Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10 /L vs preoperative 3.07×10 /L, P<0.001), with significant upregulation of CD11b (7.30×10 /L vs preoperative 3.05×10 /L, P<0.001) and CD54 (7.15×10 /L vs preoperative 2.99×10 /L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10 /L vs preoperative 1.12×10 /L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10 /L vs preoperative 1.12×10 /L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.

ObjectiveTo investigate the uric acid-lowering effects and mechanisms of acacetin on hyperuricemia （HUA） in mice. MethodsOteracil potassium and adenine were used to establish the mouse model of HUA. Male Kunming mice （n=48） were randomized into six groups： control， model， low-dose （12.5 mg·kg^-1） acacetin， medium-dose （25 mg·kg^-1） acacetin， high-dose （50 mg·kg^-1） acacetin， and allopurinol （10 mg·kg^-1）. Each group received continuous gavage administration for 21 days. An automatic biochemical analyzer was used to measure the levels of uric acid （UA）， creatinine （Cr）， urea nitrogen （BUN）， alanine aminotransferase （ALT） and aspartate aminotransferase （AST）. Additionally， the activity of xanthine oxidase （XOD） in the liver and the levels of tumor necrosis factor （TNF）-α， interleukin （IL）-1β， and IL-18 in the serum were measured by enzyme-linked immunosorbent assay （ELISA）. Pathological changes in the renal tissue were observed by hematoxylin-eosin （HE） staining. Western blot was employed to determine the levels of glucose transporter 9 （GLUT9）， urate transporter 1 （URAT1）， phospho-NF-κB p65 （p-NF-κB p65）， and nucleotide-binding oligomerization domain-like receptor pyrin domain-containing 3 （NLRP3） in the renal tissue. ResultsCompared with the control group， the model group showed elevated levels of UA， Cr， BUN， ALT， and AST， increased activity of XOD in the liver（P<0.01）， raised levels of TNF-α， IL-1β and IL-18 in the serum（P<0.01）， and significantly up-regulated expression of GLUT9， URAT1， p-NF-κB p65， and NLRP3 in the renal tissue（P<0.01）. Compared with the model group， acacetin reduced the UA level in a dose-dependent manner， significantly improved liver and kidney functions， decreased the XOD activity in the liver， ameliorated the pathological changes in the renal tissue， down-regulated the expression of GLUT9， URAT1， p-NF-κB p65 and NLRP3 in the renal tissue（P<0.01）， and lowered the levels of TNF-α， IL-1β， and IL-18 in the serum（P<0.01）. ConclusionAcacetin can ameliorate HUA by decreasing uric acid production， increasing uric acid excretion， and inhibiting the NF-κB/NLRP3 signaling pathway. Therefore， acacetin may be a potential drug for the treatment of HUA.

Objective To introduce the causes of accidents and the diagnosis and treatment of two patients with radiation-induced skin injury admitted to our hospital in 2023, and to provide a reference for the clinical treatment of subsequent radiation-induced skin injury. Methods The clinical treatment process of two patients with acute skin injury caused by external radiation exposure were summarized and analyzed. Results The exposure history of the two patients was reconstructed, the flaw detection scenario was simulated, the biological dose and hand skin exposure dose were estimated, and the infrared thermal imaging device was used for dynamic monitoring. A comprehensive analysis was conducted based on clinical manifestations and other data. The diagnosis of “Xie” was excessive exposure combined with acute radiation-induced skin injury on both hands (Grade IV for the right hand palm, index finger, and middle finger and Grade II for the left hand little finger). The diagnosis of “Hao” was acute radiation-induced skin injury on both hands (Grade I). The two patients received different clinical treatment measures: “Xie” was treated with both local and systemic therapies, while “Hao” was mainly treated with systemic therapy. Conclusion After systematic and effective treatment, the radiation-induced skin injuries healed in both patients.

