1.Chemical and pharmacological research progress on Mongolian folk medicine Syringa pinnatifolia.
Kun GAO ; Chang-Xin LIU ; Jia-Qi CHEN ; Jing-Jing SUN ; Xiao-Juan LI ; Zhi-Qiang HUANG ; Ye ZHANG ; Pei-Feng XUE ; Su-Yi-le CHEN ; Xin DONG ; Xing-Yun CHAI
China Journal of Chinese Materia Medica 2025;50(8):2080-2089
Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional
;
Humans
;
Drugs, Chinese Herbal/pharmacology*
;
Animals
;
Syringa/chemistry*
2.Formulation and interpretation of the Guidelines for the Pharmacist-managed Clinics Service and Document Writing and Usage(Reference)
Lijuan YANG ; Quanzhi LI ; Kejing WANG ; Xiaofen YE ; Zining WANG ; Xuelian YAN ; Liang HUANG ; Juan LI ; Jiancun ZHEN
China Pharmacy 2025;36(11):1301-1305
The writing of pharmacist-managed clinics documents (hereinafter referred to as “outpatient medication record”) is a necessary part of pharmacist-managed clinics service. Outpatient medication record is an important carrier to reflect the quality of pharmacist-managed clinics service. The Chinese Hospital Association Pharmaceutical Specialized Committee was entrusted by the Pharmaceutical Administration Department of the National Health Commission to lead the formulation of the Guidelines for the Pharmacist-managed Clinics Service and Document Writing and Usage (Reference) (hereinafter referred to as Guidelines) according to the compilation method of group standards and the technical route of “documentation combing→framework establishment→draft writing→opinion collection→Guidelines formation”. The Guidelines standardizes the basic requirements of pharmacist-managed clinics record management and the basic content of record, and provides a general template and two specialized templates including pregnant and lactating pharmacist-managed clinics record template and cough and asthma pharmacist-managed clinics record template, which provides a reference for medical institutions to write pharmacist-managed clinics record. This paper introduces the formulation process of Guidelines and analyzes the key contents of Guidelines, which is helpful for the application practice of Guidelines and further improves the quality of pharmacist-managed clinics work.
3.Clinicopathological Characteristics of HER2-Positive Breast Cancer Patients with BRCA1/2 Pathogenic Variants and Their Response to Neoadjuvant Targeted Therapy
Xingyu LIAO ; Huimin LIU ; Jie SUN ; Li HU ; Juan ZHANG ; Lu YAO ; Ye XU ; Yuntao XIE
Cancer Research on Prevention and Treatment 2025;52(6):491-495
Objective To analyze the proportion and clinicopathological characteristics of HER2-positive breast cancer patients with BRCA1/2 pathogenic variants, and their response to neoadjuvant anti-HER2 targeted therapy. Methods The clinicopathological data of 531 breast cancer patients with germline BRCA1/2 pathogenic variants (201 with BRCA1 variants and 330 with BRCA2 variants) were analyzed. Results Among the 201 BRCA1 and 330 BRCA2 variants, 17 (8.5%) and 42 (12.7%) HER2-positive breast cancer cases were identified, respectively, accounting for 11.1% of all BRCA1/2-mutated breast cancers. Compared with BRCA1/2-mutated HR-positive/HER2-negative patients, HER2-positive patients did not present any significant differences in clinicopathological features; however, compared with triple-negative breast cancer patients, HER2-positive patients had a later onset age and lower tumor grade. Among the 17 patients who received neoadjuvant anti-HER2 targeted therapy, 10 cases achieved pCR (58.8%), whereas 7 cases did not (41.2%). Conclusion HER2-positive breast cancer accounts for more than 10% of BRCA1/2-mutated patients. Approximately 40% of these patients fail to achieve pCR after neoadjuvant targeted therapy. This phenomenon highlights the possibility of combining anti-HER2 targeted agents with poly (adenosine diphosphate-ribose) polymerase inhibitors.
