OBJECTIVE: To explore the genetic etiology of 46 Chinese pedigrees affected with Hereditary multiple exostoses (HME) and provide genetic counseling and reproductive intervention. METHODS: Whole-exome sequencing and Sanger sequencing were carried out on 87 patients from the 46 pedigrees to analyze the variants of EXT1 and EXT2 genes. Pathogenicity of the variants was assessed based on the guidelines from the American College of Medical Genetics and Genomics and Association for Molecular Pathology (ACMG/AMP). Prenatal diagnosis and preimplantation genetic testing (PGT) were provided for couples with identified pathogenic mutations. This study was approved by the Medical Ethics Committee of the hospital (Ethics No.: LL-SC-SG-2014-010). RESULTS: In total 17 and 22 pathogenic variants were respectively identified in the EXT1 and EXT2 genes, among which 5 EXT1 and 12 EXT2 variants were unreported previously. Three patients with no family history were found to harbor de novo variants of the EXT1 gene. Twenty nine couples had opted for PGT or underwent prenatal diagnosis following natural conception, and 17 healthy babies were born. CONCLUSION This study has clarified the genetic etiology of 45 HME pedigrees and identified 17 novel variants, which has enriched the mutational spectrum of the EXT1 and EXT2 genes. Reproductive intervention through PGT and prenatal diagnosis have prevented the recurrence of HME in these families.
Humans ; Female ; Male ; Pedigree ; Exostoses, Multiple Hereditary/diagnosis* ; N-Acetylglucosaminyltransferases/genetics* ; Adult ; Exostosin 1 ; Asian People/genetics* ; Genetic Testing ; Exostosin 2 ; Mutation ; China ; Prenatal Diagnosis ; Pregnancy ; Genetic Counseling ; Preimplantation Diagnosis ; Exome Sequencing ; East Asian People

