AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.

OBJECTIVE: To explore the methods, fixation points, and effectiveness of staged therapy using external fixation frame in treatment of infectious nonunion near knee joint. METHODS: A retrospective analysis was conducted on the clinical data of 60 patients with infectious nonunion near knee joint, who underwent staged therapy using external fixation frame between June 2021 and June 2024 and were followed up. There were 48 males and 12 females with an average age of 47.9 years (range, 16-70 years). The disease duration ranged from 9 months to 20 years, with a median of 14 months. Among them, 21 cases of infectious nonunion located in the distal femur, 36 cases in the proximal tibia, and 3 cases in the patella; 12 cases exhibited segmental bone defects (≥4 cm), while 48 cases presented with localized bone defects (<4 cm). Osteomyelitis was classified using the Cierny-Mader system, with 3 cases classified as type Ⅰ, 6 cases as type Ⅱ, 35 cases as type Ⅲ, and 16 cases as type Ⅳ. Preoperative C-reactive protein levels ranged from 15.1 to 55.8 mg/L (mean, 36.4 mg/L). The erythrocyte sedimentation rate was 35-80 mm/1 h (mean, 56.9 mm/1 h). The Hospital for Special Surgery (HSS) score for knee joint was 69.3±17.7 and the range of motion was (70.61±40.60)°. After debridement and placement of antibiotic carriers at the first-stage operation, unilateral orbital frames ( n=14), combined frames ( n=27), or Ilizarov frames ( n=19) were used for cross joint fixation ( n=9) or joint preservation fixation ( n=51). After 6-8 weeks of infection control, the bone grafting or bone transport was performed at the second-stage operation based on the type of bone defect, with internal fixation employed as an adjunct if necessary. After operation, the infection control and fracture healing were observed and the bone healing time was recorded. The knee joint function was assessed using the HSS score, and the knee joint range of motion was measured as well as the angle of motion loss. Patients were grouped according to the site of nonunion, type of external fixation frame, and fixation method. The bone healing time, change value of HSS score, and knee joint range of motion loss (difference between pre- and post-operation) were compared between groups. RESULTS: All infection markers returned to the normal range within 6 weeks after the first-stage operation. All patients were followed up 12-48 months (mean, 22.0 months) after the second-stage operation. There were 5 cases of needle tract infection during the external fixation period, and 3 cases of infection recurrence after the second-stage operation, all of which were cured after symptomatic treatment. The bone healing time was 6-18 months (mean, 11.0 months). At last follow-up, the HSS score was 88.5±7.9 and the range of motion was (61.84±40.59)°, with significant differences compared to preoperative values ( P<0.05); the knee joint range of motion loss was (8.77±11.07)°. The bone healing time was significantly longer in the distal femur group than in the proximal tibia group ( P<0.05), and in the unilateral orbital frames group than in the Ilizarov frames group and the combined frames group ( P<0.05). The angle of motion loss was significantly larger in the Ilizarov frames group than in the unilateral orbital frames group and the combined frames group ( P<0.05). The change value of HSS score was significantly higher in the cross joint fixation group than in the joint preservation fixation group ( P<0.05). CONCLUSION During the first-stage operation, debridement is performed and antibiotic carriers are placed to control infection. External fixation frames are then precisely positioned based on the distance between the lesion and the joint surface, avoiding the infected wound while ensuring mechanical balance. During the second-stage operation, bone grafting options are selected according to the extent of bone defects to enhance the bone union. Postoperative early functional exercises of the knee joint are permitted to improve joint function.
