AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To investigate the expansion margins of the planning target volume (PTV) and the planning organ at risk volume (PRV) in nasopharyngeal carcinoma patients immobilized with Styrofoam and head-neck-shoulder mask. Methods A convenient sample of 33 nasopharyngeal carcinoma patients who received radiotherapy at Huanggang Central Hospital from January to October 2024 were selected as the research subjects. All patients underwent cone beam CT scans during the first three treatments and weekly thereafter. After registration and calibration, the setup errors in the X (LAT), Y (LNG), and Z (VRT) directions were recorded. Statistical analysis was performed on the setup errors in each direction to determine differences, and the expansion margins for PTV and PRV were calculated using empirical formulas. Results A total of 229 cone beam CT images were collected. Statistical analysis found that the setup errors (systematic error ± random error) of the patients in the X, Y, and Z directions were 1.05 ± 0.72, 1.30 ± 0.80, and 1.29 ± 0.82 mm, respectively. The expansion margins for PTV in the left-right, superior-inferior, and anterior-posterior directions were 1.40, 1.76, and 1.8 mm, respectively. The expansion margins for PRV in these directions were 0.83, 1.02, and 1.05 mm, respectively. Conclusion For patients immobilized using Styrofoam and head-neck-shoulder mask, it is recommended that the expansion margins for PTV and PRV be set at 2 mm and 1 mm, respectively, in the left-right, superior-inferior, and anterior-posterior directions, and the PRV margin for the spinal cord be set at 3 mm in all directions.

INTRODUCTION: Social lockdowns and quarantines have been enforced in various populations to mitigate the spread of coronavirus disease 2019 (COVID-19) in the community. This study investigated the impact of COVID-19 lockdown, known as circuit breaker movement restrictions (CBMR), on physical activity (PA) and sedentary time (ST) distribution patterns among Singapore residents aged 21-65 years. METHODS: This was a cross-sectional retrospective study that utilised a 44-item questionnaire that included sections to determine PA and ST distribution patterns before and during CBMR. It also included information on sleep duration, PA preference and routine, awareness of local initiatives and perceptions on barriers towards PA during the CBMR period. RESULTS: There was an overall decrease in PA and a significant increase in physical inactivity and ST during the CBMR period. A greater proportion of participants reported sleeping for longer hours, suggesting positive adaptations in sleep habits during CBMR. Majority were unaware of online exercise initiatives and programmes offered during the CBMR period, and >50% of the respondents never used an online resource for exercise. Singapore residents seemed to prefer outdoor and facility-based venues for exercise and PA, and closure of facilities was the primary barrier for PA during the CBMR period. CONCLUSION Reduced PA and increased ST during CBMR reflect negative lifestyle adaptations and may have adverse public health implications. Increased sleep duration suggests successful coping, which may consequently lead to physical and mental health benefits. While Singapore adult residents may be flexible with certain aspects of being physically active, they seemed less adaptive to changes in type of exercise, facility and environment.
Humans ; COVID-19/epidemiology* ; Singapore/epidemiology* ; Exercise ; Adult ; Sedentary Behavior ; Cross-Sectional Studies ; Middle Aged ; Male ; Female ; Retrospective Studies ; Public Health ; Aged ; Surveys and Questionnaires ; SARS-CoV-2 ; Young Adult ; Quarantine ; Sleep

INTRODUCTION: Randomised controlled trials (RCTs) have informed guideline recommendations for the management of stable coronary artery disease (CAD). However, the real-world impact of contemporary guidelines and trials on practising physicians in the Asia-Pacific region remains uncertain. We aimed to evaluate the knowledge, attitudes and practices among cardiovascular physicians in the region regarding stable CAD management. METHOD: An anonymised cross-sectional electronic survey was administered to cardiovascular practitioners from the Asia Pacific, assessing 3 domains: 1) baseline knowledge on recent trials and society guideline, 2) attitudes towards stable CAD, and 3) case scenarios reflecting management preferences. Correlations among knowledge, attitudes and practice scores were assessed between physicians from developed and developing countries using Pearson correlation. RESULTS: Overall, 713 respondents from 21 countries completed the survey. The mean knowledge score was 2.90±1.18 (out of 4), with 37.3% of respondents answering all questions correctly, while 74.6% noted that guidelines have significant impact on their practice. Despite guidelines recommending optimal medical therapy, majority chose revascularisation (range 53.4- 90.6%) as the preferred strategy for the case scenarios. Practitioners from developed regions had higher knowledge scores and lower attitude scores compared to developing regions, while practice scores were similar in both groups. Weakly positive correlations were noted between knowledge, attitude and practice scores. CONCLUSION Variations exist in knowledge and attitudes towards guideline recommendations and correspondingly actual clinical practice in the Asia Pacific, with most practitioners choosing an upfront invasive strategy for the treatment of stable CAD. These differences reflect real-world disparities in guideline interpretation and clinical adoption.
Humans ; Coronary Artery Disease/therapy* ; Cross-Sectional Studies ; Practice Patterns, Physicians'/statistics & numerical data* ; Asia ; Health Knowledge, Attitudes, Practice ; Surveys and Questionnaires ; Male ; Practice Guidelines as Topic ; Female ; Attitude of Health Personnel ; Middle Aged ; Developing Countries