ObjectiveTo construct a risk prediction model for frequent acute exacerbations of chronic obstructive pulmonary disease （COPD） under disease-syndrome combination， thus providing decision support for precise clinical intervention. MethodsA total of 2 029 patients with acute exacerbations of COPD admitted to the First Affiliated Hospital of Anhui University of Chinese Medicine from January 2020 to August 2024 were retrospectively included. These patients were classified into groups of frequent acute exacerbations （≥2 times/year） and infrequent acute exacerbations （<2 times/year） according to the hospitalization times per year. Risk factors were screened by LASSO regression combined with logistic regression， and a nomogram model was constructed. The model performance was assessed based on the area under the curve （AUC）， calibration curves， and decision curve analysis （DCA）. ResultsThe differences in baseline characteristics between the frequent acute exacerbations group （1 196 cases） and infrequent acute exacerbations group （833 cases） were not statistically significant. LASSO regression combined with multivariate logistic regression screened the following independent risk factors： body mass index （BMI）， hospitalization days， number of smoking years， place of residence， use of noninvasive ventilators， oxygen-demanding therapy， liver cirrhosis， use of systemic glucocorticosteroids， and traditional Chinese medicine syndrome （phlegm and stasis obstructing the lung）. The nomogram model showed good discrimination and calibration in both the training set （AUC=0.748） and validation set （AUC=0.774）. ConclusionThe risk prediction model for frequent acute exacerbations of COPD， integrating traditional Chinese medicine syndrome， constructed in this study has high accuracy. It can provide a scientific basis for early clinical identification of high-risk patients and individualized intervention.

BACKGROUND:Autophagy,as a key regulatory mechanism of cell development,plays an important role in different stages of embryonic development.The mechanism of how autophagy regulates embryonic development through histone modifications is currently unclear.OBJECTIVE:To investigate the effect of autophagy on trimethylation of lysine 4 on histone H3(H3K4me3)modification in embryos and its effect on embryonic development.METHODS:Mouse fertilized eggs were divided into control and autophagy inhibitor-treated groups(chloroquine phosphate-treated group and 3-methyladenine-treated group),and cultured in vitro to different periods of time,and were then classified as early 2-cell embryos,middle 2-cell embryos,late 2-cell embryos,4-cell embryos,8-cell embryos,morula stage,and blastocyst stage.Levels of reactive oxygen species,autophagy marker proteins LC3B and P62,DNA loss marker γH2AX,and H3K4me3 were analyzed by immunofluorescence assay in late 2-cell embryos of each group.Changes in H3K4me3 modification in late 2-cell embryos of each group were detected by CUT&Tag.RESULTS AND CONCLUSION:(1)Autophagy inhibition caused embryo development arrest.(2)There was no significant difference in reactive oxygen species and γH2AX between the autophagy inhibitor-treated groups and control group.(3)H3K4me3 levels were significantly elevated in the autophagy inhibitor-treated group compared with the control group.(4)CUT&Tag results showed a significantly increased H3K4me3 peaks on the proximal promoter region of the genes after autophagy inhibition and an increase of H3K4me3-specific modification genes.These findings suggest that autophagy may affect embryonic development by regulating the level of H3K4me3 modification.

BACKGROUND:Autophagy,as a key regulatory mechanism of cell development,plays an important role in different stages of embryonic development.The mechanism of how autophagy regulates embryonic development through histone modifications is currently unclear.OBJECTIVE:To investigate the effect of autophagy on trimethylation of lysine 4 on histone H3(H3K4me3)modification in embryos and its effect on embryonic development.METHODS:Mouse fertilized eggs were divided into control and autophagy inhibitor-treated groups(chloroquine phosphate-treated group and 3-methyladenine-treated group),and cultured in vitro to different periods of time,and were then classified as early 2-cell embryos,middle 2-cell embryos,late 2-cell embryos,4-cell embryos,8-cell embryos,morula stage,and blastocyst stage.Levels of reactive oxygen species,autophagy marker proteins LC3B and P62,DNA loss marker γH2AX,and H3K4me3 were analyzed by immunofluorescence assay in late 2-cell embryos of each group.Changes in H3K4me3 modification in late 2-cell embryos of each group were detected by CUT&Tag.RESULTS AND CONCLUSION:(1)Autophagy inhibition caused embryo development arrest.(2)There was no significant difference in reactive oxygen species and γH2AX between the autophagy inhibitor-treated groups and control group.(3)H3K4me3 levels were significantly elevated in the autophagy inhibitor-treated group compared with the control group.(4)CUT&Tag results showed a significantly increased H3K4me3 peaks on the proximal promoter region of the genes after autophagy inhibition and an increase of H3K4me3-specific modification genes.These findings suggest that autophagy may affect embryonic development by regulating the level of H3K4me3 modification.

