1.Study on accumulation of polysaccharide and steroid components in Polyporus umbellatus infected by Armillaria spp.
Ming-shu YANG ; Yi-fei YIN ; Juan CHEN ; Bing LI ; Meng-yan HOU ; Chun-yan LENG ; Yong-mei XING ; Shun-xing GUO
Acta Pharmaceutica Sinica 2025;60(1):232-238
In view of the few studies on the influence of
2.Research on The Role of Dopamine in Regulating Sleep and Wakefulness Through Exercise
Li-Juan HOU ; Ya-Xuan GENG ; Ke LI ; Zhao-Yang HUANG ; Lan-Qun MAO
Progress in Biochemistry and Biophysics 2025;52(1):88-98
Sleep is an instinctive behavior alternating awakening state, sleep entails many active processes occurring at the cellular, circuit and organismal levels. The function of sleep is to restore cellular energy, enhance immunity, promote growth and development, consolidate learning and memory to ensure normal life activities. However, with the increasing of social pressure involved in work and life, the incidence of sleep disorders (SD) is increasing year by year. In the short term, sleep disorders lead to impaired memory and attention; in the longer term, it produces neurological dysfunction or even death. There are many ways to directly or indirectly contribute to sleep disorder and keep the hormones, including pharmacological alternative treatments, light therapy and stimulus control therapy. Exercise is also an effective and healthy therapeutic strategy for improving sleep. The intensities, time periods, and different types of exercise have different health benefits for sleep, which can be found through indicators such as sleep quality, sleep efficiency and total sleep time. So it is more and more important to analyze the mechanism and find effective regulation targets during sleep disorder through exercise. Dopamine (DA) is an important neurotransmitter in the nervous system, which not only participates in action initiation, movement regulation and emotion regulation, but also plays a key role in the steady-state remodeling of sleep-awakening state transition. Appreciable evidence shows that sleep disorder on humans and rodents evokes anomalies in the dopaminergic signaling, which are also implicated in the development of psychiatric illnesses such as schizophrenia or substance abuse. Experiments have shown that DA in different neural pathways plays different regulatory roles in sleep behavior, we found that increasing evidence from rodent studies revealed a role for ventral tegmental area DA neurons in regulating sleep-wake patterns. DA signal transduction and neurotransmitter release patterns have complex interactions with behavioral regulation. In addition, experiments have shown that exercise causes changes in DA homeostasis in the brain, which may regulate sleep through different mechanisms, including cAMP response element binding protein signal transduction, changes in the circadian rhythm of biological clock genes, and interactions with endogenous substances such as adenosine, which affect neuronal structure and play a neuroprotective role. This review aims to introduce the regulatory effects of exercise on sleep disorder, especially the regulatory mechanism of DA in this process. The analysis of intracerebral DA signals also requires support from neurophysiological and chemical techniques. Our laboratory has established and developed an in vivo brain neurochemical analysis platform, which provides support for future research on the regulation of sleep-wake cycles by movement. We hope it can provide theoretical reference for the formulation of exercise prescription for clinical sleep disorder and give some advice to the combined intervention of drugs and exercise.
3.Glucocorticoid Discontinuation in Patients with Rheumatoid Arthritis under Background of Chinese Medicine: Challenges and Potentials Coexist.
Chuan-Hui YAO ; Chi ZHANG ; Meng-Ge SONG ; Cong-Min XIA ; Tian CHANG ; Xie-Li MA ; Wei-Xiang LIU ; Zi-Xia LIU ; Jia-Meng LIU ; Xiao-Po TANG ; Ying LIU ; Jian LIU ; Jiang-Yun PENG ; Dong-Yi HE ; Qing-Chun HUANG ; Ming-Li GAO ; Jian-Ping YU ; Wei LIU ; Jian-Yong ZHANG ; Yue-Lan ZHU ; Xiu-Juan HOU ; Hai-Dong WANG ; Yong-Fei FANG ; Yue WANG ; Yin SU ; Xin-Ping TIAN ; Ai-Ping LYU ; Xun GONG ; Quan JIANG
Chinese journal of integrative medicine 2025;31(7):581-589
OBJECTIVE:
To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM).
METHODS:
This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis.
RESULTS:
Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings.