4.Effect of Atractylodes macrocephala Koidz. extract on regulating immune function in mice
YAO Jiali ; ZHANG Juan ; YE Kang ; HUANG Jingjing ; SUN Jian ; JIN Zuhan ; ZHOU Danying
Journal of Preventive Medicine 2025;37(9):968-972
Objective:
To analyze the regulatory effect of Atractylodes macrocephala Koidz. extract on the immune function of mice, so as to provide a reference for the study of the mechanism of Atractylodes macrocephala Koidz. regulating immune function.
Methods:
Forty-eight SPF healthy male ICR mice were randomly divided into control group and low (0.5 g/kg), medium (2.0 g/kg), and high (4.0 g/kg) dose groups, with 12 mice in each group. The mice in control group were given the pure water by gavage once a day, while the mice in each dose group were given the corresponding dose of Atractylodes macrocephala Koidz. extract by gavage once a day. The delayed allergy test was performed for 28 consecutive days. Sixty SPF healthy male ICR mice were randomly divided into a control group, polyinosinic acid injection group (model group), and low, medium, and high dose groups, with 12 mice in each group. The mice in control group were given the pure water by gavage once a day, while the mice in each dose group were given the corresponding dose of Atractylodes macrocephala Koidz. extract by gavage once a day for 14 consecutive days. On days 13 and 14 of administration, the mice in the model group and each dose group were intraperitoneally injected with sterile polyinosinic acid solution to perform the immunosuppressive experiment induced by polyinosinic acid. The mouse ear pieces were weighed, and the thymus and spleen of the mice were weighed and stained with HE to calculate the pathological scores. Peripheral blood was collected for blood cell detection and T cell classification.
Results:
Mice in each group had normal feeding, activity, and growth status, and no abnormality was observed. In the delayed allergy test, compared with the control group, the degree and rate of ear swelling in the low, medium and high dose groups were higher, the white blood cell count in the medium dose group was higher, and the absolute values of lymphocytes in the low and medium dose groups were higher (all P<0.05). Compared with the control group, the pathological scores of the thymus and spleen in the model group were higher (both P<0.05). In the immunosuppressive experiments in mice induced by polyinosinic acid, compared with the model group, the pathological score of the thymus in the high dose group was lower (P<0.05), and the boundary between the thymus cortex and medulla was improved.
Conclusions
Atractylodes macrocephala Koidz. extract can increase the degree of ear swelling and peripheral blood white blood cell count in mice. High dose of Atractylodes macrocephala Koidz. extract can improve the thymus injury induced by polyinosinic acid, and has an immunomodulatory effect.
5.Research progress on transcription factors and regulatory proteins of Salvia miltiorrhiza.
Wen XU ; Mei TIAN ; Ye SHEN ; Juan GUO ; Bao-Long JIN ; Guang-Hong CUI
China Journal of Chinese Materia Medica 2025;50(1):58-70
Salvia miltiorrhiza is a perennial herb of the genus Salvia(Lamiaceae). As one of the earliest medicinal plants to undergo molecular biology research, it has gradually become a model plant for molecular biology of medicinal plants. With the gradual analysis of the genome of S. miltiorrhiza and the biosynthetic pathways of its main active components tanshinone and salvianolic acids, the transcriptional regulation mediated by transcription factors and related regulatory proteins has gradually become a new research focus. Due to the lack of scientific and unified naming of transcription factors and different research indexes in different literature, this paper systematically sorted out the transcription factors in different literature with the genomes of DSS3 from selfing for three generations and bh2-7 from selfing for six generations as reference. In total, 73 transcription factors and related regulatory proteins belonging to 13 gene families were identified. The effects of overexpression or gene silencing experiments on tanshinone and salvianolic acids were also analyzed. This study unified the identified transcription factors, which laid a foundation for further constructing the regulatory networks of secondary metabolites and insect or stress resistance and improving the quality of medicinal materials by using global transcriptional regulation engineering.
Salvia miltiorrhiza/chemistry*
;
Plant Proteins/metabolism*
;
Gene Expression Regulation, Plant
;
Transcription Factors/metabolism*
;
Abietanes/metabolism*
6.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
7.Genetic and clinical characteristics of children with RAS-mutated juvenile myelomonocytic leukemia.