This study aims to investigate the anti-tumor effect and mechanism of Guiqi Yiyuan Ointment combined with cisplatin on Lewis lung carcinoma-bearing mice via the protein kinase RNA-like endoplasmic reticulum kinase(PERK)/eukaryotic translation initiation factor 2α(eIF2α)/activated transcription factor 4(ATF4)/C/EBP homologous protein(CHOP) signaling pathway. Sixty SPF-grade male C57BL/6 mice were selected and assigned into a blank group and a modeling group by the random number table method. After modeling of the Lewis lung carcinoma, the mice in the modeling group were randomized into model, cisplatin(5 mg·kg~(-1), once a week), and low-, medium-, and high-dose(1.7, 3.5, and 7.05 g·kg~(-1), respectively, once a day) Guiqi Yiyuan Ointment+cisplatin(5 mg·kg~(-1)) groups(n=10). After 14 days of continuous intervention, the spleen, thymus, and tumor samples of the mice were collected, weighed, and recorded, and the spleen index, thymus index, and tumor suppression rate were calculated. Hematoxylin-eosin(HE) staining was employed to observe the pathological changes in the tumor tissue. The morphological changes of the endoplasmic reticulum of tumor cells were observed by transmission electron microscopy. The positive expression of phosphorylated eIF2α(p-eIF2α) and ATF4 in the tumor tissue was detected by immunofluorescence. Western blot was employed to determine the protein levels of phosphorylated PERK(p-PERK), p-eIF2α, ATF4, CHOP, B-cell lymphoma-2(Bcl-2), Bcl-2-associated X protein(Bax), cyclin-dependent kinase inhibitor 1A(p21), and cyclinD1 in the tumor tissue. Real-time fluorescent quantitative PCR was employed to determine the mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, Bcl-2, p21, and cyclinD1 in the tumor tissue. Compared with the blank group, the model group showed decreases in spleen index and thymus index(P<0.05). Compared with the model group, the cisplatin group showed decreases in spleen index and thymus index(P<0.05), and the medium-and high-dose Guiqi Yiyuan Ointment+cisplatin groups presented increases in spleen index and thymus index(P<0.05). In addition, the treatment groups all showed decreased tumor mass(P<0.05), increased tumor cell lysis and nuclear rupture, widened gap between rough endoplasmic reticulum, enhanced average fluorescence intensity of p-eIF2α and ATF4(P<0.05), up-regulated protein levels of p-PERK/PERK, p-eIF2α/eIF2α, ATF4, CHOP, Bax, and p21(P<0.05), down-regulated protein and mRNA levels of Bcl-2 and cyclinD1(P<0.05), and up-regulated mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, and p21(P<0.05). Compared with the cisplatin group, the combination groups showed increases in spleen index and thymus index(P<0.05) as well as mean optical density(P<0.05), and the high-dose Guiqi Yiyuan Ointment+cisplatin group showed decreased tumor mass(P<0.05). In addition, the medium-and high-dose Guiqi Yiyuan Ointment+cisplatin groups showcased enhanced average fluorescence intensity of p-eIF2α and ATF4(P<0.05), up-regulated protein levels of p-PERK/PERK, p-eIF2α/eIF2α, ATF4, CHOP, Bax, and p21(P<0.05), down-regulated protein and mRNA levels of Bcl-2 and cyclinD1(P<0.05), and up-regulated mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, and p21(P<0.05). In conclusion, Guiqi Yiyuan Ointment combined with cisplatin can effectively inhibit the growth of Lewis lung carcinoma in mice by regulating the expression of proteins related to the PERK/eIF2α/ATF4/CHOP signaling pathway and promoting cell cycle arrest and apoptosis.
Animals ; Cisplatin/administration & dosage* ; Activating Transcription Factor 4/genetics* ; Eukaryotic Initiation Factor-2/genetics* ; eIF-2 Kinase/genetics* ; Carcinoma, Lewis Lung/pathology* ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Mice ; Signal Transduction/drug effects* ; Mice, Inbred C57BL ; Transcription Factor CHOP/genetics* ; Ointments/administration & dosage* ; Humans ; Cell Proliferation/drug effects* ; Antineoplastic Agents/administration & dosage*

Prostate cancer(PCa) is a common malignant tumor among elderly men, with high incidence and mortality rates worldwide, posing a serious threat to human health. Traditional treatments face limitations, highlighting the urgent need for novel therapeutic strategies. Recent studies on the regulatory mechanisms of micro ribonucleic acid(microRNA, miRNA) in tumor development has identified miRNA as new targets for PCa diagnosis and treatment. Traditional Chinese medicine(TCM), with its multi-mechanism, multi-target, and multi-pathway regulatory properties, shows promising potential in miRNA-based PCa therapy. This review summarized recent findings on miRNA' roles in PCa and research progress of TCM intervention and found that a variety of miRNA played important regulatory roles in cell differentiation, proliferation, apoptosis, invasion, metastasis, immune microenvironment, and drug resistance, and their potential as biomarkers for PCa diagnosis, prognosis, and therapy, indicating the potential to be a biomarker for the diagnosis, prognosis evaluation, and treatment of PCa. The review concluded that the active components of TCM(terpenoids, flavonoids, alkaloids, and others) and compounds(Yishen Tonglong Decoction, Shenhu Decoction, Zhoushi Qiling Decoction, Fuzheng Yiliu Decoction, and Qilan Formula) could regulate the expression of their downstream target genes by acting on specific miRNA and affect the above biological behaviors of PCa cells, thus playing a role in the treatment of PCa. This review aims to provide a theoretical basis for miRNA as potential biomarkers and therapeutic targets for PCa and suggest new avenues for further development of targeted therapy strategies against miRNA.
Humans ; MicroRNAs/metabolism* ; Prostatic Neoplasms/metabolism* ; Male ; Drugs, Chinese Herbal/therapeutic use* ; Medicine, Chinese Traditional ; Animals ; Gene Expression Regulation, Neoplastic/drug effects*

