AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Introduction: Capivasertib is a selective oral AKT inhibitor approved for hormone receptor-positive, HER2-negative advanced breast cancer with AKT pathway mutations. As AKT is integral to insulin signaling, its inhibition predisposes patients to hyperglycemia. We report a case of severe capivasertib-induced hyperglycemia with profound insulin resistance in a non-diabetic patient. Case: A 56-year-old female with metastatic breast cancer (ER/ PR-positive, HER2-negative, AKT1- and ESR1-mutated, TMB-high) presented with severe hyperglycemia following capivasertib initiation. She had no prior diabetes history, with a baseline hemoglobin A1c of 5.6%. Her first cycle (200 mg twice daily, 7 April 2025) was uncomplicated metabolically. The second cycle was escalated to 400 mg twice daily on 21 April 2025. By Day 3, blood glucose rose significantly. Premixed insulin 20 units failed to achieve glycemic control, necessitating intravenous insulin infusion. Despite escalation to 30 units per hour, euglycemia could not be achieved. Notably, there was no biochemical evidence of diabetic ketoacidosis or hyperosmolar hyperglycemic state, and the patient remained hemodynamically stable. No corticosteroids or other contributing medications were administered. Blood glucose normalized spontaneously approximately 36 hours after the last capivasertib dose, and all insulin was weaned and discontinued by 26 April 2025. She remained euglycemic without antidiabetic therapy thereafter. The patient and family opted for palliative care, and she passed away on 6 May 2025. Conclusion Capivasertib can precipitate severe, insulin-resistant hyperglycemia even in non-diabetic patients, without progression to overt hyperglycemic crisis. Spontaneous resolution upon drug cessation supports a direct drugmediated mechanism via AKT-disrupted insulin signaling. Clinicians should monitor glucose closely during therapy and consider drug cessation in refractory cases. Further studies are warranted to guide optimal glycemic management.
capivasertib ; Hyperglycemia ; Insulins

Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.

Objective To investigate the expansion margins of the planning target volume (PTV) and the planning organ at risk volume (PRV) in nasopharyngeal carcinoma patients immobilized with Styrofoam and head-neck-shoulder mask. Methods A convenient sample of 33 nasopharyngeal carcinoma patients who received radiotherapy at Huanggang Central Hospital from January to October 2024 were selected as the research subjects. All patients underwent cone beam CT scans during the first three treatments and weekly thereafter. After registration and calibration, the setup errors in the X (LAT), Y (LNG), and Z (VRT) directions were recorded. Statistical analysis was performed on the setup errors in each direction to determine differences, and the expansion margins for PTV and PRV were calculated using empirical formulas. Results A total of 229 cone beam CT images were collected. Statistical analysis found that the setup errors (systematic error ± random error) of the patients in the X, Y, and Z directions were 1.05 ± 0.72, 1.30 ± 0.80, and 1.29 ± 0.82 mm, respectively. The expansion margins for PTV in the left-right, superior-inferior, and anterior-posterior directions were 1.40, 1.76, and 1.8 mm, respectively. The expansion margins for PRV in these directions were 0.83, 1.02, and 1.05 mm, respectively. Conclusion For patients immobilized using Styrofoam and head-neck-shoulder mask, it is recommended that the expansion margins for PTV and PRV be set at 2 mm and 1 mm, respectively, in the left-right, superior-inferior, and anterior-posterior directions, and the PRV margin for the spinal cord be set at 3 mm in all directions.

Objective To explore the acceptability of routine biochemical test results for serum samples with varying degrees of chylous high triglyceride(TG).Methods Blood samples of 69 patients with different degrees of lipids were collected,including 33 patients with mild to moderate lipids(1.7 mmol/L≤TG<5.6 mmol/L)and 36 patients with severe lipids(TG≥5.6 mmol/L).Twenty-nine biochemical tests were detected before and after high-speed centrifugation.The result acceptability before high speed centrifugation of serum was compared with the results after high speed centrifugation as the gold standard[TG and total cholesterol(TC)before centrifugation].The acceptable criteria were subject to the following three conditions at the same time.Firstly,correlation coefficient(R2)was greater than or equal to 0.95.Secondly,the slope of linear re-gression equation was 1.00±0.05.Thirdly,for the same index,the number of samples whose result bias be-fore and after centrifugation was less than 1/2 total allowable error(TEa)in more than 90%of the total sam-ple numbers.Results Firstly,in the mild to moderate lipemia group,22 tests met the criteria,7 tests did not,including total protein(TP),albumin(ALB),TG,aspartate aminotransferase(AST),carbon dioxide(CO2),α-L-fucosidase(AFU),lactate dehydrogenase(LDH)(bias<10%),and the coincidence rate was 75.9%.In the severe lipemia group,12 tests met the criteria,17 tests did not,including pre-albumin(PA),AFU,γ-glu-tamyltransferase(γ-GT),LDH,AST,TC,direct bilirubin(DBIL),CO2,5'-nucleotidase(5'-NT),small and low-density lipoprotein cholesterol(sd-LDL-C),high density lipoprotein cholesterol(HDL-C),low-density lipoprotein cholesterol(LDL-C),adenosine deaminase(ADA),cystatin C(CysC),glycosylated albumin(GA),total bilirubin(TBIL)(bias>10%),the coincidence rate was 41.4%,and there was a statistically sig-nificant difference in the coincidence rate between the two groups(P<0.05).Secondly,there was no statisti-cally significant difference in the acceptability of results between continuous monitoring method and endpoint method detection methods(P>0.05).Conclusion Most test results of direct determination with mild or moderate lipemia samples are acceptable,and the bias of unacceptable tests is small(<10%),so it is recom-mended to issue a test report without further sample treatment.However,due to the large number of unacceptable tests and larger bias(>10%),severe lipemia samples should be determined after high-speed centrifugation.

