1.Perioperative immune dynamics and clinical outcomes in patients undergoing on-pump cardiac surgery
Zhiyuan CHENG ; Xinyi LIAO ; Juan WU ; Ping YANG ; Tingting WANG ; Qinjuan WU ; Wentong MENG ; Zongcheng TANG ; Jiayi SUN ; Jia TAN ; Jing LIN ; Dan LUO ; Hao WANG ; Chaonan LIU ; Jiyue XIONG ; Liqin LING ; Jing ZHOU ; Lei DU
Chinese Journal of Blood Transfusion 2026;39(1):31-43
Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10
/L vs preoperative 3.07×10
/L, P<0.001), with significant upregulation of CD11b (7.30×10
/L vs preoperative 3.05×10
/L, P<0.001) and CD54 (7.15×10
/L vs preoperative 2.99×10
/L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10
/L vs preoperative 1.12×10
/L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10
/L vs preoperative 1.12×10
/L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.
2.Analysis of undernutrition and associated factors among left behind and nonleftbehind primary and secondary school students in the Nutrition Improvement Program areas in central and western China
Chinese Journal of School Health 2026;47(3):327-331
Objective:
To investigate the prevalence of undernutrition and its associated factors among left behind and non left behind primary and secondary school students in the Nutrition Improvement Program for Rural Compulsory Education Students (NIPRCES) areas of central and western China, so as to provide evidence for improving the nutritional status of children and adolescents.
Methods:
A survey was conducted among 123 782 students selected by random cluster sampling method in grades 3-9 from NIPRCES in central (Hebei, Shanxi, Heilongjiang, Jilin, Anhui, Jiangxi, Henan, Hunan, Hubei, and Hainan) and western (Gansu, Guangxi, Inner Mongolia, Ningxia, Tibet, Shaanxi, Guizhou, Sichuan, Xinjiang, the Xinjiang Production and Construction Corps, Yunnan, Qinghai, and Chongqing) China in 2023. Anthropometric measurements and questionnaires were used to assess nutritional and dietary status. The prevalence of undernutrition was compared between left behind and non left behind students by Chi square test, and associated factors were analyzed by three level Logistic mixed effects model.
Results:
The prevalence of undernutrition was 8.5% (4 326) in left behind students and 8.1% (5 905) in non left behind students. Three level Logistic mixed effect model analysis showed that whether left behind or non left behind, the undernutrition rates of primary and secondary students in western regions were higher than those of students in central regions [ OR (95% CI )=1.72(1.57-1.87),2.25(2.07- 2.43 )]; the undernutrition risk was lower for those whose fathers had a cultural level of high school or above [ OR (95% CI )=0.69(0.62-0.77),0.90(0.82-0.98)] or junior high school [ OR (95% CI )=0.72(0.66-0.79),0.92(0.85-0.99)] compared to those with primary school or below; picky eating or selective eating increased the risk of undernutrition [ OR (95% CI )=2.36(2.07-2.68),2.28(2.04-2.55)], and primary and secondary school students without nutritional content in health education classes had higher rates of undernutrition [ OR (95% CI )=1.12(1.03-1.23),1.09(1.01-1.17)](all P <0.05).
Conclusion
The prevalence of undernutrition is slightly higher in left behind primary and secondary students than in non left behind primary and secondary students in central and western NIPRCES areas, with variations across different characteristics.
3.Temporal trends in the frequency of meat, egg and milk consumption among primary and secondary school students in rural central and western China, 2015-2023
Chinese Journal of School Health 2026;47(3):332-336
Objective:
To analyze the trends of the frequency of meat, egg, and milk consumption among rural primary and junior high school students in central and western China covered by the Nutrition Improvement Program for Rural Compulsory Education Students (NIPRCES) from 2015 to 2023, so as to provide basis for formulating more targeted nutrition intervention policies and health education strategies.
Methods:
Using data from six rounds of monitoring and evaluation (2015-2021 and 2023), the study included 323 870 students from grade 3 to 9 across 22 provinces (autonomous regions and municipalities) in central and western China. The consumption frequencies of meat, egg, and milk over the past week were collected via questionnaires. The Cochran-Armitage trend test was used to analyze temporal trends, and multivariable Logistic regression models were employed to analyze factors associated with the frequency of meat, egg and milk consumption and to test for interaction effects between the year and gender, region, and grade level.