CONCLUSIONS
RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Arthritis, Rheumatoid/drug therapy*
;
Glucocorticoids/therapeutic use*
;
Medicine, Chinese Traditional
;
Retrospective Studies
4.Neuroplasticity Mechanisms of Exercise-induced Brain Protection
Li-Juan HOU ; Lan-Qun MAO ; Wei CHEN ; Ke LI ; Xu-Dong ZHAO ; Yin-Hao WANG ; Zi-Zheng YANG ; Tian-He WEI
Progress in Biochemistry and Biophysics 2025;52(6):1435-1452
Neuroscience is a significant frontier discipline within the natural sciences and has become an important interdisciplinary frontier scientific field. Brain is one of the most complex organs in the human body, and its structural and functional analysis is considered the “ultimate frontier” of human self-awareness and exploration of nature. Driven by the strategic layout of “China Brain Project”, Chinese scientists have conducted systematic research focusing on “understanding the brain, simulating the brain, and protecting the brain”. They have made breakthrough progress in areas such as the principles of brain cognition, mechanisms and interventions for brain diseases, brain-like computation, and applications of brain-machine intelligence technology, aiming to enhance brain health through biomedical technology and improve the quality of human life. Due to limited understanding and comprehension of neuroscience, there are still many important unresolved issues in the field of neuroscience, resulting in a lack of effective measures to prevent and protect brain health. Therefore, in addition to actively developing new generation drugs, exploring non pharmacological treatment strategies with better health benefits and higher safety is particularly important. Epidemiological data shows that, exercise is not only an indispensable part of daily life but also an important non-pharmacological approach for protecting brain health and preventing neurodegenerative diseases, forming an emerging research field known as motor neuroscience. Basic research in motor neuroscience primarily focuses on analyzing the dynamic coding mechanisms of neural circuits involved in motor control, breakthroughs in motor neuroscience research depend on the construction of dynamic monitoring systems across temporal and spatial scales. Therefore, high spatiotemporal resolution detection of movement processes and movement-induced changes in brain structure and neural activity signals is an important technical foundation for conducting motor neuroscience research and has developed a set of tools based on traditional neuroscience methods combined with novel motor behavior decoding technologies, providing an innovative technical platform for motor neuroscience research. The protective effect of exercise in neurodegenerative diseases provides broad application prospects for its clinical translation. Applied research in motor neuroscience centers on deciphering the regulatory networks of neuroprotective molecules mediated by exercise. From the perspectives of exercise promoting neurogenesis and regeneration, enhancing synaptic plasticity, modulating neuronal functional activity, and remodeling the molecular homeostasis of the neuronal microenvironment, it aims to improve cognitive function and reduce the incidence of Parkinson’s disease and Alzheimer’s disease. This has also advanced research into the molecular regulatory networks mediating exercise-induced neuroprotection and facilitated the clinical application and promotion of exercise rehabilitation strategies. Multidimensional analysis of exercise-regulated neural plasticity is the theoretical basis for elucidating the brain-protective mechanisms mediated by exercise and developing intervention strategies for neurological diseases. Thus,real-time analysis of different neural signals during active exercise is needed to study the health effects of exercise throughout the entire life cycle and enhance lifelong sports awareness. Therefore, this article will systematically summarize the innovative technological developments in motor neuroscience research, review the mechanisms of neural plasticity that exercise utilizes to protect the brain, and explore the role of exercise in the prevention and treatment of major neurodegenerative diseases. This aims to provide new ideas for future theoretical innovations and clinical applications in the field of exercise-induced brain protection.