Local anesthetics (LAs), such as articaine (AT), exhibit limited efficacy in inflammatory environments, which constitutes a significant limitation in their clinical application within oral medicine. In our prior research, we developed AT-17, which demonstrated effective properties in chronic inflammatory conditions and appears to function as a novel oral LA that could address this challenge. In the present study, we further elucidated the beneficial effects of AT-17 in acute inflammation, particularly in oral acute inflammation, where mitochondrial-related apoptosis played a crucial role. Our findings indicated that AT-17 effectively inhibited lipopolysaccharide (LPS)-induced nerve cell apoptosis by ameliorating mitochondrial dysfunction in vitro. This process involved the inhibition of mitochondrial reactive oxygen species (mtROS) production and the subsequent activation of the NRF2 pathway. Most notably, improvements in mitochondria-related apoptosis were key contributors to AT-17's inhibition of voltage-gated sodium channels. Additionally, AT-17 was shown to reduce mtROS production in nerve cells through the Na⁺/NCLX/ETC signaling axis. In conclusion, we have developed a novel local anesthetic that exhibits pronounced anesthetic functionality under inflammatory conditions by enhancing mitochondria-related apoptosis. This advancement holds considerable promise for future drug development and deepening our understanding of the underlying mechanisms of action.

Osteoporosis is a prevalent skeletal condition characterized by reduced bone mass and strength, leading to increased fragility. Buqi-Tongluo (BQTL) decoction, a traditional Chinese medicine (TCM) prescription, has yet to be fully evaluated for its potential in treating bone diseases such as osteoporosis. To investigate the mechanism by which BQTL decoction inhibits osteoclast differentiation in vitro and validate these findings through in vivo experiments. We employed MTS assays to assess the potential proliferative or toxic effects of BQTL on bone marrow macrophages (BMMs) at various concentrations. TRAcP experiments were conducted to examine BQTL's impact on osteoclast differentiation. RT-PCR and Western blot analyses were utilized to evaluate the relative expression levels of osteoclast-specific genes and proteins under BQTL stimulation. Finally, in vivo experiments were performed using an osteoporosis model to further validate the in vitro findings. This study revealed that BQTL suppressed receptor activator of NF-κB ligand (RANKL)-induced osteoclastogenesis and osteoclast resorption activity in vitro in a dose-dependent manner without observable cytotoxicity. The inhibitory effects of BQTL on osteoclast formation and function were attributed to the downregulation of NFATc1 and c-fos activity, primarily through attenuation of the MAPK, NF-κB, and Calcineurin signaling pathways. BQTL's inhibitory capacity was further examined in vivo using an ovariectomized (OVX) rat model, demonstrating a strong protective effect against bone loss. BQTL may serve as an effective therapeutic TCM for the treatment of postmenopausal osteoporosis and the alleviation of bone loss induced by estrogen deficiency and related conditions.
Animals ; NFATC Transcription Factors/genetics* ; Drugs, Chinese Herbal/pharmacology* ; Ovariectomy ; Osteoclasts/metabolism* ; Female ; Osteogenesis/drug effects* ; Rats, Sprague-Dawley ; Rats ; NF-kappa B/genetics* ; Osteoporosis/genetics* ; Signal Transduction/drug effects* ; Bone Resorption/genetics* ; Cell Differentiation/drug effects* ; Humans ; RANK Ligand/metabolism* ; Mitogen-Activated Protein Kinases/genetics* ; Transcription Factors

Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.

Chikungunya fever is spreading continuously worldwide，posing a growing public health challenge alongside other arboviral diseases. This article systematically reviews the epidemiological characteristics of chikungunya fever，analyzes the pandemic potential of Aedes mosquito-borne diseases and discusses integrated prevention and control strategies for China in the context of increasing importation risk，drawing on containment practices from multiple countries and regions.