Yun-Long CHEN ; Xing-Chen WANG ; Chen-Meng LIU ; Tian-Yuan HU ; Jing-Liao ZHANG ; Fang LIU ; Li ZHANG ; Xiao-Juan CHEN ; Ye GUO ; Yao ZOU ; Yu-Mei CHEN ; Ying-Chi ZHANG ; Xiao-Fan ZHU ; Wen-Yu YANG
Chinese Journal of Contemporary Pediatrics 2025;27(5):548-554
OBJECTIVES:
To investigate the genomic characteristics and prognostic factors of juvenile myelomonocytic leukemia (JMML) with RAS mutations.
METHODS:
A retrospective analysis was conducted on the clinical data of JMML children with RAS mutations treated at the Hematology Hospital of Chinese Academy of Medical Sciences, from January 2008 to November 2022.
RESULTS:
A total of 34 children were included, with 17 cases (50%) having isolated NRAS mutations, 9 cases (27%) having isolated KRAS mutations, and 8 cases (24%) having compound mutations. Compared to children with isolated NRAS mutations, those with NRAS compound mutations showed statistically significant differences in age at onset, platelet count, and fetal hemoglobin proportion (P<0.05). Cox proportional hazards regression model analysis revealed that hematopoietic stem cell transplantation (HSCT) and hepatomegaly (≥2 cm below the costal margin) were factors affecting the survival rate of JMML children with RAS mutations (P<0.05); hepatomegaly was a factor affecting survival in the non-HSCT group (P<0.05).
CONCLUSIONS
Children with NRAS compound mutations have a later onset age compared to those with isolated NRAS mutations. At initial diagnosis, children with NRAS compound mutations have poorer peripheral platelet and fetal hemoglobin levels than those with isolated NRAS mutations. Liver size at initial diagnosis is related to the prognosis of JMML children with RAS mutations. HSCT can improve the prognosis of JMML children with RAS mutations.
Humans
;
Leukemia, Myelomonocytic, Juvenile/therapy*
;
Mutation
;
Male
;
Female
;
Child, Preschool
;
Retrospective Studies
;
Child
;
Infant
;
GTP Phosphohydrolases/genetics*
;
Membrane Proteins/genetics*
;
Adolescent
;
Hematopoietic Stem Cell Transplantation
;
Proportional Hazards Models
;
Proto-Oncogene Proteins p21(ras)/genetics*
;
Prognosis
8.Avatrombopag for platelet engraftment after allogeneic hematopoietic stem cell transplantation in children: a retrospective clinical study.
Xin WANG ; Yuan-Yuan REN ; Xia CHEN ; Chao-Qian JIANG ; Ran-Ran ZHANG ; Xiao-Yan ZHANG ; Li-Peng LIU ; Yu-Mei CHEN ; Li ZHANG ; Yao ZOU ; Fang LIU ; Xiao-Juan CHEN ; Wen-Yu YANG ; Xiao-Fan ZHU ; Ye GUO
Chinese Journal of Contemporary Pediatrics 2025;27(10):1233-1239
OBJECTIVES:
To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO).
METHODS:
A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38).
RESULTS:
At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043).
CONCLUSIONS
In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans
;
Retrospective Studies
;
Hematopoietic Stem Cell Transplantation/adverse effects*
;
Male
;
Female
;
Child
;
Child, Preschool
;
Infant
;
Adolescent
;
Transplantation, Homologous
;
Blood Platelets/drug effects*
;
Thiazoles/therapeutic use*
;
Thrombopoietin/therapeutic use*
;
Thiophenes
9.Granuloma faciale and Takayasu arteritis in a child: a case report.