Humans ; Male ; Female ; Middle Aged ; Adult ; Fractures, Ununited/surgery* ; Retrospective Studies ; External Fixators ; Aged ; Knee Joint/surgery* ; Adolescent ; Young Adult ; Treatment Outcome ; Osteomyelitis/surgery* ; Fracture Fixation/instrumentation* ; Bone Transplantation ; Tibial Fractures/surgery*

OBJECTIVE: To explore the effectiveness of primary interventional revascularization combined with secondary perforator composite flap in the treatment of peripheral arterial disease (PAD) accompanied by soft tissue defects around the ankle. METHODS: Between January 2022 and January 2025, 12 patients with PAD and soft tissue defects around the ankle were admitted. Among them, there were 9 males and 3 females; their ages ranged from 52 to 82 years, with an average of 68.9 years. The causes of injury included 4 cases of traffic accident, 5 cases of falls, 1 case of falling from height, 1 case of foreign body puncture injury, and 1 case of electric shock injury. The infection duration ranged from 1 month to 35 years, with a median duration of 3.5 months. The wound size ranged from 5.5 cm×3.0 cm to 15.0 cm×9.0 cm. The ankle-brachial index (ABI) was 0.32±0.12. The visual analogue scale (VAS) score for pain was 3.3±0.5. Preoperative vascular stenosis assessment was performed in all patients, with primary intervention to dredge large and medium-sized arteries, followed by secondary repair of the wound using a perforator composite flap. The flap size ranged from 6.5 cm×4.0 cm to 16.0 cm×10.0 cm. The donor sites were sutured directly or repaired with skin grafts. After two stages of treatment, the effectiveness was evaluated by measuring ABI, observing flap survival and wound healing, assessing VAS scores, and American Orthopedic Foot and Ankle Society (AOFAS) scores. RESULTS: All 12 cases completed two stages of treatment; all patients were followed up after the second-stage treatment, with a follow-up period ranging from 7 to 28 months, with an average of 16.8 months. After the first-stage treatment, the skin temperature around the ankle was significantly higher than that before treatment, and the ABI increased to 0.71±0.07, with a significant difference ( t=9.918, P<0.001). After the second-stage treatment, the blisters on the distal end of the skin flap occurred in 3 cases. The flaps survived and the wounds healed, with a healing time ranging from 10 to 14 days (mean, 11.8 days). The incisions at the donor site healed by first intention, and the skin grafts survived. The VAS score was 0.5±0.5 at 3 weeks, which was significantly lower than that before treatment ( t=13.675, P<0.001). No infection recurrence occurred during follow-up. At 6 months after the second-stage treatment, the AOFAS score of the ankle joint ranged from 92 to 97, with an average of 94.7, all reaching excellent. CONCLUSION Interventional revascularization combined with perforator composite flap for staged treatment of PAD with ankle soft tissue defects can obtain good effectiveness, by unclogging the main blood vessels, improving lower limb blood supply, and improving the survival rate of the skin flap.
Humans ; Male ; Female ; Middle Aged ; Aged ; Peripheral Arterial Disease/surgery* ; Soft Tissue Injuries/surgery* ; Perforator Flap/blood supply* ; Plastic Surgery Procedures/methods* ; Aged, 80 and over ; Ankle/blood supply* ; Treatment Outcome ; Ankle Brachial Index ; Skin Transplantation/methods*

OBJECTIVE: To compare clinical efficacy of tibial transverse transport (TTT) microcirculation reconstruction and periosteal distraction in treating patients with early diabetic foot(DF). METHODS: From June 2021 to June 2024, 60 patients with DF were admitted and divided into bone transport group and stretch group according to different treatment methods. There were 30 patients in bone transport group, including 16 males and 14 females;aged from 48 to 65 years old with an average of (55.59±3.78) years old;the course of disease ranged from 2 to 9 months with an average of(5.95±1.32) months;TTT microcirculation