The α7 nicotinic acetylcholine receptor (α7 nAChR) is a ligand-gated ion channel characterized by high Ca²⁺ permeability, rapid activation, and rapid desensitization. It is widely expressed in the nervous system and various non-neuronal cell types. α7 nAChR is involved in regulating neuronal excitability, synaptic transmission and plasticity, cognitive function, and inflammatory responses. These properties have made α7 nAChR a potential therapeutic target for neuropsychiatric and inflammatory diseases. In recent years, advances in cryo-electron microscopy have provided structural insights into α7 nAChR gating, ligand recognition, allosteric modulation, and allosteric activation. The receptor mainly undergoes transitions among resting, open, and desensitized states. Recent structural studies have further revealed asymmetric conformational changes and multiple intermediate states during receptor activation and recovery from desensitization. Conformational rearrangements in the extracellular domain-transmembrane domain coupling region and the pore-forming M2 helices are closely associated with channel opening and desensitization. However, structural characterization of the α7 nAChR gating cycle still largely depends on pharmacological stabilization. Open-state structures have been resolved in the presence of PNU-120596 or GAT107, whereas a high-resolution structure of the open state induced by acetylcholine alone remains to be determined. These physiological roles underpin the involvement of α7 nAChR in multiple disease processes. In the hippocampus, α7 nAChR regulates local neuronal circuits, theta oscillations, synaptic transmission, and synaptic plasticity, thereby contributing to learning, memory, attention, and other cognitive processes. In macrophages, microglia, and other immune-related cells, α7 nAChR activation regulates inflammatory responses and oxidative stress. These effects involve several signaling pathways, including Janus kinase 2 (JAK2)/STAT3, phosphoinositide 3-kinase (PI3K)/AKT, and NF-κB signaling, as well as regulation of the NLRP3 inflammasome and IL-1β production. Such anti-inflammatory effects may also contribute to α7 nAChR-mediated neuroprotection. Although several compounds targeting α7 nAChR have entered clinical studies, no α7 nAChR-selective drug has been approved for clinical use. Limited clinical translation may be related to rapid receptor desensitization, inconsistent efficacy across clinical studies, insufficient or variable target engagement, patient heterogeneity, and clinical endpoint selection. TC-5619 showed promising effects on cognitive impairment and negative symptoms in an early exploratory study of schizophrenia, but these effects were not confirmed in a subsequent, larger phase II trial. Encenicline (EVP-6124) also showed cognitive improvement in early studies, whereas two global phase III trials in schizophrenia failed to meet their co-primary cognitive and functional endpoints. Pharmacological strategies targeting α7 nAChR have expanded from orthosteric agonists to positive allosteric modulators (PAMs) and allosteric agonist-positive allosteric modulators (ago-PAMs). Orthosteric agonists directly activate the receptor by binding to the orthosteric site, but their effects are limited by rapid receptor desensitization. Type I PAMs mainly enhance agonist-evoked responses with relatively small effects on desensitization, whereas type II PAMs markedly potentiate receptor responses and reduce or delay desensitization. Ago-PAMs such as GAT107 can directly activate α7 nAChR through an allosteric mechanism while also potentiating responses to orthosteric agonists. Together, these findings have broadened the pharmacological approaches to α7 nAChR regulation. In summary, future drug development should focus on precise regulation of α7 nAChR according to receptor structure and disease mechanisms, rather than simply enhancing receptor activation. Further studies are needed to clarify how candidate ligands affect receptor gating, conformational transitions, recovery from desensitization, and downstream signaling. Pharmacological differences between neuronal and non-neuronal α7 nAChRs, between homomeric α7 and heteromeric α7β2 receptors, and between α7 nAChR and other nAChR subtypes also require further investigation. Integrating structure prediction, artificial intelligence-assisted virtual screening, molecular docking, molecular dynamics simulations, and electrophysiological validation may facilitate the discovery and optimization of new α7 nAChR modulators.

