ObjectiveTo explore the effects of Jingui Shenqiwan （JSW） and Liuwei Dihuangwan （LDW） on the reproductive ability and brain function of normal mice and compare the actions of the two medications. MethodsSeven groups of female and male mice were divided at a ratio of 2∶1. Except for the control group， the other six groups were as follows： a group of both males and females receiving JSW （3.0 g·kg^-1）， a group of both males and females receiving LDW （4.5 g·kg^-1）， a group of males receiving water and females receiving JSW， a group of males receiving water while females receiving LDW， a group of females receiving water while males receiving JSW， and a group of females receiving water while males receiving LDW. Each group was administered the drug for 14 days and then caged together at a 2∶1 （female∶male） ratio to detect the number of pregnant mice and calculate the pregnancy rate. Pregnant mice continued receiving the drug until they naturally gave birth， which was followed by the observation of newborn mice， calculation of their average number， and the measurement of the offspring's preference for sugar water and neonatal recognition index. At the end of the experiment， the weights of the thymus and spleen were measured to calculate the organ coefficients， and mRNA or protein expression was analyzed in the brain and testes or ovaries. A 1% sucrose solution was used to examine the euphoria of their brain reward systems， while novel object recognition test （NOR） was applied to assess their memory capabilities. mRNA expression was detected using real-time quantitative polymerase chain reaction （Real-time PCR） assay， and protein expression was analyzed with Western blot. ResultsCompared with the control group， oral administration of JSW to both male and female mice for 14 days significantly increased the pregnancy rate of female mice on day 2 after being caged together （P<0.05）， while LDW showed a trend but no statistical significance. Additionally， compared with the control group， JSW could upregulate the gene expression of gonadotropin-releasing hormone （GnRH） in the thalamus， as well as reproductive stem cell factor （SCF） and tyrosine kinase receptor （c-Kit） in the testes and reproductive stem cell marker mouse vasa homologue （MVH） in the ovaries， upregulate the expression of proteins influencing neuronal functional activity， such as brain-derived neurotrophic factor （BDNF）， in hippocampal neurons （P<0.05）， and enhance sucrose preference in male mice （P<0.05）. Compared with the control group， JSW significantly increased sucrose preference and novel object recognition index in offspring mice （P<0.05）， which was related to the upregulation of hippocampal dopamine D1 receptor （D1R） and N-methyl-D-aspartate receptor （Nmdar） gene expression. Compared with the control group， both JSW and LDW could upregulate the protein expression of glucocorticoid receptor （GR）， BDNF， and tyrosine kinase receptor B （TrkB） in the hippocampus of offspring mice （P<0.05）. ConclusionJSW significantly enhances the reproductive ability of normal mice， which is not only related to the release of gonadotropin but also associated with its regulation of brain function. Additionally， JSW has a certain regulatory effect on the brain function of the offspring mice.

Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10 /L vs preoperative 3.07×10 /L, P<0.001), with significant upregulation of CD11b (7.30×10 /L vs preoperative 3.05×10 /L, P<0.001) and CD54 (7.15×10 /L vs preoperative 2.99×10 /L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10 /L vs preoperative 1.12×10 /L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10 /L vs preoperative 1.12×10 /L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.

Objective To optimize the process conditions and analyze the components of alkaloids from Zanthoxylum bungeanum Maxim（Z. bungeanum）using macroporous resin. Methods Combining single factor tests and orthogonal tests, the content of hydroxy-α-sanshool（HAS）and hydroxy-β-sanshool（HBS）were considered as indexes to determine the best process parameters. Ultra-performance liquid chromatography-quadrupole tandem time-of-flight mass spectrometry（UPLC-Q-TOF-MS^E）was used to identify the structures of alkaloids. Results The optimal conditions were Mitsubishi HP-20 macroporous resin, the loading solution concentration was 0.2 g crude drug/ml, the ratio of crude drug to resin volume was 1 g∶2.5 ml, the diameter/height ratio of resin column was 1∶7, the dynamic adsorption flow rate was 4 times of bed volume（BV）per hour, and the adsorption time was 1 h. Impurities were removed by using 2 BV of 20% ethanol, 5 BV of 80% ethanol was used to elution, and the content of HAS and HBS was 4.71% and 1.02%, respectively. A total of 20 alkaloids were identified from Z. bungeanum. Conclusion This method was stable and feasible, obtaining high purity and various kinds of alkaloids, which could be used for the enrichment and purification of alkaloids from Z. bungeanum.