5.The Regulatory Mechanisms of Dopamine Homeostasis in Behavioral Functions Under Microgravity
Xin YANG ; Ke LI ; Ran LIU ; Xu-Dong ZHAO ; Hua-Lin WANG ; Lan-Qun MAO ; Li-Juan HOU
Progress in Biochemistry and Biophysics 2025;52(8):2087-2102
As China accelerates its efforts in deep space exploration and long-duration space missions, including the operationalization of the Tiangong Space Station and the development of manned lunar missions, safeguarding astronauts’ physiological and cognitive functions under extreme space conditions becomes a pressing scientific imperative. Among the multifactorial stressors of spaceflight, microgravity emerges as a particularly potent disruptor of neurobehavioral homeostasis. Dopamine (DA) plays a central role in regulating behavior under space microgravity by influencing reward processing, motivation, executive function and sensorimotor integration. Changes in gravity disrupt dopaminergic signaling at multiple levels, leading to impairments in motor coordination, cognitive flexibility, and emotional stability. Microgravity exposure induces a cascade of neurobiological changes that challenge dopaminergic stability at multiple levels: from the transcriptional regulation of DA synthesis enzymes and the excitability of DA neurons, to receptor distribution dynamics and the efficiency of downstream signaling pathways. These changes involve downregulation of tyrosine hydroxylase in the substantia nigra, reduced phosphorylation of DA receptors, and alterations in vesicular monoamine transporter expression, all of which compromise synaptic DA availability. Experimental findings from space analog studies and simulated microgravity models suggest that gravitational unloading alters striatal and mesocorticolimbic DA circuitry, resulting in diminished motor coordination, impaired vestibular compensation, and decreased cognitive flexibility. These alterations not only compromise astronauts’ operational performance but also elevate the risk of mood disturbances and motivational deficits during prolonged missions. The review systematically synthesizes current findings across multiple domains: molecular neurobiology, behavioral neuroscience, and gravitational physiology. It highlights that maintaining DA homeostasis is pivotal in preserving neuroplasticity, particularly within brain regions critical to adaptation, such as the basal ganglia, prefrontal cortex, and cerebellum. The paper also discusses the dual-edged nature of DA plasticity: while adaptive remodeling of synapses and receptor sensitivity can serve as compensatory mechanisms under stress, chronic dopaminergic imbalance may lead to maladaptive outcomes, such as cognitive rigidity and motor dysregulation. Furthermore, we propose a conceptual framework that integrates homeostatic neuroregulation with the demands of space environmental adaptation. By drawing from interdisciplinary research, the review underscores the potential of multiple intervention strategies including pharmacological treatment, nutritional support, neural stimulation techniques, and most importantly, structured physical exercise. Recent rodent studies demonstrate that treadmill exercise upregulates DA transporter expression in the dorsal striatum, enhances tyrosine hydroxylase activity, and increases DA release during cognitive tasks, indicating both protective and restorative effects on dopaminergic networks. Thus, exercise is highlighted as a key approach because of its sustained effects on DA production, receptor function, and brain plasticity, making it a strong candidate for developing effective measures to support astronauts in maintaining cognitive and emotional stability during space missions. In conclusion, the paper not only underscores the centrality of DA homeostasis in space neuroscience but also reflects the authors’ broader academic viewpoint: understanding the neurochemical substrates of behavior under microgravity is fundamental to both space health and terrestrial neuroscience. By bridging basic neurobiology with applied space medicine, this work contributes to the emerging field of gravitational neurobiology and provides a foundation for future research into individualized performance optimization in extreme environments.
6.Construction and validation of predictive model for gastric precancerous lesions based on urea breath test,serum pepsinogen and gastrin-17
Juan HONG ; Xin JIANG ; Sicong HOU ; Yanbing DING ; Xuefeng GAO
Journal of Clinical Medicine in Practice 2025;29(13):1-6,12
Objective To construct and validate a predictive model for gastric precancerous le-sions based on urea breath test,serum pepsinogen(PG)and gastrin-17(G-17).Methods Partici-pants who underwent endoscopic screening for upper gastrointestinal tumors were retrospectively en-rolled as study subjects.Using random function,all participants were divided into training cohort of 2,788 cases(comprising 1,290 cases in precancerous lesion group and 1,498 cases in control group)and validation cohort of 1,194 cases(comprising 581 cases in precancerous lesion group and 613 cases in control group)at a ratio of 7 to 3.A simple model was established based on urea breath test,PG and G-17.Clinical data between the precancerous lesion group and the control group in the training cohort were compared.A predictive model for gastric precancerous lesions was constructed u-sing multifactorial Logistic regression analysis,and a scoring model for gastric precancerous lesions(the complete model)was developed based on this predictive model.The complete model,the simple model,the new ABC method,and the Li's score were all included in the validation cohort to compare the predictive performance of the four models.Results Multifactorial Logistic regression analysis indicated that male,smoking,positive Helicobacter pylori(Hp)infection,PG Ⅱ ≥10.19 μg/L,the ratio of PG Ⅰ to PG Ⅱ(PGR)≤11.87,and G-17 ≥3.82 pmol/L were independent risk factors for gastric precancerous lesions(P<0.05).A predictive model for gastric precancerous lesions was constructed based on these risk factors,and the complete model was established based on the predic-tive model.The total score ranged from 0 to 12(with 6 to 12 indicating a high-risk population for gastric precancerous lesions and 0 to 5 indicating a low-risk population).When the complete model,the simple model,the new ABC method,and the Li's score were included in the validation cohort for comparison,the predictive values of the complete model and the simple model were similar.Both models demonstrated higher sensitivity,specificity,positive predictive value,negative predictive value,and accuracy compared to the new ABC method and the Li's score.Furthermore,the diag-nostic value of the simple model in the high-sensitivity region was slightly superior to that of the com-plete model.Conclusion The simple model constructed based on the urea breath test,PG and G-17 exhibits favorable predictive efficacy,calibration,and clinical utility,and is of positive signifi-cance for the early identification of patients with gastric precancerous lesions.