Results:
From 2015 to 2023, the proportion of students consuming meat, egg, and milk ≥1 time/day increased from 23.20 %, 10.71%, and 0.74% to 35.53%, 22.09%, and 26.63%, respectively. Trend tests indicated a significant upward trend for the daily intake of all three food categories for meat, egg and milk over the years ( Z =67.18, 64.90, 93.14, all P <0.01). Multivariable Logistic regression analysis showed that the daily meat intake was lower in the central region than in the western region ( OR=0.77, 95%CI =0.76-0.78), whereas the daily intake of eggs ( OR=1.19, 95%CI =1.17-1.22) and milk ( OR= 1.27 , 95%CI =1.24-1.29) was higher in the central region (all P <0.05). Compared with grade 3-4 students, junior high school students had lower daily intake of meat, eggs, and milk≥1 time/day ( OR =0.95, 0.77, 0.77, all P <0.05), with a declining trend as grade increased. Girls also had lower daily intake of meat, eggs, and milk ≥1 time/day than boys ( OR =0.95,0.93,0.91, all P < 0.05). Significant interactions were observed between year and region, as well as between year and grade (all P <0.05).
Conclusion
From 2015 to 2023, the NIPRCES improved the intake level of among rural students, but the situation of relatively insufficient intake of egg and milk among females, junior high school students and those in the western region still exists.
4.Association between physical activity level and dyslipidemia among freshmen of a medical college
Yushuang LUO ; Yan WANG ; Yanli LIU ; Jin ZHANG ; Minghui HE ; Wanhong HE ; Juan WU ; Yihan GU ; Chenyang ZHENG ; WANG WANG
Journal of Public Health and Preventive Medicine 2026;37(2):170-174
Objective To investigate the association between physical activity levels and blood lipids among college freshmen, and to provide scientific evidence for the health management of college freshmen. Methods An electronic questionnaire survey on physical activity was conducted on freshmen of a university, and fasting blood biochemical indicators were detected. The International Physical Activity Questionnaire (IPAQ) short form was used to evaluate the physical activity levels of the participants. Dyslipidemia was defined as an abnormality in any one of the following serum lipid parameters: total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), or non-high-density lipoprotein cholesterol. Binary logistic regression and stratified analyses were employed to explore the relationship between physical activity and blood lipids. Results A total of 3 401 participants were included, with an average age of 18.45 ± 0.92 years, and 60.5% were female. The prevalence of dyslipidemia was 17.7%, with a higher rate among males (22.1%) than females (14.8%). After adjusting for confounding factors related to blood lipids, high-intensity physical activity was negatively associated with the risk of elevated LDL-C among males (OR = 0.36, 95% CI: 0.13–0.99, P = 0.049). Conclusion Among freshmen at a medical college in Hubei Province, high-intensity physical activity is negatively associated with the risk of elevated LDL-C in males, but this association needs to be further confirmed by larger prospective cohort studies.
5.Comparative Study on Effect of Jingui Shenqiwan and Liuwei Dihuangwan on Reproductive Ability and Brain Function of Normal Mice
Hong SUN ; Fan LEI ; Chenggong LI ; Rui LUO ; Shixian HU ; Bin REN ; Juan HAO ; Yi DING ; Lijun DU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):1-14
ObjectiveTo explore the effects of Jingui Shenqiwan (JSW) and Liuwei Dihuangwan (LDW) on the reproductive ability and brain function of normal mice and compare the actions of the two medications. MethodsSeven groups of female and male mice were divided at a ratio of 2∶1. Except for the control group, the other six groups were as follows: a group of both males and females receiving JSW (3.0 g·kg-1), a group of both males and females receiving LDW (4.5 g·kg-1), a group of males receiving water and females receiving JSW, a group of males receiving water while females receiving LDW, a group of females receiving water while males receiving JSW, and a group of females receiving water while males receiving LDW. Each group was administered the drug for 14 days and then caged together at a 2∶1 (female∶male) ratio to detect the number of pregnant mice and calculate the pregnancy rate. Pregnant mice continued receiving the drug until they naturally gave birth, which was followed by the observation of newborn mice, calculation of their average number, and the measurement of the offspring's preference for sugar water and neonatal recognition index. At the end of the experiment, the weights of the thymus and spleen were measured to calculate the organ coefficients, and mRNA or protein expression was analyzed in the brain and testes or ovaries. A 1% sucrose solution was used to examine the euphoria of their brain reward systems, while novel object recognition test (NOR) was applied to assess their memory capabilities. mRNA expression was detected using real-time quantitative polymerase chain reaction (Real-time PCR) assay, and protein expression was analyzed with Western blot. ResultsCompared with the control group, oral administration of JSW to both male and female mice for 14 days significantly increased the pregnancy rate of female mice on day 2 after being caged together (P<0.05), while LDW showed a trend but no statistical significance. Additionally, compared with the control group, JSW could upregulate the gene expression of gonadotropin-releasing hormone (GnRH) in the thalamus, as well as reproductive stem cell factor (SCF) and tyrosine kinase receptor (c-Kit) in the testes and reproductive stem cell marker mouse vasa homologue (MVH) in the ovaries, upregulate the expression of proteins influencing neuronal functional activity, such as brain-derived neurotrophic factor (BDNF), in hippocampal neurons (P<0.05), and enhance sucrose preference in male mice (P<0.05). Compared with the control group, JSW significantly increased sucrose preference and novel object recognition index in offspring mice (P<0.05), which was related to the upregulation of hippocampal dopamine D1 receptor (D1R) and N-methyl-D-aspartate receptor (Nmdar) gene expression. Compared with the control group, both JSW and LDW could upregulate the protein expression of glucocorticoid receptor (GR), BDNF, and tyrosine kinase receptor B (TrkB) in the hippocampus of offspring mice (P<0.05). ConclusionJSW significantly enhances the reproductive ability of normal mice, which is not only related to the release of gonadotropin but also associated with its regulation of brain function. Additionally, JSW has a certain regulatory effect on the brain function of the offspring mice.