This study developed a core outcome set(COS) for traditional Chinese medicine(TCM) interventions in diabetic peripheral neuropathy(DPN), standardizing evaluation metrics for TCM efficacy and providing a new framework for DPN treatment and management. A systematic search was conducted across databases, including CNKI, Wanfang, and PubMed, targeting clinical trial literature published between January 1, 2013, and January 1, 2023. The search focused on extracting outcome indicators and measurement tools used in TCM treatments for DPN. Retrospective data collection was performed from January 2018 to June 2023, involving 200 DPN patients hospitalized at the Department of Endocrinology of the First Affiliated Hospital of Anhui University of Chinese Medicine. Additionally, semi-structured interviews were conducted with inpatients, outpatients, their families, and nursing staff to further refine and enhance the list of outcome indicators. After two rounds of Delphi questionnaire survey and consensus meeting, a consensus was reached. The study initially retrieved 3 421 publications, of which 170 met the inclusion criteria after review. These publications, combined with retrospective analysis and semi-structured interviews, supplemented the list of indicators. After two rounds of Delphi surveys, experts agreed on 24 indicators and 6 measurement tools. The final COS determined by expert consensus meeting included 5 domains and 13 outcome indicators: neurological function signs, quality of life, TCM syndrome score, nerve conduction velocity, current perception threshold test, fasting blood glucose, 2 h postprandial blood glucose, glycated hemoglobin, complete blood count, urinalysis, liver function test, kidney function test, and electrocardiogram.
Humans ; Diabetic Neuropathies/drug therapy* ; Medicine, Chinese Traditional/methods* ; Drugs, Chinese Herbal/therapeutic use* ; Retrospective Studies ; Treatment Outcome ; Male ; Female

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the clinical characteristics and prognosis of primary pulmonary lymphoma (PPL). METHODS: The clinical data of 17 patients with PPL admitted to Gansu Provincial Hospital from January 2013 to June 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized. RESULTS: The median age of the 17 patients was 56 (29-73) years old. There were 8 males and 9 females. According to Ann Arbor staging system, there were 9 patients with stage I-II and 8 patients with stage III-IV. There were 14 patients with IPI score of 0-2 and 3 patients with IPI score of 3-4. All 17 patients had symptoms at the initial diagnosis, most of the first symptoms were cough, and 6 patients had B symptoms.Among the 17 patients, there were 8 cases of diffuse large B-cell lymphoma (DLBCL), 5 cases of mucosa-associated lymphoid tissue (MALT) lymphoma, 1 case of gray zone lymphoma (GZL), and 3 cases of Hodgkin's lymphoma (HL). 15 patients received chemotherapy, of which 3 cases received autologous hematopoietic stem cell transplantation(ASCT) and 3 cases received radiotherapy; 2 patients did not receive treatment. The median number of chemotherapy courses was 6(2-8). The short-term efficacy was evaluated, 12 patients achieved complete remission (CR) and 3 patients achieved partial remission (PR). The age, pathological subtype, sex, Ann Arbor stage, β₂-microglobulin(β₂-MG) level, lactate dehydrogenase(LDH) level were not correlated with CR rate (P >0.05), while IPI score was correlated with recent CR rate (P < 0.05 ). The median follow-up time was 31(2-102) months. One of the 12 CR patients died of COVID-19, and the rest survived. Among the 3 patients who did not reach CR, 1 died after disease progression, while the other 2 survived. One of the 2 untreated patients died one year after diagnosis. Both the median progression-free survival (PFS) time and overall survival (OS) time of the 17 patients were both 31 (2-102) months. CONCLUSION The incidence of PPL is low, and the disease has no specific clinical manifestations, which is easily missed and misdiagnosed. The pathological subtypes are mainly MALT lymphoma and DLBCL, and the treatment is mainly combined chemotherapy. The IPI score is related to the treatment efficacy.
Humans ; Middle Aged ; Male ; Female ; Adult ; Prognosis ; Aged ; Lung Neoplasms/therapy* ; Retrospective Studies ; Neoplasm Staging ; Lymphoma/therapy* ; Lymphoma, Large B-Cell, Diffuse