7.The role of surface electromyography network indices in assessing neuromuscular dysfunction in hemiplegia
Jinping LI ; Ying XU ; Xianglian KANG ; Runing JI ; Juan WANG ; Minjun DAI ; Ke LI ; Ying HOU
Chinese Journal of Physical Medicine and Rehabilitation 2025;47(5):446-452
Objective:To observe the characteristics of multi-muscle surface electromyography (sEMG) network indices during static standing among hemiplegic stroke survivors, and to evaluate the value of the indices in assessing neuromuscular dysfunction.Methods:Ten male stroke survivors with hemiplegia were recruited into the hemiplegia group, and 10 age-matched healthy males were chosen as the control group. Both groups were required to perform 30s static standing tasks with their eyes open and closed. The sEMG signals from the bilateral gluteus maximus (GM), rectus femoris (RF) and biceps femoris (BF) muscles were synchronously collected. Linear time-frequency domain indices were then calculated from the sEMG signals, including the root mean square (RMS) and median frequency (MF). Network indices were extracted from the multiplex recurrence network and weighted networks were constructed from the sEMG signals, including the average interlayer mutual information (I), average edge overlap (ω), clustering coefficient (C), average shortest path length (L) and degree of centrality (DC).Results:With the eyes closed, the RMS values of the bilateral GMs of the hemiplegia group, as well as the values for the RF and BF on the unaffected side were significantly higher than the control group′s values. In the hemiplegia group, the RMS values of the RF and BF muscles on the unaffected side were significantly higher than on the affected side during standing with the eyes closed. For the RF muscles the RMS values on the unaffected side were, on average, significantly higher than with the eyes open. The MF of the GM muscles on the unaffected side in the hemiplegia group was significantly lower than the average MF values of the bilateral GM muscles in the control group with the eyes open or closed. With the eyes closed, the MF of the unaffected-side GM was significantly lower than that of the affected-side GM in the hemiplegia group. Compared with the control group, the hemiplegia group showed a significant increase in I and ω values, but a significant decrease in L values with the eyes open or closed. The DC values of the bilateral GM, RF and BF muscles in the hemiplegia group were significantly higher than among the control group with the eyes open, which was also true of the bilateral GM and RF muscles with the eyes closed. With the BF muscles it was true only of the unaffected side. In the hemiplegia group, the DC values of the unaffected-side GM with the eyes open or closed, and of the unaffected-side BF with the eyes closed.Conclusions:When standing still, hemiplegic stroke survivors exhibit increased overall synchronous muscle adjustment with involvement of unaffected-side muscles, especially the GM. sEMG network indices such as I, ω, L and DC can assess multi-muscle synchronous adaptability and the involvement of single muscles. sEMG network algorithms thus have potential as a new method for localizing and quantitatively assessing neuromuscular dysfunction among such patients.
