AIM: To investigate the global research status, hotspots, and trends of exosome studies in ophthalmology, providing a theoretical foundation and constructive references for future research, and promoting in-depth development in this field.METHODS: Relevant literature on exosomes in ophthalmology published up to May 20, 2024, was retrieved from the China National Knowledge Infrastructure(CNKI), Web of Science Core Collection, and PubMed databases. Visual analyses of publication countries, institutions, authors, high-frequency keywords, burst keywords, and timelines were performed using CiteSpace 6.3.R1 and VOSviewer software.RESULTS: A total of 37 Chinese articles and 548 English articles were included. The top five countries in terms of publication volume were the United States(130 articles), China(80 articles), South Korea(24 articles), the United Kingdom(20 articles), and Japan(19 articles). The leading foreign institutions were the University of California System, Duke University, and Harvard University, while the top domestic institutions were Qingdao University, the Department of Ophthalmology at the First Affiliated Hospital of Jinan University, and the School of Physical Education and Sports Science at Beijing Normal University. Analysis of Chinese and English high-frequency and burst keywords indicated that global research hotspots on exosomes in ophthalmology primarily focus on dry eye, extracellular vesicles, mesenchymal stem cells and their derived exosomes, ocular surface diseases, ocular surface inflammation, biomarkers, retinal protection, immune eye diseases, uveitis, degenerative eye diseases, macular degeneration, diabetic retinopathy, neovascularization, thyroid-associated ophthalmopathy, and glaucoma, while English high-frequency words mainly were dry eye, dry eye disease, delivery, regenerative medicine, uveal melanoma, protein, and transplantation. Research has evolved from initial basic biological studies to exploring the pathogenesis of ocular diseases and advancing toward novel diagnostic and therapeutic approaches.CONCLUSION: Over the past 5 a, research on exosomes in ophthalmology has grown rapidly. Exosomes, as novel biomarkers and potential therapeutic targets, have become central to studies on the pathogenesis and clinical applications of ophthalmic diseases. Their roles in the diagnosis, treatment, and prevention of these diseases represent promising directions for future research.

OBJECTIVE To evaluate the quality of evidence in the systematic evaluation/meta-analysis of traditional Chinese medicine （TCM） for diabetes retinopathy （DR） based on the GRADE system. METHODS Chinese and English databases were searched to obtain the relevant studies of systematic evaluation/meta-analysis of traditional Chinese medicine in the treatment of DR. The search time was from the establishment of each database to January 13th， 2024. According to the inclusion and exclusion criteria， literature screening was conducted. After extracting relevant information from the included literature， the GRADE system was used to evaluate the quality level of the evidence body in the included studies， and the evidence of the outcome indicators was integrated and summarized. RESULTS A total of 51 studies were ultimately included， encompassing 135 outcome indexes. Among these， 19 indicators （14.1%） were of high quality， 87 （64.4%） were of medium quality， 26 （19.3%） were of low quality， and 3 （2.2%） were of very low quality. Overall， the evidence quality of the outcome indicators in the included studies was medium to low quality. The integrated results of evidence on the efficacy of outcome indexes showed that compared with conventional Western medicine， calcium dobesilate or placebo， TCM had significant advantages in improving overall efficacy， reducing bleeding spot area， reducing macular foveal thickness， and increasing visual improvement rate. In addition，the combination of TCM and conventional Western medicine or calcium dobesilate was significantly more effective than using conventional Western medicine or calcium dobesilate alone. CONCLUSIONS The overall quality of the evidence in the systematic evaluation/meta-analysis study on the treatment of DR with TCM is medium to low quality. Based on existing research findings， TCM demonstrates good clinical efficacy in the treatment of DR.