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*

Acute lung injury (ALI) has been a kind of acute and severe disease that is mainly characterized by systemic uncontrolled inflammatory response to the production of huge amounts of reactive oxygen species (ROS) in the lung tissue. Given the critical role of ROS in ALI, a Fe₃O₄ loaded bovine serum albumin (BSA) nanocluster (BF) was developed to act as a nanomedicine for the treatment of ALI. Combining with NIR irradiation, it exhibited excellent ROS scavenging capacity. Significantly, it also displayed the excellent antioxidant and anti-inflammatory functions for lipopolysaccharides (LPS) induced macrophages (RAW264.7), and Sprague Dawley rats via lowering intracellular ROS levels, reducing inflammatory factors expression levels, inducing macrophage M2 polarization, inhibiting NF-κB signaling pathway, increasing CD4⁺/CD8⁺ T cell ratios, as well as upregulating HSP70 and CD31 expression levels to reprogram redox homeostasis, reduce systemic inflammation, activate immunoregulation, and accelerate lung tissue repair, finally achieving the synergistic enhancement of ALI immunotherapy. It finally provides an effective therapeutic strategy of BF + NIR for the management of inflammation related diseases.

OBJECTIVES: To investigate the antioxidative mechanism of snake venom-derived protein C activator (PCA) in mitigating vascular endothelial cell injury. METHODS: Human umbilical vein endothelial cells (HUVECs) were cultured in DMEM containing 1.0 g/L D-glucose and exposed to hypoxia (1% O₂) for 6 h followed by reoxygenation for 2 h to establish a cell model of oxygen-glucose deprivation/reoxygenation (OGD/R). The cell model was treated with 2 μg/mL PCA alone or in combination with 2-ME2 (a HIF-1α inhibitor) or DMOG (a HIF-1α stabilizer), and intracellular production of reactive oxygen species (ROS) and protein expression levels of HIF-1α, BNIP3, and Beclin-1 were detected using DCFH-DA fluorescence probe, flow cytometry, and Western blotting. The OGD/R cell model was transfected with a BNIP3-specific siRNA or a scrambled control sequence prior to PCA treatment, and the changes in protein expressions of HIF-1α, BNIP3 and Beclin-1 and intracellular ROS production were examined. RESULTS: In the OGD/R cell model, PCA treatment significantly upregulated HIF-1α, BNIP3 and Beclin-1 expressions and reduced ROS production. The effects of PCA were obviously attenuated by co-treatment with 2-ME2 but augmented by treatment with DMOG (a HIF-1α stabilizer). In the cell model with BNIP3 knockdown, PCA treatment increased BNIP3 expression and decreased ROS production without causing significant changes in HIF-1α expression. Compared with HUVECs with PCA treatment only, the cells with BNIP3 knockdown prior to PCA treatment showed significantly lower Beclin-1 expression and higher ROS levels. CONCLUSIONS Snake venom PCA alleviates OGD/R-induced endothelial cell injury by upregulating HIF-1α/BNIP3 signaling to suppress ROS generation, suggesting its potential as a therapeutic agent against oxidative stress in vascular pathologies.
Humans ; Reactive Oxygen Species/metabolism* ; Hypoxia-Inducible Factor 1, alpha Subunit/metabolism* ; Human Umbilical Vein Endothelial Cells/drug effects* ; Membrane Proteins/metabolism* ; Proto-Oncogene Proteins/metabolism* ; Up-Regulation ; Cell Hypoxia ; Cells, Cultured ; Snake Venoms/chemistry* ; Beclin-1