8.Development, reliability, and validity of a treatment-related quality of life scale for Chinese patients with multiple myeloma
Chunyan SUN ; Zhen CAI ; Bing CHEN ; Lijuan CHEN ; Wenming CHEN ; Kaiyang DING ; Juan DU ; Rong FU ; Chengcheng FU ; Da GAO ; Guangxun GAO ; Yanjuan HE ; Jian HOU ; Ming JIANG ; Fei LI ; Jian LI ; Juan LI ; Zhenyu LI ; Aijun LIAO ; Jing LIU ; Jun LUO ; Jianmin LUO ; Yanping MA ; Jianqing MI ; Ting NIU ; Hongling PENG ; Yongping SONG ; Luqun WANG ; Rong ZHAN ; Xi ZHANG ; Yu HU
Chinese Journal of Hematology 2025;46(8):713-721
Objective:To develop a treatment-related quality of life scale for Chinese patients with multiple myeloma (MM) and to test its reliability and validity.Methods:The initial scale was constructed through a literature search, Delphi expert correspondence, and cognitive testing. This study conducted a preliminary survey of 379 patients with MM and a formal survey of 865 patients from the hematology departments of 155 hospitals nationwide from February 2024 to March 2024. The final scale was obtained after conducting item analysis and reliability and validity tests on the initial scale.Results:The constructed scale contains 36 items covering six domains: physiological, psychological, social, treatment side effects, general health, and others. In the preliminary survey, the Cronbach’s alpha coefficient of each item ranged from 0.597 to 0.939, and the test-retest reliability was 0.747 ( P<0.001). Exploratory factor analysis extracted eight common factors with a cumulative variance contribution of 60.058%. In the formal survey, the Cronbach’s alpha coefficient of each item ranged from 0.484 to 0.930, and the test-retest reliability was 0.835 ( P<0.001). Confirmatory factor analysis revealed a comparative fit index of 0.750, a root-mean-square error of approximation of 0.090, and a root-mean-square residual of 0.067. Conclusion:The treatment-related quality of life scale for Chinese patients with MM designed in this study exhibited good reliability and validity, reflecting the impact of treatment on the quality of life of patients. This scale can provide a reference to clinicians for assessing the disease status of patients.
9.Application of 3D-printed auxiliary guides in adolescent scoliosis surgery.
Dong HOU ; Jian-Tao WEN ; Chen ZHANG ; Jin HUANG ; Chang-Quan DAI ; Kai LI ; Han LENG ; Jing ZHANG ; Shao-Bo YANG ; Xiao-Juan CUI ; Juan WANG ; Xiao-Yun YUAN
China Journal of Orthopaedics and Traumatology 2025;38(11):1119-1125
OBJECTIVE:
To investigate the accuracy and safety of pedicle screw placement using 3D-printed auxiliary guides in scoliosis correction surgery for adolescents.
METHODS:
A retrospective analysis was conducted on the clinical data of 51 patients who underwent posterior scoliosis correction surgery from January 2020 to March 2023. Among them, there were 35 cases of adolescent idiopathic scoliosis and 16 cases of congenital scoliosis. The patients were divided into two groups based on the auxiliary tool used:the 3D-printed auxiliary guide screw placement group (3D printing group) and the free-hand screw placement group (free-hand group, without auxiliary tools). The 3D printing group included 32 patients (12 males and 20 females) with an average age of (12.59±2.60) years;the free-hand group included 19 patients (7 males and 12 females) with an average age of (14.58±3.53) years. The two groups were compared in terms of screw placement accuracy and safety, spinal correction rate, intraoperative blood loss, number of intraoperative fluoroscopies, operation time, hospital stay, and preoperative and last follow-up scores of the Scoliosis Research Society-22 (SRS-22) questionnaire.
RESULTS:
A total of 707 pedicle screws were placed in the two groups, with 441 screws in the 3D printing group and 266 screws in the free-hand group. All patients in both groups successfully completed the surgery. There was a statistically significant difference in operation time between the two groups (P<0.05). The screw placement accuracy rate of the 3D printing group was 95.46% (421/441), among which the Grade A placement rate was 89.34% (394/441);the screw placement accuracy rate of the free-hand group was 86.47% (230/266), with a Grade A placement rate of 73.31% (195/266). There were statistically significant differences in the accuracy of Grade A, B, and C screw placements between the two groups (P<0.05), while no statistically significant differences were observed in intraoperative blood loss, number of fluoroscopies, correction rate, or hospital stay (P>0.05). In the SRS-22 questionnaire scores, the scores of functional status and activity ability, self-image, mental status, and pain of patients in each group at the last follow-up were significantly improved compared with those before surgery (P<0.05), but there were no statistically significant differences in all scores between the two groups (P>0.05).
CONCLUSION
In scoliosis correction surgery, compared with traditional free-hand screw placement, the use of 3D-printed auxiliary guides for screw placement significantly improves the accuracy and safety of screw placement and shortens the operation time.
Humans
;
Male
;
Scoliosis/surgery*
;
Female
;
Adolescent
;
Printing, Three-Dimensional
;
Retrospective Studies
;
Pedicle Screws
;
Child
10.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test

Result Analysis
Print
Save
E-mail