Wei LIAO ; Juan LONG ; Jian-Ping TANG ; Dan-Ni WO ; Ye SHU ; Zhu WEI
Chinese Journal of Contemporary Pediatrics 2025;27(10):1266-1270
An 11-year-old boy presented with erythematous plaques over the bilateral mandibular and mental regions for 2 years, accompanied by cough and dyspnea for more than 2 months. Chest computed tomography angiography revealed marked stenosis of the right pulmonary artery, irregular aortic caliber, and aortic wall thickening. Histopathological examination of the skin lesion, including immunohistochemistry and special stains, confirmed a chronic suppurative inflammation. Whole-exome sequencing was negative. A final diagnosis of granuloma faciale and Takayasu arteritis was established. Combination therapy with systemic tocilizumab, prednisone, and methotrexate, along with topical 0.1% tacrolimus ointment, resulted in a favorable clinical response. This report summarizes the clinical features of a pediatric case of granuloma faciale and Takayasu arteritis and reviews the etiology, diagnostic approach, and current treatment strategies for the disorders, aiming to enhance clinicians' understanding of these conditions.
Humans
;
Male
;
Child
;
Takayasu Arteritis/diagnosis*
;
Facial Dermatoses/diagnosis*
10.Clinical and Laboratory Characteristics of Streptococcus mitis Causing Bloodstream Infection in Children with Hematological Disease.
Yu-Long FAN ; Guo-Qing ZHU ; Zhi-Ying TIAN ; Yan-Xia LYU ; Zhao WANG ; Ye GUO ; Wen-Yu YANG ; Qing-Song LIN ; Xiao-Juan CHEN
Journal of Experimental Hematology 2025;33(1):286-291
OBJECTIVE:
To investigate the risk factors, clinical characteristics, and bacterial resistance of bloodstream infections caused by Streptococcus mitis in children with hematological disease, so as to provide a reference for infection control.
METHODS:
The clinical information and laboratory findings of pediatric patients complicated with blood cultures positive for Streptococcus mitis from January 2018 to December 2020 in the Institute of Hematology & Blood Diseases Hospital were searched and collected. The clinical characteristics, susceptibility factors, and antibiotic resistance of the children were retrospectively analyzed.
RESULTS:
Data analysis from 2018 to 2020 showed that the proportion of Streptococcus mitis isolated from bloodstream infections in children (≤14 years old) with hematological diseases was the highest (19.91%) and significantly higher than other bacteria, accounting for 38.64% of Gram-positive cocci, and presented as an increasing trend year by year. A total of 427 children tested positive blood cultures, including 85 children with bloodstream infections caused by Streptococcus mitis who tested after fever. Most children experienced a recurrent high fever in the early and middle stages (≤6 d) of neutropenia and persistent fever for more than 3 days. After adjusting the antibiotics according to the preliminary drug susceptibility results, the body temperature of most children (63.5%) returned to normal within 4 days. The 85 children were mainly diagnosed with acute myeloid leukemia (AML), accounting for 84.7%. The proportion of children in the neutropenia stage was 97.7%. The incidence of oral mucosal damage, lung infection, and gastrointestinal injury symptoms was 40%, 31.8%, and 27.1%, respectively. The ratio of elevated C-reactive protein (CRP) and procalcitonin was 65.9% and 9.4%, respectively. All isolated strains of Streptococcus mitis were not resistant to vancomycin and linezolid, and the resistance rate to penicillin, cefotaxime, levofloxacin, and quinupristin-dalfopristin was 10.6%, 8.2%, 9.4%, and 14.1%, respectively. None of children died due to bloodstream infection caused by Streptococcus mitis.
CONCLUSION
The infection rate of Streptococcus mitis is increasing year by year in children with hematological diseases, especially in children with AML. Among them, neutropenia and oral mucosal damage after chemotherapy are high-risk infection factors. The common clinical symptoms include persistent high fever, oral mucosal damage, and elevated CRP. Penicillin and cephalosporins have good sensitivity. Linezolid, as a highly sensitive antibiotic, can effectively control infection and shorten the course of disease.
Humans
;
Child
;
Streptococcal Infections/microbiology*
;
Retrospective Studies
;
Hematologic Diseases/complications*
;
Streptococcus mitis
;
Drug Resistance, Bacterial
;
Risk Factors
;
Microbial Sensitivity Tests
;
Anti-Bacterial Agents
;
Female
;
Male
;
Bacteremia/microbiology*
;
Child, Preschool
;
Adolescent


Result Analysis
Print
Save
E-mail