Background: Visual impairment is increasingly prevalent, underscoring the need for effective prevention strategies. This study investigated the association between cardiovascular health and visual impairment using three progressively developed metrics: Life’s Simple 7 (LS7), a cardiovascular health score developed by the American Heart Association based on 7 components, including physical activity, smoking status, body mass index (BMI), diet, blood glucose, blood pressure, and total cholesterol; Life’s Essential 8(LE8), which adds sleep health as an additional component; and Life’s Crucial 9 (LC9), which further incorporates mental health. We aimed to evaluate whether these expanded metrics provide additional explanatory value and to inform future public health strategies. Objective: To investigate the associations among LS7, LE8, and LC9 cardiovascular health scores and visual impairment in National Health and Nutrition Examination Survey 2013 to 2018, assess the added value of sleep and mental health components, and identify key contributing subcomponents using regression and machine learning methods. Methods: We analyzed data from 9891 participants in the 2013 to 2018 National Health and Nutrition Examination Survey. Multivariable logistic regression, restricted cubic spline modeling, and subgroup analyses were conducted to evaluate the association between cardiovascular health and visual impairment. Machine learning methods, including Random Forest and SHapley Additive exPlanations, a model interpretation approach used to assess feature importance, were applied. The Boruta algorithm, a feature selection method, was used to identify key subcomponents of cardiovascular health. Results: Participants with visual impairment were older, had lower poverty-to-income ratios, and exhibited lower cardiovascular health scores (LS7, LE8, and LC9). Higher cardiovascular health scores were negatively associated with visual impairment. Each one standard deviation increase in LS7, LE8, and LC9 was associated with approximately 8%, 2%, and 3% lower odds of visual impairment, respectively. LS7 showed the strongest negative association, whereas LE8 and LC9 emerged as the most important predictors in the machine learning models. Key subcomponents such as blood glucose, blood pressure, and BMI, as well as mental health status, were strongly associated with visual impairment. Conclusion: Higher cardiovascular health scores were negatively associated with visual impairment. LS7 demonstrated the strongest statistical association, whereas LE8 and LC9 were the most influential features in the machine learning models. Blood glucose, blood pressure, BMI, and mental health status were important correlates of visual impairment. From the perspective of the “prevention and treatment of diseases” in traditional Chinese medicine and the holistic concept, the aforementioned research findings confirm that severe visual impairment is indeed an external manifestation of overall health imbalance (such as organ dysfunction and Qi deficiency and blood stasis). The prevention strategy lies in comprehensively adjusting lifestyle, emotional factors, and metabolic indicators (corresponding to the key factors in the study) to restore the body’s internal balance and achieve prevention before disease arises.

OBJECTIVE To investigate the effects of dexborneol on the pharmacokinetic parameters of edaravone in rats under the pathological condition of cerebral ischemic stroke （CIS）.METHODS Twenty male SD rats were randomly divided into the edaravone group and the Edaravone and dexborneol concentrated solution for injection （EDB injection） group， with 10 rats in each group. A middle cerebral artery occlusion （MCAO） rat model was established using the modified Longa suture method. Within 5 min of ischemia-reperfusion， the corresponding drug solutions were injected via the tail vein at a dose of 2.5 mg/kg （calculated by edaravone）. Blood samples were collected from the orbital venous plexus at 0.08， 0.5， 1， 3， 6， 18， and 24 h after injection. With carbamazepine as the internal standard， the plasma concentration of edaravone was determined by ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） method. Pharmacokinetic parameters were calculated using DAS software and compared between the two groups.RESULTS Compared with the edaravone group， the peak concentration （ c max ） of edaravone in the EDB injection group was significantly increased （ P ＜0.05）， while no statistically significant differences were observed in the half life， time to peak， clearance， or area under curve （ P ＞0.05）.CONCLUSIONS Under the pathological condition of CIS， dexborneol can increase the c max of edaravone in the plasma of model rats， but has no significant effect on the systemic exposure or clearance of edaravone.