ObjectiveTo explore the effect of Shenge Bushen Capsules （SBC） on sexual development in normal 3-week-old mice. MethodsThe experiment consisted of two parts. In the first part， mice were divided into four groups： The control group and the low， medium， and high-dose SBC groups （234.7， 469.4， 938.7 mg·kg^-1， respectively）. In the second part， mice were divided into four groups： Control group， Pseudostellariae Radix polysaccharide （PRP） group， total flavonoids group， and SBC group， all receiving a dose of 469.4 mg·kg^-1. After 7 days of administration， the vaginal opening of female mice and the descent of testes and scrotum in male mice， as well as the ovarian and testicular organ indices， were observed. After 4 weeks of administration， female and male mice were housed together for 2 days， and the pregnancy rate of females was monitored. After delivery， the pregnant female mice continued receiving the treatment for 4 weeks， and the sexual development of their offspring， including vaginal opening， testicular descent， and organ indices of ovaries and testes， was observed. Serum sex hormones were measured by enzyme-linked immunosorbent assay （ELISA）， and the expression of gonadotropin-releasing hormone （GnRH） and growth hormone （GH） proteins in the hypothalamus was assessed by Western blot. ResultsCompared with the control group， there was no significant effect on the vaginal opening of female mice or the descent of testes in male mice after 7 days of SBC administration. After 4 weeks of administration， the pregnancy rate in the low-dose group was significantly reduced （P<0.05）， but no significant effects were observed in the other groups. The three doses of SBC did not significantly affect the ovarian or testicular organ indices， and there was no significant upregulation in the expression of GnRH or GH in the hypothalamus. The primary component of SBC， Pseudostellariae Radix polysaccharide， significantly reduced the vaginal opening in female mice after 7 days of administration （P<0.05）. After 4 weeks， the serum estradiol levels of non-pregnant female mice were decreased （P<0.05）， but there was no significant effect on the expression of GnRH or GH proteins in the hypothalamus of either male or female mice. Additionally， there were no significant effects on precocious puberty indicators， such as vaginal opening and testicular descent， in the offspring mice. ConclusionSBC does not significantly promote precocious puberty in young mice， and it does not have any noticeable effects on the pregnancy rate of adult mice or the sexual development of their offspring.

Objective: To analyze the consumption frequency of major foods among Chinese children aged 6-17 years old, and to provide a basis for optimizing the dietary structure of children in China. Methods: Using data from the China Nutrition and Health System Survey and Application Program for Children 0-18 years old, 56 734 children aged 6-17 years old from North, Norththeast East, Central, South, Southwest and Northwest seven regions in China were selected for the study using stratified cluster random sampling from 2019 to 2021. A food frequency questionnaire was used to investigate the intake frequency of eight food groups in a month, including fresh vegetables, fresh fruits, livestock and poultry meats, aquatic products, eggs, dairy products, legumes, and cereals and potatoes. The foods were grouped according to whether they met the recommended intake criteria outlined in the Dietary Guidelines for Chinese Residents 2022. The〖KG*2〗χ2 test was used to compare the differences in the proportion of childrens intake frequency of each food group meeting the standard in different regions and age groups. Results: The proportions of Chinese children aged 6-17 years who consumed fresh vegetables and cereals and potatoes ≥3 times/d were 12.1% and 67.2%, respectively. The proportions of children who consumed fresh fruits, livestock and poultry meats, eggs and dairy products ≥1 time/d were 50.8%, 58.8%, 36.0% and 54.3%, respectively. The proportion of legumes consumed ≥4 times/week was 37.4%, and the proportion of aquatic products consumed ≥2 times/week was 39.7%. Fresh vegetables (5.5%), fresh fruits (33.1%), and dairy products (36.4%) had the lowest frequency of meeting the recommended standards in South China, and aquatic products (27.4%) and eggs (21.1%) had the lowest frequency of meeting the recommended standards in Northwest (P<0.008 3). Conclusion The overall intake frequency of fresh vegetables, fresh fruits, legumes, and dairy products are insufficient among Chinese children, with significant regional variations.