6.Metabolomic features of energy metabolic dysregulation and related targeted therapeutic strategies in acute-on-chronic liver failure
Xinxin CHEN ; Juan LUO ; Fengqin YE ; Zhengyuan MO ; Xiufeng WANG
Journal of Clinical Hepatology 2026;42(7):1710-1716
Acute-on-chronic liver failure is an acute decompensated syndrome that occurs on the basis of chronic liver disease and is characterized by a high short-term mortality rate. Metabolomics reveals the presence of significant energy metabolic reprogramming, manifesting as extensive dysregulation of glucose/lipid/amino acid metabolism, mitochondrial metabolism, and intestinal flora, and it closely interacts with systemic inflammation and immune imbalance, jointly promoting disease progression. The core metabolic phenotypes include suppressed gluconeogenesis, enhanced glycolysis, impaired β-oxidation, inhibited mitochondrial oxidative phosphorylation, ammonia metabolic imbalance, and gut microbiota dysbiosis. This article analyzes the latest studies on metabolomic and molecular mechanisms and systematically reviews the dysregulation characteristics of the five major metabolic networks. In terms of intervention for energy metabolism, this article summarizes the five strategies of glucose metabolism regulation, lipid metabolism intervention, mitochondria-targeted protection, gut microbiota rebalancing, and amino-acid optimization and assesses their application value and prospects for clinical translation, so as to provide a scientific basis for the treatment, alleviation, and even reversal of disease progression.
7.Optimization of purification process and component analysis of alkaloids from Zanthoxylum bungeanum Maxim
Heying YANG ; Caiping LUO ; Ting PENG ; Wenyi LIANG ; Songzhang SHEN ; Juan SU
Journal of Pharmaceutical Practice and Service 2025;43(2):75-81
Objective To optimize the process conditions and analyze the components of alkaloids from Zanthoxylum bungeanum Maxim(Z. bungeanum)using macroporous resin. Methods Combining single factor tests and orthogonal tests, the content of hydroxy-α-sanshool(HAS)and hydroxy-β-sanshool(HBS)were considered as indexes to determine the best process parameters. Ultra-performance liquid chromatography-quadrupole tandem time-of-flight mass spectrometry(UPLC-Q-TOF-MSE)was used to identify the structures of alkaloids. Results The optimal conditions were Mitsubishi HP-20 macroporous resin, the loading solution concentration was 0.2 g crude drug/ml, the ratio of crude drug to resin volume was 1 g∶2.5 ml, the diameter/height ratio of resin column was 1∶7, the dynamic adsorption flow rate was 4 times of bed volume(BV)per hour, and the adsorption time was 1 h. Impurities were removed by using 2 BV of 20% ethanol, 5 BV of 80% ethanol was used to elution, and the content of HAS and HBS was 4.71% and 1.02%, respectively. A total of 20 alkaloids were identified from Z. bungeanum. Conclusion This method was stable and feasible, obtaining high purity and various kinds of alkaloids, which could be used for the enrichment and purification of alkaloids from Z. bungeanum.