reconstruction surgery was performed. There were 30 patients in distraction group, including 17 males and 13 females;aged from 47 to 67 years old with an average of (55.24±3.81) years old;the course of disease ranged from 2 to 10 months with an average of (5.68±1.54) months;periosteal distraction surgery was performed. The skin temperature of the affected feet, the time of getting out of bed and walking after operation, the time of full weight-bearing, the wound healing time and complications were compared between two groups;the pain was evaluated by visual analogue scale (VAS) before operation and one month after operation respectively;the changes of blood flow velocity of dorsal foot arteries, ankle brachial index(ABI), epidermal growth factor (EGF), and basic fibroblast growth factor (bFGF) before and after operation at 3 months were compared between two groups. RESULTS: All patients were followed up for 3 to 4 months with an average of (3.52±0.12) months. There were no statistically significant differences in comparison of foot skin temperature, postoperative walking time, full weight-bearing time and complications between two groups (P>0.05). The wound healing time of bone transport group (61.26±7.31) days was shorter than that of distraction group (70.17±7.15) days, and the difference was statistically significant (P<0.05). Postoperative VAS at 1 month of bone transport group (2.19±0.21) was lower than that of distraction group (2.55±0.20), and the difference was statistically significant (P<0.05). At 3 months after operation, the blood flow velocity of dorsal foot artery, ankle-brachial index, EGF and bFGF in bone transport group were(34.73±4.18) cm·s^-1, (0.95±0.13), (716.61±71.13) pg·ml^-1 and (175.69±31.28) pg·ml^-1, respectively;which were higher than that of distraction group (31.86±3.23) cm·s^-1, (0.84±0.11), (677.37±70.21) pg·ml^-1, (149.26±30.13) pg·ml^-1, and the differences were statistically significant (P<0.05). There was no recurrence of ulcers in situ or at other sites in both groups during follow-up. CONCLUSION Compared with periosteal distraction, TTT microcirculation reconstruction surgery has a definite effect in the treatment of early DF. It could effectively reduce pain level, improve blood flow indicators and vascular endothelial function of the foot, and has a relatively high safety.
Humans ; Male ; Female ; Middle Aged ; Aged ; Tibia/blood supply* ; Diabetic Foot/physiopathology* ; Microcirculation ; Periosteum/surgery* ; Plastic Surgery Procedures/methods* ; Osteogenesis, Distraction

Local anesthetics (LAs), such as articaine (AT), exhibit limited efficacy in inflammatory environments, which constitutes a significant limitation in their clinical application within oral medicine. In our prior research, we developed AT-17, which demonstrated effective properties in chronic inflammatory conditions and appears to function as a novel oral LA that could address this challenge. In the present study, we further elucidated the beneficial effects of AT-17 in acute inflammation, particularly in oral acute inflammation, where mitochondrial-related apoptosis played a crucial role. Our findings indicated that AT-17 effectively inhibited lipopolysaccharide (LPS)-induced nerve cell apoptosis by ameliorating mitochondrial dysfunction in vitro. This process involved the inhibition of mitochondrial reactive oxygen species (mtROS) production and the subsequent activation of the NRF2 pathway. Most notably, improvements in mitochondria-related apoptosis were key contributors to AT-17's inhibition of voltage-gated sodium channels. Additionally, AT-17 was shown to reduce mtROS production in nerve cells through the Na⁺/NCLX/ETC signaling axis. In conclusion, we have developed a novel local anesthetic that exhibits pronounced anesthetic functionality under inflammatory conditions by enhancing mitochondria-related apoptosis. This advancement holds considerable promise for future drug development and deepening our understanding of the underlying mechanisms of action.