Objective: To understand the prevalence and related factors of depressive symptoms among primary and secondary school students in the in depth monitoring counties of China s Rural Compulsory Education Nutrition Improvement Program, so as to provide a basis for prevention and psychological intervention of depressive symptoms among children and adolescents in rural areas. Methods: In November 2022, a stratified random sampling method was adopted to collect height and weight data, basic personal and family information of 7 949 primary and secondary school students from grade three to grade nine through physical measurements and questionnaires in 56 key monitoring schools implementing the Student Nutrition Improvement Program in 7 in depth monitoring counties (Jalaid Banner in Inner Mongolia, Jinzhai County in Anhui, Mao Xian in Sichuan, Tiandeng County in Guangxi, Mian County in Shaanxi, Zhaozhou County in Heilongjiang and Youxi County in Fujian), and to obtain the information related to their depressive symptoms through the self assessment questionnaire on depression. Multivariate Logistic regression analysis was conducted to analyze the prevalence of depressive symptoms among primary and secondary school students, as well as their related factors. Results: The detection rate of depressive symptoms among primary and secondary school students in the in depth monitored counties was 23.5%. Logistic regression analysis showed that the probability of detecting depressive symptoms was higher among female students, middle school students, students whose video screen duration per day was >2 h, and students whose parents marital status was divorced or widowed ( OR =1.40, 1.64, 1.60, 1.24), and students whose sleep duration reached the recommended standard, whose parents usually accompanied them daily for time was 60-<120 min and ≥120 min, and students whose mothers literacy level was middle school graduation had lower probability of detecting depressive symptoms ( OR =0.85, 0.84, 0.71, 0.76) ( P < 0.05 ). Conclusion The detection rate of depressive symptoms among students in the in depth monitoring area is high, and targeted interventions need to be developed for students to reduce the risk of mental health problems.

AIM: To investigate the global research status, hotspots, and trends of exosome studies in ophthalmology, providing a theoretical foundation and constructive references for future research, and promoting in-depth development in this field.METHODS: Relevant literature on exosomes in ophthalmology published up to May 20, 2024, was retrieved from the China National Knowledge Infrastructure(CNKI), Web of Science Core Collection, and PubMed databases. Visual analyses of publication countries, institutions, authors, high-frequency keywords, burst keywords, and timelines were performed using CiteSpace 6.3.R1 and VOSviewer software.RESULTS: A total of 37 Chinese articles and 548 English articles were included. The top five countries in terms of publication volume were the United States(130 articles), China(80 articles), South Korea(24 articles), the United Kingdom(20 articles), and Japan(19 articles). The leading foreign institutions were the University of California System, Duke University, and Harvard University, while the top domestic institutions were Qingdao University, the Department of Ophthalmology at the First Affiliated Hospital of Jinan University, and the School of Physical Education and Sports Science at Beijing Normal University. Analysis of Chinese and English high-frequency and burst keywords indicated that global research hotspots on exosomes in ophthalmology primarily focus on dry eye, extracellular vesicles, mesenchymal stem cells and their derived exosomes, ocular surface diseases, ocular surface inflammation, biomarkers, retinal protection, immune eye diseases, uveitis, degenerative eye diseases, macular degeneration, diabetic retinopathy, neovascularization, thyroid-associated ophthalmopathy, and glaucoma, while English high-frequency words mainly were dry eye, dry eye disease, delivery, regenerative medicine, uveal melanoma, protein, and transplantation. Research has evolved from initial basic biological studies to exploring the pathogenesis of ocular diseases and advancing toward novel diagnostic and therapeutic approaches.CONCLUSION: Over the past 5 a, research on exosomes in ophthalmology has grown rapidly. Exosomes, as novel biomarkers and potential therapeutic targets, have become central to studies on the pathogenesis and clinical applications of ophthalmic diseases. Their roles in the diagnosis, treatment, and prevention of these diseases represent promising directions for future research.

OBJECTIVE To evaluate the quality of evidence in the systematic evaluation/meta-analysis of traditional Chinese medicine （TCM） for diabetes retinopathy （DR） based on the GRADE system. METHODS Chinese and English databases were searched to obtain the relevant studies of systematic evaluation/meta-analysis of traditional Chinese medicine in the treatment of DR. The search time was from the establishment of each database to January 13th， 2024. According to the inclusion and exclusion criteria， literature screening was conducted. After extracting relevant information from the included literature， the GRADE system was used to evaluate the quality level of the evidence body in the included studies， and the evidence of the outcome indicators was integrated and summarized. RESULTS A total of 51 studies were ultimately included， encompassing 135 outcome indexes. Among these， 19 indicators （14.1%） were of high quality， 87 （64.4%） were of medium quality， 26 （19.3%） were of low quality， and 3 （2.2%） were of very low quality. Overall， the evidence quality of the outcome indicators in the included studies was medium to low quality. The integrated results of evidence on the efficacy of outcome indexes showed that compared with conventional Western medicine， calcium dobesilate or placebo， TCM had significant advantages in improving overall efficacy， reducing bleeding spot area， reducing macular foveal thickness， and increasing visual improvement rate. In addition，the combination of TCM and conventional Western medicine or calcium dobesilate was significantly more effective than using conventional Western medicine or calcium dobesilate alone. CONCLUSIONS The overall quality of the evidence in the systematic evaluation/meta-analysis study on the treatment of DR with TCM is medium to low quality. Based on existing research findings， TCM demonstrates good clinical efficacy in the treatment of DR.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test