Sleep is an instinctive behavior alternating awakening state, sleep entails many active processes occurring at the cellular, circuit and organismal levels. The function of sleep is to restore cellular energy, enhance immunity, promote growth and development, consolidate learning and memory to ensure normal life activities. However, with the increasing of social pressure involved in work and life, the incidence of sleep disorders (SD) is increasing year by year. In the short term, sleep disorders lead to impaired memory and attention; in the longer term, it produces neurological dysfunction or even death. There are many ways to directly or indirectly contribute to sleep disorder and keep the hormones, including pharmacological alternative treatments, light therapy and stimulus control therapy. Exercise is also an effective and healthy therapeutic strategy for improving sleep. The intensities, time periods, and different types of exercise have different health benefits for sleep, which can be found through indicators such as sleep quality, sleep efficiency and total sleep time. So it is more and more important to analyze the mechanism and find effective regulation targets during sleep disorder through exercise. Dopamine (DA) is an important neurotransmitter in the nervous system, which not only participates in action initiation, movement regulation and emotion regulation, but also plays a key role in the steady-state remodeling of sleep-awakening state transition. Appreciable evidence shows that sleep disorder on humans and rodents evokes anomalies in the dopaminergic signaling, which are also implicated in the development of psychiatric illnesses such as schizophrenia or substance abuse. Experiments have shown that DA in different neural pathways plays different regulatory roles in sleep behavior, we found that increasing evidence from rodent studies revealed a role for ventral tegmental area DA neurons in regulating sleep-wake patterns. DA signal transduction and neurotransmitter release patterns have complex interactions with behavioral regulation. In addition, experiments have shown that exercise causes changes in DA homeostasis in the brain, which may regulate sleep through different mechanisms, including cAMP response element binding protein signal transduction, changes in the circadian rhythm of biological clock genes, and interactions with endogenous substances such as adenosine, which affect neuronal structure and play a neuroprotective role. This review aims to introduce the regulatory effects of exercise on sleep disorder, especially the regulatory mechanism of DA in this process. The analysis of intracerebral DA signals also requires support from neurophysiological and chemical techniques. Our laboratory has established and developed an in vivo brain neurochemical analysis platform, which provides support for future research on the regulation of sleep-wake cycles by movement. We hope it can provide theoretical reference for the formulation of exercise prescription for clinical sleep disorder and give some advice to the combined intervention of drugs and exercise.

In view of the few studies on the influence of Armillaria spp. infection on the content of the chemical components in different parts of Polyporus umbellatus sclerotia, this study determined the biomass of P. umbellatus sclerotia and the contents of ergosterol, polyporusterone A, polyporusterone B and polysaccharide in the separated cavity wall of the sclerotia and the uninfected part of the sclerotia in different harvesting years under the conditions of A. gallica and A. mellea infection respectively. According to the difference of content and dynamic changes of the polysaccharide and the steroid substances, the superior Armillaria sp. was screened to obtain the best harvest years of P. umbellatus. Using HPLC and UV-VIS spectrophotometry methods, the contents of ergosterol, polyporusterone A, polyporusterone B and polysaccharide in P. umbellatus sclerotia infected by the two Armillaria spp. in different years were determined. In addition, the differentially expressed genes related to P. umbellatus polysaccharide synthesis were screened according to the transcriptomic data of different parts of P. umbellatus after A. mellea infection. With the increase of years, the biomass of sclerotia infected by different Armillaria spp. had significant differences, and there were significant differences in the four components of sclerotia. The four components of the separated cavity wall of the sclerotia were significantly higher than those of the uninfected part. The best harvest time was the third year after cultivation. Transcriptomic analysis showed that the infection of Armillaria spp. could significantly promote polysaccharide synthesis, which provided a basis for polysaccharide content determination at the molecular level. The study clarified the influence of different Armillaria spp. infection on the accumulation of chemical components of P. umbellatus sclerotia, laying a foundation for exploring the symbiosis mechanism and provided a scientific clue for screening superior Armillaria sp. and guiding the artificial cultivation of P. umbellatus sclerotia.