BACKGROUND:Neuroinflammation is a major cause of exacerbation after spinal cord injury.In recent years,pyroptosis has received much attention due to its remarkable pro-inflammatory features.Some of these natural products can significantly inhibit the inflammatory response and improve the damaged nerve function by regulating the level of pyroptosis after spinal cord injury,which provides a new therapeutic idea for spinal cord injury.OBJECTIVE:To summarize the mechanism of action of natural products in regulating pyroptosis for the treatment of spinal cord injury,with a view to providing lessons and references for future research on the treatment of spinal cord injury.METHODS:The search terms"spinal cord injury,pyroptosis,inflammasome,natural products,natural compounds,traditional Chinese medicine"in Chinese and English were used to search for relevant literature since the establishment of the database up to September 2024 in the databases of PubMed,Web of Science,WanFang,and CNKI.According to the inclusion and exclusion criteria,75 relevant articles were finally obtained.RESULTS AND CONCLUSION:(1)Pyroptosis is an important pro-inflammatory pathway in spinal cord injury,and controlling pyroptosis is an effective way to improve damaged nerve function.(2)Some natural products can regulate pyroptosis via the NLRP3/Caspase-1 classical pyroptosis pathway,the NF-κB-related pathway,other upstream pathways such as Nrf2/HO-1,and autophagy,thereby affecting the level of tissue inflammation and accelerating neurological recovery after spinal cord injury.(3)The anti-pyroptosis effects of these natural products are mostly dependent on the NLRP3 classical pyroptosis pathway,and there is a lack of studies on other pyroptosis pathways.(4)There are still many problems in this field,such as the fact that these natural products are not currently supported by evidence from appropriate clinical studies.(5)The natural product has great potential in regulating pyroptosis and is expected to be a powerful weapon in the treatment of spinal cord injury.

Objective To analyze the medication law and compatibility characteristics of TCM compounds for the treatment of myocardial infarction in the national patent database.Methods TCM compounds for treating myocardial infarction were retrieved from CNIPA patent publication website.A prescription database was built using Excel 2019 software to statistically analyze the frequency of medicinal use and their properties,taste and meridian tropism;SPSS Modeler 18.0 software was used to analyze the association rules of drugs;a network of Chinese materia medica co-occurrence was constructed using Cytoscape 3.10.0,and systematic clustering analysis was performed on the Chinese materia medica in the core network.Results A total of 146 patents of TCM compounds were included,involved 440 kinds of Chinese materia medica.High frequency drugs included Salviea Miltiorrhizae Radix et Rhizoma,Chuanxiong Rhizoma,Angelicae Sinensis Radix,Glycyrrhizae Radix et Rhizoma,etc.The main property was warm,the main tastes were bitter,sweet and pungent,and the medicines mostly belongs to the liver meridian,heart meridian and spleen meridians.Commonly used medicinal pairs included Angelicae Sinensis Radix-Chuanxiong Rhizoma,Astragali Radix-Salviea Miltiorrhizae Radix et Rhizoma,Paeoniae Radix Rubra-Angelicae Sinensis Radix,etc.Commonly used tripartite combinations included Paeoniae Radix Rubra-Chuanxiong Rhizoma-Angelicae Sinensis Radix,Carthami Flos-Angelicae Sinensis Radix-Chuanxiong Rhizoma,Carthami Flos-Chuanxiong Rhizoma-Angelicae Sinensis Radix,etc.Clustering analysis showed four types of combinations.Conclusion TCM compound patents for the treatment of myocardial infarction is based on promoting blood circulation,removing blood stasis,and relieving pain,while also using methods such as eliminating phlegm,tonifying qi,warming yang,and nourishing yin.It can provide references for clinical medication.