OBJECTIVE To re-evaluate the use of systematic evaluation/meta-analysis of anti-VEGF drugs in the treatment of diabetic macular oedema （DME）， aiming to provide evidence-based support for the clinical application of this medication. METHODS A comprehensive search was conducted across a range of databases， including CNKI， Wanfang data， VIP， CBM， PubMed， Web of Science， Embase， and Cochrane Library. The objective was to identify systematic evaluation/meta-analysis of anti- VEGF drugs for DME， with search time from the inception of the databases to March 2024. The report quality， methodological quality， and evidence quality were assessed by using PRISMA2020 statement， AMSTAR2 scale and GRADE tool. A comprehensive analysis of systematic evaluation/meta-analysis results was also conducted. RESULTS A total of 22 articles were included. According to the PRISMA2020 statement evaluation， 13 studies provided relatively complete information （≥21 points）， while 9 studies had information deficiencies （18-＜21 points）. The AMSTAR 2 scale evaluation revealed that 21 studies had very low methodological quality， and one study had low methodological quality. The GRADE tool evaluation showed that out of 89 outcome indicators， 28（ 31.46%） were classified as high-quality evidence， 34（ 38.20%） as moderate-quality evidence， 24（ 26.97%） as low- quality evidence， and 3 （3.37%） as very low-quality evidence. The comprehensive quality analysis results demonstrated that， compared with laser photocoagulation， anti-VEGF drugs significantly enhanced the improvement in best-corrected visual acuity （BCVA）， as well as significant change in retinal thickness at 1 and 6 months， and 1 and 2 years post-treatment， and also in BCVA and retinal thickness at 1， 3， and 6 months post-treatment （P＜0.05）. Compared with placebo， patients treated with anti-VEGF drugs showed significant improvement in BCVA after 1 year of treatment （P＜0.05）. However， when compared with corticosteroid drugs， patients treated with anti-VEGF drugs exhibited a significant increase in retinal thickness after 6 months of treatment （P＜0.05）. Compared with corticosteroid drugs， the incidence of adverse events related to the eyes， cataract formation and intraocular pressure were significantly decreased in patients treated with anti-VEGF drugs （P＜0.05）. Compared with laser photocoagulation， the incidence of ocular adverse events was significantly decreased in patients treated with anti-VEGF drugs， while the incidence of fatal adverse events was significantly increased （P＜0.05）. CONCLUSIONS Anti-VEGF therapy for DME may possess certain advantages in terms of efficacy and safety， but it is associated with a higher risk of fatal adverse events； the evidence included in systematic reviews/meta-analyses is of moderate to high quality.

BACKGROUND:The guinea pig is considered to be the most useful spontaneous model for evaluating primary osteoarthritis in humans because of its similar knee joint structure and close histopathologic features to those of humans. OBJECTIVE:To investigate the pathological process of spontaneous knee osteoarthritis in guinea pigs by analyzing the histopathology of the total knee joint of guinea pigs aged 1 to 18 months. METHODS:Eight healthy female Hartley guinea pigs in each age group of 1,6,10,14,16,and 18 months old were selected.The quadriceps femoris was taken for hematoxylin-eosin staining,and the total knee joint was stained with hematoxylin-eosin and toluidine blue.The histopathology of the cartilage,subchondral bone,synovium,meniscus,and muscles were observed under light microscope.Mankin's score and synovitis score were compared,and the correlation analysis was conducted. RESULTS AND CONCLUSION:As the guinea pig age increased,the Mankin's score increased(P<0.05),and the pathological score of synovitis also gradually increased(P<0.05),and there was a significant positive correlation between the two(r=0.641,P<0.001).The incidence rate of subchondral bone marrow lesion in 18-month-old guinea pigs was 50%,and the incidence of meniscus injury was 37.5%.In addition,osteophyte and narrowing of the joint space were observed,and only a few guinea pigs had inflammation in the quadriceps femoris.To conclude,guinea pigs develop significant cartilage defects,synovial inflammation,subchondral bone lesions,meniscus injury,osteophyte formation,and joint space narrowing as they age,all of which are similar to the pathological processes of primary knee osteoarthritis in humans,making it an ideal model of spontaneous knee osteoarthritis.

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Traditional Chinese medicine(TCM) capable of clearing heat and removing toxin is most commonly used in clinical practice and has the effect of removing fire-heat and toxin. Studies have shown that most of the Ilex plants have the effect of clearing heat and removing toxin, among which the varieties of I. cornuta, I. pubescens, I. rotunda, I. latifolia, and I. chinensis are most widely used. These plants generally contain triterpenoids and their glycosides, alkaloids, flavonoids, phenylpropanoids, and other chemical components, especially pentacyclic triterpenoids. According to their skeletons, pentacyclic triterpenoids can be divided into the oleanane type, the ursane type, the lupinane type, etc. Among them, ursane-type components are the most abundant, and 136 species have been found so far. These components have been proved to have pharmacological effects such as anti-inflammatory, anti-tumor, hypolipidemic, anti-thrombosis, cardiomyocyte-protective, antibacterial, and hepatoprotective effects. Therefore, this paper systematically reviews the domestic and foreign literature on Ilex plants with a focus on the research progress on pentacyclic triterpenoids and their pharmacological activities, aiming to provide reference for the development of TCM resources with the effect of clearing heat and removing toxin.
Ilex/chemistry* ; Plants, Medicinal/chemistry* ; Pentacyclic Triterpenes/pharmacology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/pharmacology* ; Humans ; Animals

