1.In Vivo Electrochemical Analysis of Brain Neurochemistry:Opportunities and Challenges in Clinical Applications
Ke LI ; Huan WEI ; Ran LIU ; Yi-Fei XUE ; Li-Juan LI ; Li-Juan HOU ; Lan-Qun MAO
Chinese Journal of Analytical Chemistry 2025;53(3):311-327
Neuroscience,a cutting-edge field in interdisciplinary research,consistently draws considerable research interest,of which quantitatively probing the neurochemical dynamics is essential for brain science research.In vivoelectrochemical analysis,featuring with high sensitivity,high spatiotemporal resolution,free from transfection,and designable electrode/solution interfaces,provides important tools for in vivo neurochemicals sensing.Fast scan cyclic voltammetry combined with microelectrodes can not only enable precise detection of dopamine but also is compatible with existing neurosurgical equipment.This offers new opportunities for the clinical application of in vivo electrochemical analysis and paves new avenues for the diagnosis and treatment of neurological diseases.This review summarized recent progress of in vivo electrochemical techniques for brain neurochemistry and addressed key clinical challenges and their potential solutions.
2.Research on The Role of Dopamine in Regulating Sleep and Wakefulness Through Exercise
Li-Juan HOU ; Ya-Xuan GENG ; Ke LI ; Zhao-Yang HUANG ; Lan-Qun MAO
Progress in Biochemistry and Biophysics 2025;52(1):88-98
Sleep is an instinctive behavior alternating awakening state, sleep entails many active processes occurring at the cellular, circuit and organismal levels. The function of sleep is to restore cellular energy, enhance immunity, promote growth and development, consolidate learning and memory to ensure normal life activities. However, with the increasing of social pressure involved in work and life, the incidence of sleep disorders (SD) is increasing year by year. In the short term, sleep disorders lead to impaired memory and attention; in the longer term, it produces neurological dysfunction or even death. There are many ways to directly or indirectly contribute to sleep disorder and keep the hormones, including pharmacological alternative treatments, light therapy and stimulus control therapy. Exercise is also an effective and healthy therapeutic strategy for improving sleep. The intensities, time periods, and different types of exercise have different health benefits for sleep, which can be found through indicators such as sleep quality, sleep efficiency and total sleep time. So it is more and more important to analyze the mechanism and find effective regulation targets during sleep disorder through exercise. Dopamine (DA) is an important neurotransmitter in the nervous system, which not only participates in action initiation, movement regulation and emotion regulation, but also plays a key role in the steady-state remodeling of sleep-awakening state transition. Appreciable evidence shows that sleep disorder on humans and rodents evokes anomalies in the dopaminergic signaling, which are also implicated in the development of psychiatric illnesses such as schizophrenia or substance abuse. Experiments have shown that DA in different neural pathways plays different regulatory roles in sleep behavior, we found that increasing evidence from rodent studies revealed a role for ventral tegmental area DA neurons in regulating sleep-wake patterns. DA signal transduction and neurotransmitter release patterns have complex interactions with behavioral regulation. In addition, experiments have shown that exercise causes changes in DA homeostasis in the brain, which may regulate sleep through different mechanisms, including cAMP response element binding protein signal transduction, changes in the circadian rhythm of biological clock genes, and interactions with endogenous substances such as adenosine, which affect neuronal structure and play a neuroprotective role. This review aims to introduce the regulatory effects of exercise on sleep disorder, especially the regulatory mechanism of DA in this process. The analysis of intracerebral DA signals also requires support from neurophysiological and chemical techniques. Our laboratory has established and developed an in vivo brain neurochemical analysis platform, which provides support for future research on the regulation of sleep-wake cycles by movement. We hope it can provide theoretical reference for the formulation of exercise prescription for clinical sleep disorder and give some advice to the combined intervention of drugs and exercise.