Osteoporosis is a prevalent skeletal condition characterized by reduced bone mass and strength, leading to increased fragility. Buqi-Tongluo (BQTL) decoction, a traditional Chinese medicine (TCM) prescription, has yet to be fully evaluated for its potential in treating bone diseases such as osteoporosis. To investigate the mechanism by which BQTL decoction inhibits osteoclast differentiation in vitro and validate these findings through in vivo experiments. We employed MTS assays to assess the potential proliferative or toxic effects of BQTL on bone marrow macrophages (BMMs) at various concentrations. TRAcP experiments were conducted to examine BQTL's impact on osteoclast differentiation. RT-PCR and Western blot analyses were utilized to evaluate the relative expression levels of osteoclast-specific genes and proteins under BQTL stimulation. Finally, in vivo experiments were performed using an osteoporosis model to further validate the in vitro findings. This study revealed that BQTL suppressed receptor activator of NF-κB ligand (RANKL)-induced osteoclastogenesis and osteoclast resorption activity in vitro in a dose-dependent manner without observable cytotoxicity. The inhibitory effects of BQTL on osteoclast formation and function were attributed to the downregulation of NFATc1 and c-fos activity, primarily through attenuation of the MAPK, NF-κB, and Calcineurin signaling pathways. BQTL's inhibitory capacity was further examined in vivo using an ovariectomized (OVX) rat model, demonstrating a strong protective effect against bone loss. BQTL may serve as an effective therapeutic TCM for the treatment of postmenopausal osteoporosis and the alleviation of bone loss induced by estrogen deficiency and related conditions.
Animals ; NFATC Transcription Factors/genetics* ; Drugs, Chinese Herbal/pharmacology* ; Ovariectomy ; Osteoclasts/metabolism* ; Female ; Osteogenesis/drug effects* ; Rats, Sprague-Dawley ; Rats ; NF-kappa B/genetics* ; Osteoporosis/genetics* ; Signal Transduction/drug effects* ; Bone Resorption/genetics* ; Cell Differentiation/drug effects* ; Humans ; RANK Ligand/metabolism* ; Mitogen-Activated Protein Kinases/genetics* ; Transcription Factors

Local anesthetics (LAs), such as articaine (AT), exhibit limited efficacy in inflammatory environments, which constitutes a significant limitation in their clinical application within oral medicine. In our prior research, we developed AT-17, which demonstrated effective properties in chronic inflammatory conditions and appears to function as a novel oral LA that could address this challenge. In the present study, we further elucidated the beneficial effects of AT-17 in acute inflammation, particularly in oral acute inflammation, where mitochondrial-related apoptosis played a crucial role. Our findings indicated that AT-17 effectively inhibited lipopolysaccharide (LPS)-induced nerve cell apoptosis by ameliorating mitochondrial dysfunction in vitro. This process involved the inhibition of mitochondrial reactive oxygen species (mtROS) production and the subsequent activation of the NRF2 pathway. Most notably, improvements in mitochondria-related apoptosis were key contributors to AT-17's inhibition of voltage-gated sodium channels. Additionally, AT-17 was shown to reduce mtROS production in nerve cells through the Na⁺/NCLX/ETC signaling axis. In conclusion, we have developed a novel local anesthetic that exhibits pronounced anesthetic functionality under inflammatory conditions by enhancing mitochondria-related apoptosis. This advancement holds considerable promise for future drug development and deepening our understanding of the underlying mechanisms of action.

Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.

Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.

ObjectiveTo investigate the effect of video-based educational intervention combined with maternal presence on perioperative adverse outcomes in preschool children undergoing general anesthesia， including cooperation in anesthesia induction， perioperative anxiety， pain and agitation during recovery. MethodsA total of 300 preschool children scheduled for general anesthesia in our hospital from June to December 2023 were randomly assigned to control group （n=150） and intervention group （n=150）. The control group received routine recovery care. For the intervention group， in addition to routine recovery care， a preoperative visit was scheduled one day before surgery. During this visit， mothers were guided to watch anesthesia videos with their children. During the waiting period in the operating room and 30 minutes after awakening， the mothers were guided to accompany the children for more than 30 minutes. Recovery conditions were recorded using the surgical anesthesia information system， and the children’s anesthetic induction compliance， perioperative anxiety， pain， and agitation were evaluated and recorded using the modified Yale Preoperative Anxiety Scale （m-YPAS）， the Induction Compliance Scale （ICC）， the Children’s Pain Behavior Scale （FLACC）， and the Pediatric Agitation and Emergence Delirium Scale （PAED）. ResultsOn the preoperative visit day， there were no statistically significant differences in baseline data between the two groups （P > 0.05）. For perioperative anxiety， the m-YPAS scores of the intervention group were significantly lower than those of the control group， both when entering the operating room waiting area （35.27±6.48 vs. 41.79±6.68， P < 0.05） and 30 minutes after postoperative recovery （20.13±7.05 vs. 35.75±9.51， P < 0.05）. In terms of anesthesia induction cooperation， the ICC scores of the intervention group were significantly lower than those of the control group （1.84±0.95 vs. 3.17±0.62， P < 0.05）， and the proportion of good induction cooperation was significantly higher than that of the control group （24.00% vs. 12.67%， P < 0.05）. There was no significant difference in awakening duration between the two groups， but the intervention group had a significantly shorter length of stay in the post-anesthesia care unit than the control group （0.90±0.29 hours vs. 1.29±0.42 hours， P < 0.001）. For perioperative agitation， the PAED scores of the intervention group were significantly lower than those of the control group （entering in the operating room waiting area： 8.5 vs. 9.2， P < 0.05； 30 minutes after postoperative recovery： 4.2 vs. 7.8， P < 0.05）. In terms of pain scores， the FLACC scores of the intervention group were also significantly lower than those of the control group， both when entering the operating room waiting area （ 5.3 vs. 6.7， P < 0.05； 30 minutes after postoperative recovery： 2.1 vs. 4.9， P < 0.05）. ConclusionsVideo-based educational intervention combined with maternal presence reduces the perioperative anxiety， pain and agitation of preschool children undergoing general anesthesia， and improved the compliance of anesthesia induction. It is recommended to promote this intervention measure in clinical practice.