8.Effect of Shenge Bushen Capsules and Its Polysaccharides and Flavonoids on Precocious Puberty in Young Mice
Hong SUN ; Fan LEI ; Chenggong LI ; Shixian HU ; Weihua WANG ; Bin REN ; Juan HAO ; Rui LUO ; Lijun DU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(1):95-103
ObjectiveTo explore the effect of Shenge Bushen Capsules (SBC) on sexual development in normal 3-week-old mice. MethodsThe experiment consisted of two parts. In the first part, mice were divided into four groups: The control group and the low, medium, and high-dose SBC groups (234.7, 469.4, 938.7 mg·kg-1, respectively). In the second part, mice were divided into four groups: Control group, Pseudostellariae Radix polysaccharide (PRP) group, total flavonoids group, and SBC group, all receiving a dose of 469.4 mg·kg-1. After 7 days of administration, the vaginal opening of female mice and the descent of testes and scrotum in male mice, as well as the ovarian and testicular organ indices, were observed. After 4 weeks of administration, female and male mice were housed together for 2 days, and the pregnancy rate of females was monitored. After delivery, the pregnant female mice continued receiving the treatment for 4 weeks, and the sexual development of their offspring, including vaginal opening, testicular descent, and organ indices of ovaries and testes, was observed. Serum sex hormones were measured by enzyme-linked immunosorbent assay (ELISA), and the expression of gonadotropin-releasing hormone (GnRH) and growth hormone (GH) proteins in the hypothalamus was assessed by Western blot. ResultsCompared with the control group, there was no significant effect on the vaginal opening of female mice or the descent of testes in male mice after 7 days of SBC administration. After 4 weeks of administration, the pregnancy rate in the low-dose group was significantly reduced (P<0.05), but no significant effects were observed in the other groups. The three doses of SBC did not significantly affect the ovarian or testicular organ indices, and there was no significant upregulation in the expression of GnRH or GH in the hypothalamus. The primary component of SBC, Pseudostellariae Radix polysaccharide, significantly reduced the vaginal opening in female mice after 7 days of administration (P<0.05). After 4 weeks, the serum estradiol levels of non-pregnant female mice were decreased (P<0.05), but there was no significant effect on the expression of GnRH or GH proteins in the hypothalamus of either male or female mice. Additionally, there were no significant effects on precocious puberty indicators, such as vaginal opening and testicular descent, in the offspring mice. ConclusionSBC does not significantly promote precocious puberty in young mice, and it does not have any noticeable effects on the pregnancy rate of adult mice or the sexual development of their offspring.
9.Analysis of health-related lifestyles among primary and secondary school students in nutrition improvement program regions of China between 2021 and 2023
Chinese Journal of School Health 2025;46(6):788-791
Objective:
To analyze the features of unhealthy lifestyle patterns among primary and secondary school students in the nutrition improvement program for rural compulsory education students (NIPRCES) areas in China in 2021 and 2023, so as to provide data support for lifestyle promotion and healthy development among primary and secondary school students.
Methods:
Adopting a cluster random sampling method, data on primary and secondary students aged 7-15 years from nutrition and health surveillance of China NIPRCES in 2021 and 2023 were collected. The prevalence of unhealthy lifestyles among primary and secondary students such as physical inactivity, outdoor inactivity, excessive screen time, and sleep deprivation by gender, school section, urban/rural, and region were analyzed. The reporting rates of the above indicators among primary and secondary students were compared by Chi-square test.
Results:
In 2021 and 2023, the rates of moderate to vigorous physical inactivity among primary and secondary school students were 79.2% and 80.4%, the rates of outdoor inactivity were 42.8% and 49.3%, the rates of excessive video time were 2.6% and 2.9%, the rates of sleep deprivation were 32.9% and 22.6%, and the differences were statistically significant( χ 2=51.86,1 071.48,18.36,3 296.99, P <0.05). In 2023, the rate of outdoor inactivity for primary and secondary students increased by 6.5 percentage points compared with 2021, and the rate of sleep deprivation decreased by 10.3 percentage points compared with that in 2021. In 2021 and 2023, the reporting rates of moderate to vigorous physical inactivity, outdoor inactivity, and sleep deprivation among girls and junior high school students were higher than those among boys ( χ 2=174.41,180.11; 175.75, 85.46 ;92.22,151.35) and elementary school students ( χ 2=136.64,5.75; 40.55,4.71;162.80,3 291.61); the reporting rates of moderate to vigorous physical inactivity( χ 2=194.43,118.60) and sleep deprivation ( χ 2=969.66,983.72) among urban students were higher than those among rural students; the reporting rates of excessive video time for boys and junior high school students were higher than those for girls ( χ 2=103.62,84.85) and elementary school students ( χ 2=810.09,626.51)( P <0.05). From a regional distribution perspective, the reporting rates of moderato to vigorous physical inactivity, outdoor inactivity, and excessive video time among primary and seconday school students in the central and western regions were lower than those in the eastern region ( χ 2= 663.44,302.78; 356.97,82.10;50.89,81.83) ( P <0.05).
Conclusions
Unhealthy lifestyles remain prevalent among primary and secondary students in NIPRCES areas of China. These findings underscore the need to strengthen policy implementation for promoting healthy lifestyles among primary and secondary school students.
10.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test


Result Analysis
Print
Save
E-mail