Neuroscience is a significant frontier discipline within the natural sciences and has become an important interdisciplinary frontier scientific field. Brain is one of the most complex organs in the human body, and its structural and functional analysis is considered the “ultimate frontier” of human self-awareness and exploration of nature. Driven by the strategic layout of “China Brain Project”, Chinese scientists have conducted systematic research focusing on “understanding the brain, simulating the brain, and protecting the brain”. They have made breakthrough progress in areas such as the principles of brain cognition, mechanisms and interventions for brain diseases, brain-like computation, and applications of brain-machine intelligence technology, aiming to enhance brain health through biomedical technology and improve the quality of human life. Due to limited understanding and comprehension of neuroscience, there are still many important unresolved issues in the field of neuroscience, resulting in a lack of effective measures to prevent and protect brain health. Therefore, in addition to actively developing new generation drugs, exploring non pharmacological treatment strategies with better health benefits and higher safety is particularly important. Epidemiological data shows that, exercise is not only an indispensable part of daily life but also an important non-pharmacological approach for protecting brain health and preventing neurodegenerative diseases, forming an emerging research field known as motor neuroscience. Basic research in motor neuroscience primarily focuses on analyzing the dynamic coding mechanisms of neural circuits involved in motor control, breakthroughs in motor neuroscience research depend on the construction of dynamic monitoring systems across temporal and spatial scales. Therefore, high spatiotemporal resolution detection of movement processes and movement-induced changes in brain structure and neural activity signals is an important technical foundation for conducting motor neuroscience research and has developed a set of tools based on traditional neuroscience methods combined with novel motor behavior decoding technologies, providing an innovative technical platform for motor neuroscience research. The protective effect of exercise in neurodegenerative diseases provides broad application prospects for its clinical translation. Applied research in motor neuroscience centers on deciphering the regulatory networks of neuroprotective molecules mediated by exercise. From the perspectives of exercise promoting neurogenesis and regeneration, enhancing synaptic plasticity, modulating neuronal functional activity, and remodeling the molecular homeostasis of the neuronal microenvironment, it aims to improve cognitive function and reduce the incidence of Parkinson’s disease and Alzheimer’s disease. This has also advanced research into the molecular regulatory networks mediating exercise-induced neuroprotection and facilitated the clinical application and promotion of exercise rehabilitation strategies. Multidimensional analysis of exercise-regulated neural plasticity is the theoretical basis for elucidating the brain-protective mechanisms mediated by exercise and developing intervention strategies for neurological diseases. Thus,real-time analysis of different neural signals during active exercise is needed to study the health effects of exercise throughout the entire life cycle and enhance lifelong sports awareness. Therefore, this article will systematically summarize the innovative technological developments in motor neuroscience research, review the mechanisms of neural plasticity that exercise utilizes to protect the brain, and explore the role of exercise in the prevention and treatment of major neurodegenerative diseases. This aims to provide new ideas for future theoretical innovations and clinical applications in the field of exercise-induced brain protection.

As China accelerates its efforts in deep space exploration and long-duration space missions, including the operationalization of the Tiangong Space Station and the development of manned lunar missions, safeguarding astronauts’ physiological and cognitive functions under extreme space conditions becomes a pressing scientific imperative. Among the multifactorial stressors of spaceflight, microgravity emerges as a particularly potent disruptor of neurobehavioral homeostasis. Dopamine (DA) plays a central role in regulating behavior under space microgravity by influencing reward processing, motivation, executive function and sensorimotor integration. Changes in gravity disrupt dopaminergic signaling at multiple levels, leading to impairments in motor coordination, cognitive flexibility, and emotional stability. Microgravity exposure induces a cascade of neurobiological changes that challenge dopaminergic stability at multiple levels: from the transcriptional regulation of DA synthesis enzymes and the excitability of DA neurons, to receptor distribution dynamics and the efficiency of downstream signaling pathways. These changes involve downregulation of tyrosine hydroxylase in the substantia nigra, reduced phosphorylation of DA receptors, and alterations in vesicular monoamine transporter expression, all of which compromise synaptic DA availability. Experimental findings from space analog studies and simulated microgravity models suggest that gravitational unloading alters striatal and mesocorticolimbic DA circuitry, resulting in diminished motor coordination, impaired vestibular compensation, and decreased cognitive flexibility. These alterations not only compromise astronauts’ operational performance but also elevate the risk of mood disturbances and motivational deficits during prolonged missions. The review systematically synthesizes current findings across multiple domains: molecular neurobiology, behavioral neuroscience, and gravitational physiology. It highlights that maintaining DA homeostasis is pivotal in preserving neuroplasticity, particularly within brain regions critical to adaptation, such as the basal ganglia, prefrontal cortex, and cerebellum. The paper also discusses the dual-edged nature of DA plasticity: while adaptive remodeling of synapses and receptor sensitivity can serve as compensatory mechanisms under stress, chronic dopaminergic imbalance may lead to maladaptive outcomes, such as cognitive rigidity and motor dysregulation. Furthermore, we propose a conceptual framework that integrates homeostatic neuroregulation with the demands of space environmental adaptation. By drawing from interdisciplinary research, the review underscores the potential of multiple intervention strategies including pharmacological treatment, nutritional support, neural stimulation techniques, and most importantly, structured physical exercise. Recent rodent studies demonstrate that treadmill exercise upregulates DA transporter expression in the dorsal striatum, enhances tyrosine hydroxylase activity, and increases DA release during cognitive tasks, indicating both protective and restorative effects on dopaminergic networks. Thus, exercise is highlighted as a key approach because of its sustained effects on DA production, receptor function, and brain plasticity, making it a strong candidate for developing effective measures to support astronauts in maintaining cognitive and emotional stability during space missions. In conclusion, the paper not only underscores the centrality of DA homeostasis in space neuroscience but also reflects the authors’ broader academic viewpoint: understanding the neurochemical substrates of behavior under microgravity is fundamental to both space health and terrestrial neuroscience. By bridging basic neurobiology with applied space medicine, this work contributes to the emerging field of gravitational neurobiology and provides a foundation for future research into individualized performance optimization in extreme environments.