BACKGROUND:The guinea pig is considered to be the most useful spontaneous model for evaluating primary osteoarthritis in humans because of its similar knee joint structure and close histopathologic features to those of humans. OBJECTIVE:To investigate the pathological process of spontaneous knee osteoarthritis in guinea pigs by analyzing the histopathology of the total knee joint of guinea pigs aged 1 to 18 months. METHODS:Eight healthy female Hartley guinea pigs in each age group of 1,6,10,14,16,and 18 months old were selected.The quadriceps femoris was taken for hematoxylin-eosin staining,and the total knee joint was stained with hematoxylin-eosin and toluidine blue.The histopathology of the cartilage,subchondral bone,synovium,meniscus,and muscles were observed under light microscope.Mankin's score and synovitis score were compared,and the correlation analysis was conducted. RESULTS AND CONCLUSION:As the guinea pig age increased,the Mankin's score increased(P<0.05),and the pathological score of synovitis also gradually increased(P<0.05),and there was a significant positive correlation between the two(r=0.641,P<0.001).The incidence rate of subchondral bone marrow lesion in 18-month-old guinea pigs was 50%,and the incidence of meniscus injury was 37.5%.In addition,osteophyte and narrowing of the joint space were observed,and only a few guinea pigs had inflammation in the quadriceps femoris.To conclude,guinea pigs develop significant cartilage defects,synovial inflammation,subchondral bone lesions,meniscus injury,osteophyte formation,and joint space narrowing as they age,all of which are similar to the pathological processes of primary knee osteoarthritis in humans,making it an ideal model of spontaneous knee osteoarthritis.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Heart failure is a complex clinical syndrome and pediatric heart failure (PHF) has a high mortality rate. Early diagnosis is crucial for treatment and management of PHF. In clinical practice, various tests and examinations play a key role in the diagnosis of PHF, including continuously updated biomarkers, echocardiography, and cardiac magnetic resonance imaging. This article focuses on summarizing relevant research on biomarkers, examinations, combined testing, clinical models, and the grading and staging of PHF diagnosis, aiming to provide insights and directions for the diagnosis of PHF.
Humans ; Heart Failure/diagnosis* ; Child ; Biomarkers/blood* ; Echocardiography ; Magnetic Resonance Imaging

OBJECTIVES: To evaluate the effectiveness of single-balloon and double-balloon enteroscopy in diagnosing pediatric small bowel diseases and assess the diagnostic efficacy of computed tomography enterography (CTE) for small bowel diseases using enteroscopy as the reference standard. METHODS: Clinical data from 576 children who underwent enteroscopy at Hunan Children's Hospital between January 2017 and December 2023 were retrospectively collected. The children were categorized based on enteroscopy type into the single-balloon enteroscopy (SBE) group (n=457) and double-balloon enteroscopy (DBE) group (n=119), and the clinical data were compared between the two groups. The sensitivity and specificity of CTE for diagnosing small bowel diseases were evaluated using enteroscopy results as the standard. RESULTS: Among the 576 children, small bowel lesions were detected by enteroscopy in 274 children (47.6%).There was no significant difference in lesion detection rates or complication rates between the SBE and DBE groups (P>0.05), but the DBE group had deeper insertion, longer procedure time, and higher complete small bowel examination rate (P<0.05). The complication rate during enteroscopy was 4.3% (25/576), with 18 cases (3.1%) of mild complications and 7 cases (1.2%) of severe complications, which improved with symptomatic treatment, surgical, or endoscopic intervention. Among the 412 children who underwent CTE, the sensitivity and specificity for diagnosing small bowel diseases were 44.4% and 71.3%, respectively. CONCLUSIONS SBE and DBE have similar diagnostic efficacy for pediatric small bowel diseases, but DBE is preferred for suspected deep small bowel lesions and comprehensive small bowel examination. Enteroscopy in children demonstrates relatively good overall safety. CTE demonstrates relatively low sensitivity but comparatively high specificity for diagnosing small bowel diseases.
Retrospective Studies ; Treatment Outcome ; Double-Balloon Enteroscopy/statistics & numerical data* ; Single-Balloon Enteroscopy/statistics & numerical data* ; Humans ; Male ; Female ; Child ; Operative Time ; Tomography, X-Ray Computed/statistics & numerical data* ; Sensitivity and Specificity ; Intestine, Small/surgery* ; Intestinal Diseases/surgery*