and lesion-targeting capability of the PLP were monitored through live fluorescence imaging. Therapeutic efficacy was comprehensively evaluated by triphenyltetrazolium chloride (TTC) staining, glial fibrillary acidic protein (GFAP) immunofluorescence analysis, body weight monitoring, and neurological severity score (NSS) assessment. ResultsPLP nanoparticles displayed a uniform spherical morphology, nanoscale particle size distribution, and stable negative surface charge, indicating favorable colloidal stability and circulation potential. SDS-PAGE results confirmed the effective retention of key platelet membrane proteins associated with endothelial adhesion, immune evasion, and inflammatory regulation, demonstrating the successful biomimetic construction. Optimal therapeutic concentrations were determined in OGD/R-induced BV2 cells, where PLP exhibited excellent cytocompatibility and anti-inflammatory activity.In vitro experiments demonstrated that PLP significantly inhibited the polarization of RAW264.7 macrophages toward the pro-inflammatory M1 phenotype and markedly reduced neuronal apoptosis under ischemia-reperfusion conditions. In vivo fluorescence imaging revealed that PLP rapidly accumulated in the ischemic brain hemisphere and maintained prolonged retention for up to 7 d, suggesting enhanced lesion-specific targeting and sustained drug release. Compared with control group, PLP treatment significantly reduced cerebral infarct volume, attenuated reactive astrogliosis, improved weight recovery, and accelerated neurological functional restoration, as reflected by significantly improved NSS scores. ConclusionThis study establishes a multifunctional biomimetic nanoplatform that integrates platelet membrane-mediated active targeting with the anti-inflammatory, antioxidative, and neuroprotective properties of TGF-β1. The PLP system enables rapid lesion homing and long-term retention while synergistically regulating the post-stroke inflammatory microenvironment by suppressing pro-inflammatory immune activation, reducing neuronal apoptosis, and limiting excessive astrocyte reactivity. Importantly, this study proposes a conceptually therapeutic paradigm that combines targeted delivery with immune microenvironment remodeling to achieve comprehensive neurovascular protection. These findings provide strong experimental evidence supporting the translational potential of biomimetic nanotherapeutics as next-generation precision interventions for ischemic stroke.

ObjectiveDonkey hide is the sole legally designated raw material for the preparation of the traditional Chinese medicine Ejiao. The quality stability of donkey hide during preservation directly determines the efficacy and safety of Ejiao. This study focuses on the dynamic succession of microbial communities during the preservation of donkey hides from different origins, aiming to clarify the correlation between microbial biodiversity difference and the degradation profiles of hide collagen and critical biochemical components, thereby providing a theoretical foundation for developing targeted preservation strategies based on microbial regulation. MethodsDonkey hides originating from four different regions were subjected to an accelerated microbial aging assay to simulate the spoilage process. The microbial community succession was analyzed using high-throughput sequencing. Microstructure changes and pore structure characteristics were assessed by scanning electron microscopy and mercury intrusion porosimetry, respectively. Additionally, the content of major components, including lipids, proteins, and sugars were determined by biochemical methods. ResultsAfter 96 h of aging, the collagen fiber structure in Africa donkey hides (ADH) exhibited significant degradation and collapse, followed by Xinjiang donkey hides (XDH). Instead, the microstructure of Dong’e black donkey hides (DDH) and Peru donkey hides (PDH) remained relatively intact. The porosities of DDH, XDH, PDH, and ADH increased from 27.9%, 15.7%, 30.3%, and 46.2% to 36.5%, 52.6%, 42.8%, and 57.7%, respectively, during the aging process, which suggested that the originally compact fiber structure was disrupted by microbial aging. Fourier transform infrared spectrometer analysis revealed the amide bands in XDH exhibited relatively weak intensity, and no collagen amide I band was observed in ADH. Meanwhile, the lipid and protein contents decreased in all four types of donkey hides, indicating that these components served as the primary nutrient sources for the growth of microorganism. Notably, the most severe collagen degradation was observed in XDH and ADH. A substantial increase was detected in the total soluble sugar in PDH aging solution and hydroxyproline in the ADH aging solution, respectively. These results indicated that donkey hides exhibit distinct patterns of structural degradation and nutrient utilization. Furthermore, the viable cells number of donkey hides increased sharply after 48 h of aging. Metagenomic analysis revealed that the relative abundance of Euryarchaeota in ADH, PDH and XDH declining from initial 93.19%, 97.73% and 30.08% to 0.79%, 1.43% and 0.02% after 96 h, respectively. Conversely, a significantly increase was observed in the abundance of Bacillota, with a marked increase in ADH, peaking at 92.75%. Additionally, the abundance of Pseudomonadota in PDH increased from 0.10% to 87.84%, suggesting that Bacillota and Pseudomonadota may be key factors exacerbating donkey hide spoilage. Unlike the other three types of donkey hides, the dominant bacterial phylum in DDH shifted from Pseudomonadota to Bacteroidota, characterized by a substantial abundance increase of Bacteroidota from 0.13% to 44.22%. ConclusionRegional variation in origin significantly influence the microbial aging of donkey hides, leading to distinct patterns of structural deterioration and differential nutrient utilization. Therefore, implementing origin-specific preservation strategies, through the precisely controlling environmental factors to suppress harmful phyla such as Bacillota and Pseudomonadota, is crucial for enhancing the storage quality of donkey hides.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.