OBJECTIVE: To investigate the accuracy and safety of pedicle screw placement using 3D-printed auxiliary guides in scoliosis correction surgery for adolescents. METHODS: A retrospective analysis was conducted on the clinical data of 51 patients who underwent posterior scoliosis correction surgery from January 2020 to March 2023. Among them, there were 35 cases of adolescent idiopathic scoliosis and 16 cases of congenital scoliosis. The patients were divided into two groups based on the auxiliary tool used:the 3D-printed auxiliary guide screw placement group (3D printing group) and the free-hand screw placement group (free-hand group, without auxiliary tools). The 3D printing group included 32 patients (12 males and 20 females) with an average age of (12.59±2.60) years;the free-hand group included 19 patients (7 males and 12 females) with an average age of (14.58±3.53) years. The two groups were compared in terms of screw placement accuracy and safety, spinal correction rate, intraoperative blood loss, number of intraoperative fluoroscopies, operation time, hospital stay, and preoperative and last follow-up scores of the Scoliosis Research Society-22 (SRS-22) questionnaire. RESULTS: A total of 707 pedicle screws were placed in the two groups, with 441 screws in the 3D printing group and 266 screws in the free-hand group. All patients in both groups successfully completed the surgery. There was a statistically significant difference in operation time between the two groups (P<0.05). The screw placement accuracy rate of the 3D printing group was 95.46% (421/441), among which the Grade A placement rate was 89.34% (394/441);the screw placement accuracy rate of the free-hand group was 86.47% (230/266), with a Grade A placement rate of 73.31% (195/266). There were statistically significant differences in the accuracy of Grade A, B, and C screw placements between the two groups (P<0.05), while no statistically significant differences were observed in intraoperative blood loss, number of fluoroscopies, correction rate, or hospital stay (P>0.05). In the SRS-22 questionnaire scores, the scores of functional status and activity ability, self-image, mental status, and pain of patients in each group at the last follow-up were significantly improved compared with those before surgery (P<0.05), but there were no statistically significant differences in all scores between the two groups (P>0.05). CONCLUSION In scoliosis correction surgery, compared with traditional free-hand screw placement, the use of 3D-printed auxiliary guides for screw placement significantly improves the accuracy and safety of screw placement and shortens the operation time.
Humans ; Male ; Scoliosis/surgery* ; Female ; Adolescent ; Printing, Three-Dimensional ; Retrospective Studies ; Pedicle Screws ; Child

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Gene regulation relies on the precise binding of transcription factors (TFs) at regulatory elements, but simultaneously detecting hundreds of TFs on chromatin is challenging. We developed cFOOT-seq, a cytosine deaminase-based TF footprinting assay, for high-resolution, quantitative genome-wide assessment of TF binding in both open and closed chromatin regions, even with small cell numbers. By utilizing the dsDNA deaminase SsdAtox, cFOOT-seq converts accessible cytosines to uracil while preserving genomic integrity, making it compatible with techniques like ATAC-seq for sensitive and cost-effective detection of TF occupancy at the single-molecule and single-cell level. Our approach enables the delineation of TF footprints, quantification of occupancy, and examination of chromatin influences on TF binding. Notably, cFOOT-seq, combined with FootTrack analysis, enables de novo prediction of TF binding sites and tracking of TF occupancy dynamics. We demonstrate its application in capturing cell type-specific TFs, analyzing TF dynamics during reprogramming, and revealing TF dependencies on chromatin remodelers. Overall, cFOOT-seq represents a robust approach for investigating the genome-wide dynamics of TF occupancy and elucidating the cis-regulatory architecture underlying gene regulation.
Transcription Factors/genetics* ; Humans ; Chromatin/genetics* ; Animals ; Binding Sites ; Mice ; DNA Footprinting/methods*