Gegen Qinlian Decoction(GQD) is a classic prescription for the clinical treatment of ulcerative colitis(UC). This study, based on the differences in efficacy observed in UC mice under different level of bile acids treated with GQD, aims to clarify the impact of bile acids on UC and its therapeutic effects. It further investigates the expression of bile acid receptors in the liver of UC mice, and preliminarily reveals the mechanism through which GQD affects bile acid synthesis in the treatment of UC. A UC mouse model was established using dextran sulfate sodium(DSS) induction. The efficacy of GQD was evaluated by assessing the general condition, disease activity index(DAI) score, colon length, and histopathological changes in colon tissue via hematoxylin and eosin(HE) staining. ELISA and Western blot were used to evaluate the inflammatory response in colon tissue. The total bile acid(TBA) level and liver damage were quantified using an automatic biochemistry analyzer. The expression levels of bile acid receptors and bile acid synthetases in liver tissue were detected by Western blot and RT-qPCR. The results showed that compared with the model group, GQD treatment significantly improved the DAI score, colon shortening, and histopathological damage in UC mice. The levels of pro-inflammatory factors TNF-α and IL-6 in the colon were significantly reduced. Serum TBA levels were significantly decreased, while alkaline phosphatase(ALP) levels significantly increased. After administration of cholic acid(CA), UC symptoms in the CA + GQD group were significantly aggravated compared with the GQD group. The DAI score, degree of weight loss, colon injury, serum TBA, and liver injury markers all increased significantly. However, compared with the CA group, the CA + GQD group showed a marked reduction in TBA levels and a significant improvement in UC-related symptoms, indicating that GQD can alleviate UC damage exacerbated by CA. Further investigation into the expression of bile acid receptors and synthetases in the liver showed that under GQD treatment, the expression of farnesoid X receptor(FXR) and small heterodimer partner(SHP) significantly increased, while the expression of G protein-coupled receptor 5(TGR5) and cholesterol 7α-hydroxylase(Cyp7A1) significantly decreased. These findings suggest that GQD may affect bile acid receptors and synthetases, inhibiting bile acid synthesis through the FXR/SHP pathway to treat UC.
Animals ; Colitis, Ulcerative/genetics* ; Bile Acids and Salts/biosynthesis* ; Drugs, Chinese Herbal/administration & dosage* ; Mice ; Male ; Humans ; Receptors, Cytoplasmic and Nuclear/metabolism* ; Colon/metabolism* ; Disease Models, Animal ; Liver/metabolism* ; Mice, Inbred C57BL

The AP2/ERF transcription factor family is a class of transcription factors widely present in plants, playing a crucial role in regulating flowering, flower development, flower opening, and flower senescence. Based on transcriptome data from flower, leaf, and stem samples of two Lonicera macranthoides varieties, 117 L. macranthoides AP2/ERF family members were identified, including 14 AP2 subfamily members, 61 ERF subfamily members, 40 DREB subfamily members, and 2 RAV subfamily members. Bioinformatics and differential gene expression analyses were performed using NCBI, ExPASy, SOMPA, and other platforms, and the expression patterns of L. macranthoides AP2/ERF transcription factors were validated via qRT-PCR. The results indicated that the 117 LmAP2/ERF members exhibited both similarities and variations in protein physicochemical properties, AP2 domains, family evolution, and protein functions. Differential gene expression analysis revealed that AP2/ERF transcription factors were primarily differentially expressed in the flowers of the two L. macranthoides varieties, with the differentially expressed genes mainly belonging to the ERF and DREB subfamilies. Further analysis identified three AP2 subfamily genes and two ERF subfamily genes as potential regulators of flower development, two ERF subfamily genes involved in flower opening, and two ERF subfamily genes along with one DREB subfamily gene involved in flower senescence. Based on family evolution and expression analyses, it is speculated that AP2/ERF transcription factors can regulate flower development, opening, and senescence in L. macranthoides, with ERF subfamily genes potentially serving as key regulators of flowering duration. These findings provide a theoretical foundation for further research into the specific functions of the AP2/ERF transcription factor family in L. macranthoides and offer important theoretical insights into the molecular mechanisms underlying floral phenotypic differences among its varieties.
Plant Proteins/chemistry* ; Gene Expression Regulation, Plant ; Transcription Factors/chemistry* ; Lonicera/classification* ; Flowers/metabolism* ; Phylogeny ; Gene Expression Profiling ; Multigene Family

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test