3.The Regulatory Mechanisms of Dopamine Homeostasis in Behavioral Functions Under Microgravity
Xin YANG ; Ke LI ; Ran LIU ; Xu-Dong ZHAO ; Hua-Lin WANG ; Lan-Qun MAO ; Li-Juan HOU
Progress in Biochemistry and Biophysics 2025;52(8):2087-2102
As China accelerates its efforts in deep space exploration and long-duration space missions, including the operationalization of the Tiangong Space Station and the development of manned lunar missions, safeguarding astronauts’ physiological and cognitive functions under extreme space conditions becomes a pressing scientific imperative. Among the multifactorial stressors of spaceflight, microgravity emerges as a particularly potent disruptor of neurobehavioral homeostasis. Dopamine (DA) plays a central role in regulating behavior under space microgravity by influencing reward processing, motivation, executive function and sensorimotor integration. Changes in gravity disrupt dopaminergic signaling at multiple levels, leading to impairments in motor coordination, cognitive flexibility, and emotional stability. Microgravity exposure induces a cascade of neurobiological changes that challenge dopaminergic stability at multiple levels: from the transcriptional regulation of DA synthesis enzymes and the excitability of DA neurons, to receptor distribution dynamics and the efficiency of downstream signaling pathways. These changes involve downregulation of tyrosine hydroxylase in the substantia nigra, reduced phosphorylation of DA receptors, and alterations in vesicular monoamine transporter expression, all of which compromise synaptic DA availability. Experimental findings from space analog studies and simulated microgravity models suggest that gravitational unloading alters striatal and mesocorticolimbic DA circuitry, resulting in diminished motor coordination, impaired vestibular compensation, and decreased cognitive flexibility. These alterations not only compromise astronauts’ operational performance but also elevate the risk of mood disturbances and motivational deficits during prolonged missions. The review systematically synthesizes current findings across multiple domains: molecular neurobiology, behavioral neuroscience, and gravitational physiology. It highlights that maintaining DA homeostasis is pivotal in preserving neuroplasticity, particularly within brain regions critical to adaptation, such as the basal ganglia, prefrontal cortex, and cerebellum. The paper also discusses the dual-edged nature of DA plasticity: while adaptive remodeling of synapses and receptor sensitivity can serve as compensatory mechanisms under stress, chronic dopaminergic imbalance may lead to maladaptive outcomes, such as cognitive rigidity and motor dysregulation. Furthermore, we propose a conceptual framework that integrates homeostatic neuroregulation with the demands of space environmental adaptation. By drawing from interdisciplinary research, the review underscores the potential of multiple intervention strategies including pharmacological treatment, nutritional support, neural stimulation techniques, and most importantly, structured physical exercise. Recent rodent studies demonstrate that treadmill exercise upregulates DA transporter expression in the dorsal striatum, enhances tyrosine hydroxylase activity, and increases DA release during cognitive tasks, indicating both protective and restorative effects on dopaminergic networks. Thus, exercise is highlighted as a key approach because of its sustained effects on DA production, receptor function, and brain plasticity, making it a strong candidate for developing effective measures to support astronauts in maintaining cognitive and emotional stability during space missions. In conclusion, the paper not only underscores the centrality of DA homeostasis in space neuroscience but also reflects the authors’ broader academic viewpoint: understanding the neurochemical substrates of behavior under microgravity is fundamental to both space health and terrestrial neuroscience. By bridging basic neurobiology with applied space medicine, this work contributes to the emerging field of gravitational neurobiology and provides a foundation for future research into individualized performance optimization in extreme environments.
4.Genome-wide investigation of transcription factor footprints and dynamics using cFOOT-seq.
Heng WANG ; Ang WU ; Meng-Chen YANG ; Di ZHOU ; Xiyang CHEN ; Zhifei SHI ; Yiqun ZHANG ; Yu-Xin LIU ; Kai CHEN ; Xiaosong WANG ; Xiao-Fang CHENG ; Baodan HE ; Yutao FU ; Lan KANG ; Yujun HOU ; Kun CHEN ; Shan BIAN ; Juan TANG ; Jianhuang XUE ; Chenfei WANG ; Xiaoyu LIU ; Jiejun SHI ; Shaorong GAO ; Jia-Min ZHANG
Protein & Cell 2025;16(11):932-952
Gene regulation relies on the precise binding of transcription factors (TFs) at regulatory elements, but simultaneously detecting hundreds of TFs on chromatin is challenging. We developed cFOOT-seq, a cytosine deaminase-based TF footprinting assay, for high-resolution, quantitative genome-wide assessment of TF binding in both open and closed chromatin regions, even with small cell numbers. By utilizing the dsDNA deaminase SsdAtox, cFOOT-seq converts accessible cytosines to uracil while preserving genomic integrity, making it compatible with techniques like ATAC-seq for sensitive and cost-effective detection of TF occupancy at the single-molecule and single-cell level. Our approach enables the delineation of TF footprints, quantification of occupancy, and examination of chromatin influences on TF binding. Notably, cFOOT-seq, combined with FootTrack analysis, enables de novo prediction of TF binding sites and tracking of TF occupancy dynamics. We demonstrate its application in capturing cell type-specific TFs, analyzing TF dynamics during reprogramming, and revealing TF dependencies on chromatin remodelers. Overall, cFOOT-seq represents a robust approach for investigating the genome-wide dynamics of TF occupancy and elucidating the cis-regulatory architecture underlying gene regulation.
Transcription Factors/genetics*
;
Humans
;
Chromatin/genetics*
;
Animals
;
Binding Sites
;
Mice
;
DNA Footprinting/methods*
5.Study on accumulation of polysaccharide and steroid components in Polyporus umbellatus infected by Armillaria spp.
Ming-shu YANG ; Yi-fei YIN ; Juan CHEN ; Bing LI ; Meng-yan HOU ; Chun-yan LENG ; Yong-mei XING ; Shun-xing GUO
Acta Pharmaceutica Sinica 2025;60(1):232-238
In view of the few studies on the influence of
7.Application of 3D-printed auxiliary guides in adolescent scoliosis surgery.