Objective:To investigate the effects and molecular mechanisms of Wilms tumor 1-associated proteins(WTAP)on the cell biological properties of esophageal squamous cell carcinoma(ESCC)cells.Methods:31 pairs of ESCC tissues and their paired paracancerous tissues that were surgically resected at the Second Clinical Medical College of Chuanbei Medical College between September 2019 and April 2021 were collected.The esophageal cancer cells KYSE30,KYSE410,KYSE150,KYSE510,TE-1,and normal human esophageal epithelial cells HET-1A were routinely cultured.Transfection reagents were used to transfect si-NC,si-WTAP#1 and si-WTAP#2 nucleic acids into KYSE150 and KYSE510 cells.The cells were divided into si-NC,si-WTAP#1 and si-WTAP#2 groups.The expressions of WTAP and MAP3K9 mRNA were detected in the cells of each group by qPCR assay.CCK-8 assay,clone formation assay,and scratch healing assay,Transwell assay were employed to detect the effects of knockdown of WTAP expression on ESCC cell proliferation,migration,invasion and apoptosis.WB assay was used to detect the expressions of WTAP,MAP3K9,EMT and MAPK pathway-related proteins in ESCC cells of each group knocked down of WTAP;immunohistochemistry to detect the expression of WTAP proteins in ESCC tissues,immunoprecipitation of methylated RNA(MeRIP)-qPCR assay to detect the level of MAP3K9 m6A in ESCC cells,actinomycin D assay to detect the stability of mRNA of MAP3K9,and database data to analyze the expression,target genes,functional enrichment,and interacting RNA of WTAP.Results:WTAP was highly expressed in ESCC tissues and cells(P<0.05 or P<0.01 or P<0.001)and correlated with the degree of differentiation(P<0.01);the expression of WTAP mRNA and its protein were successfully knocked down in KYSE150 and KYSE510 cells(P<0.01 or P<0.001);the knockdown of WTAP significantly inhibited the proliferation,migration and invasion of KYSE150 and KYSE510 cells(P<0.05 or P<0.01 or P<0.001),and promoted the apoptosis of KYSE150 and KYSE510 cells(P<0.05 or P<0.01).Knockdown of WTAP resulted in a significant decrease in the m6A level of MAP3K9(P<0.05),and its mRNA expression level and mRNA stability were both significantly reduced(P<0.05).Database data analysis showed that WTAP target genes clustered in the MAPK signaling pathway;the expression levels of MAP3K9,p-ERK,N-cadherin,and MMP9 were significantly reduced(P<0.05 or P<0.01),and the expression level of E-cadherin was significantly elevated(P<0.05 or P<0.01)in the KYSE150 and KYSE510 cells after knockdown of WTAP.Conclusions:WTAP is highly expressed in ESCC tissues and cells and correlates with their differentiation.It promotes the stability of MAP3K9 mRNA through m6A modification,activates the MAPK pathway and thus promotes the malignant biological behaviors of ESCC cells.

Objective:To analyze the prenatal ultrasonographic features and prognosis of fetal perirenal urinoma.Methods:This retrospective study included eight fetuses with perirenal urinoma diagnosed by prenatal ultrasound in the Women and Children's Hospital of Chongqing Medical University from January 2017 to August 2023. Descriptive analysis was performed on their prenatal ultrasonographic features, intrauterine intervention measures, postnatal treatment, and prognosis.Results:Among the eight cases, the prenatal ultrasonographic diagnosis was consistent with the postnatal clinical diagnosis in seven cases, with one misdiagnosis (postnatally confirmed as giant renal cyst with multicystic dysplastic kidney). Prenatal ultrasonographic features of fetal perirenal urinoma included cystic mass adjacent to the renal capsule; obvious compression of the surrounding organs and the affected kidney; increased craniocaudal diameter of the affected kidney with thin parenchyma, increased echogenicity, indistinct corticomedullary differentiation, and pyeletasis; poorly visualized partial renal arteries; normal or mildly enlarged contralateral kidney; adequate bladder filling; normal amniotic fluid volume. Two cases underwent intrauterine cyst aspiration with subsequent cyst size reduction (slight re-enlargement during follow-up). Among the remaining six untreated cases, one case showed stable cyst size, while five cases exhibited initial significant cyst enlargement followed by stabilization or regression trend. All eight cases were born at full term (three delivered vaginally and five by cesarean section). The affected kidney was significantly atrophied within one week after birth by ultrasound observation. Impaired function of the affected kidney was shown in four patients by follow-up after discharge (including two cases of intrauterine treatment),one case abandoned treatment due to other illnesses, two cases were lost to follow-up after discharge.Conclusions:Prenatal ultrasound images of perirenal urinary cysts infetuses exhibit typical features. Intrauterine treatment can reduce the compression of large cysts and hydronephrosis on fetal organs, but there is no significant improvement in the recovery of renal function.