Dong HOU ; Jian-Tao WEN ; Chen ZHANG ; Jin HUANG ; Chang-Quan DAI ; Kai LI ; Han LENG ; Jing ZHANG ; Shao-Bo YANG ; Xiao-Juan CUI ; Juan WANG ; Xiao-Yun YUAN
China Journal of Orthopaedics and Traumatology 2025;38(11):1119-1125
OBJECTIVE:
To investigate the accuracy and safety of pedicle screw placement using 3D-printed auxiliary guides in scoliosis correction surgery for adolescents.
METHODS:
A retrospective analysis was conducted on the clinical data of 51 patients who underwent posterior scoliosis correction surgery from January 2020 to March 2023. Among them, there were 35 cases of adolescent idiopathic scoliosis and 16 cases of congenital scoliosis. The patients were divided into two groups based on the auxiliary tool used:the 3D-printed auxiliary guide screw placement group (3D printing group) and the free-hand screw placement group (free-hand group, without auxiliary tools). The 3D printing group included 32 patients (12 males and 20 females) with an average age of (12.59±2.60) years;the free-hand group included 19 patients (7 males and 12 females) with an average age of (14.58±3.53) years. The two groups were compared in terms of screw placement accuracy and safety, spinal correction rate, intraoperative blood loss, number of intraoperative fluoroscopies, operation time, hospital stay, and preoperative and last follow-up scores of the Scoliosis Research Society-22 (SRS-22) questionnaire.
RESULTS:
A total of 707 pedicle screws were placed in the two groups, with 441 screws in the 3D printing group and 266 screws in the free-hand group. All patients in both groups successfully completed the surgery. There was a statistically significant difference in operation time between the two groups (P<0.05). The screw placement accuracy rate of the 3D printing group was 95.46% (421/441), among which the Grade A placement rate was 89.34% (394/441);the screw placement accuracy rate of the free-hand group was 86.47% (230/266), with a Grade A placement rate of 73.31% (195/266). There were statistically significant differences in the accuracy of Grade A, B, and C screw placements between the two groups (P<0.05), while no statistically significant differences were observed in intraoperative blood loss, number of fluoroscopies, correction rate, or hospital stay (P>0.05). In the SRS-22 questionnaire scores, the scores of functional status and activity ability, self-image, mental status, and pain of patients in each group at the last follow-up were significantly improved compared with those before surgery (P<0.05), but there were no statistically significant differences in all scores between the two groups (P>0.05).
CONCLUSION
In scoliosis correction surgery, compared with traditional free-hand screw placement, the use of 3D-printed auxiliary guides for screw placement significantly improves the accuracy and safety of screw placement and shortens the operation time.
Humans
;
Male
;
Scoliosis/surgery*
;
Female
;
Adolescent
;
Printing, Three-Dimensional
;
Retrospective Studies
;
Pedicle Screws
;
Child
8.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
9.Multiple biomarkers risk score for accurately predicting the long-term prognosis of patients with acute coronary syndrome.
Zhi-Yong ZHANG ; Xin-Yu WANG ; Cong-Cong HOU ; Hong-Bin LIU ; Lyu LYU ; Mu-Lei CHEN ; Xiao-Rong XU ; Feng JIANG ; Long LI ; Wei-Ming LI ; Kui-Bao LI ; Juan WANG
Journal of Geriatric Cardiology 2025;22(7):656-667
BACKGROUND:
Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients.
METHODS:
We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables.
RESULTS:
During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively).
CONCLUSIONS
CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.
10.Glucocorticoid Discontinuation in Patients with Rheumatoid Arthritis under Background of Chinese Medicine: Challenges and Potentials Coexist.
Chuan-Hui YAO ; Chi ZHANG ; Meng-Ge SONG ; Cong-Min XIA ; Tian CHANG ; Xie-Li MA ; Wei-Xiang LIU ; Zi-Xia LIU ; Jia-Meng LIU ; Xiao-Po TANG ; Ying LIU ; Jian LIU ; Jiang-Yun PENG ; Dong-Yi HE ; Qing-Chun HUANG ; Ming-Li GAO ; Jian-Ping YU ; Wei LIU ; Jian-Yong ZHANG ; Yue-Lan ZHU ; Xiu-Juan HOU ; Hai-Dong WANG ; Yong-Fei FANG ; Yue WANG ; Yin SU ; Xin-Ping TIAN ; Ai-Ping LYU ; Xun GONG ; Quan JIANG
Chinese journal of integrative medicine 2025;31(7):581-589
OBJECTIVE:
To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM).
METHODS:
This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis.
RESULTS:
Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings.
CONCLUSIONS
RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Arthritis, Rheumatoid/drug therapy*
;
Glucocorticoids/therapeutic use*
;
Medicine, Chinese Traditional
;
Retrospective Studies

Result Analysis
Print
Save
E-mail