Sleep is an instinctive behavior alternating awakening state, sleep entails many active processes occurring at the cellular, circuit and organismal levels. The function of sleep is to restore cellular energy, enhance immunity, promote growth and development, consolidate learning and memory to ensure normal life activities. However, with the increasing of social pressure involved in work and life, the incidence of sleep disorders (SD) is increasing year by year. In the short term, sleep disorders lead to impaired memory and attention; in the longer term, it produces neurological dysfunction or even death. There are many ways to directly or indirectly contribute to sleep disorder and keep the hormones, including pharmacological alternative treatments, light therapy and stimulus control therapy. Exercise is also an effective and healthy therapeutic strategy for improving sleep. The intensities, time periods, and different types of exercise have different health benefits for sleep, which can be found through indicators such as sleep quality, sleep efficiency and total sleep time. So it is more and more important to analyze the mechanism and find effective regulation targets during sleep disorder through exercise. Dopamine (DA) is an important neurotransmitter in the nervous system, which not only participates in action initiation, movement regulation and emotion regulation, but also plays a key role in the steady-state remodeling of sleep-awakening state transition. Appreciable evidence shows that sleep disorder on humans and rodents evokes anomalies in the dopaminergic signaling, which are also implicated in the development of psychiatric illnesses such as schizophrenia or substance abuse. Experiments have shown that DA in different neural pathways plays different regulatory roles in sleep behavior, we found that increasing evidence from rodent studies revealed a role for ventral tegmental area DA neurons in regulating sleep-wake patterns. DA signal transduction and neurotransmitter release patterns have complex interactions with behavioral regulation. In addition, experiments have shown that exercise causes changes in DA homeostasis in the brain, which may regulate sleep through different mechanisms, including cAMP response element binding protein signal transduction, changes in the circadian rhythm of biological clock genes, and interactions with endogenous substances such as adenosine, which affect neuronal structure and play a neuroprotective role. This review aims to introduce the regulatory effects of exercise on sleep disorder, especially the regulatory mechanism of DA in this process. The analysis of intracerebral DA signals also requires support from neurophysiological and chemical techniques. Our laboratory has established and developed an in vivo brain neurochemical analysis platform, which provides support for future research on the regulation of sleep-wake cycles by movement. We hope it can provide theoretical reference for the formulation of exercise prescription for clinical sleep disorder and give some advice to the combined intervention of drugs and exercise.

OBJECTIVE: To investigate the accuracy and safety of pedicle screw placement using 3D-printed auxiliary guides in scoliosis correction surgery for adolescents. METHODS: A retrospective analysis was conducted on the clinical data of 51 patients who underwent posterior scoliosis correction surgery from January 2020 to March 2023. Among them, there were 35 cases of adolescent idiopathic scoliosis and 16 cases of congenital scoliosis. The patients were divided into two groups based on the auxiliary tool used:the 3D-printed auxiliary guide screw placement group (3D printing group) and the free-hand screw placement group (free-hand group, without auxiliary tools). The 3D printing group included 32 patients (12 males and 20 females) with an average age of (12.59±2.60) years;the free-hand group included 19 patients (7 males and 12 females) with an average age of (14.58±3.53) years. The two groups were compared in terms of screw placement accuracy and safety, spinal correction rate, intraoperative blood loss, number of intraoperative fluoroscopies, operation time, hospital stay, and preoperative and last follow-up scores of the Scoliosis Research Society-22 (SRS-22) questionnaire. RESULTS: A total of 707 pedicle screws were placed in the two groups, with 441 screws in the 3D printing group and 266 screws in the free-hand group. All patients in both groups successfully completed the surgery. There was a statistically significant difference in operation time between the two groups (P<0.05). The screw placement accuracy rate of the 3D printing group was 95.46% (421/441), among which the Grade A placement rate was 89.34% (394/441);the screw placement accuracy rate of the free-hand group was 86.47% (230/266), with a Grade A placement rate of 73.31% (195/266). There were statistically significant differences in the accuracy of Grade A, B, and C screw placements between the two groups (P<0.05), while no statistically significant differences were observed in intraoperative blood loss, number of fluoroscopies, correction rate, or hospital stay (P>0.05). In the SRS-22 questionnaire scores, the scores of functional status and activity ability, self-image, mental status, and pain of patients in each group at the last follow-up were significantly improved compared with those before surgery (P<0.05), but there were no statistically significant differences in all scores between the two groups (P>0.05). CONCLUSION In scoliosis correction surgery, compared with traditional free-hand screw placement, the use of 3D-printed auxiliary guides for screw placement significantly improves the accuracy and safety of screw placement and shortens the operation time.
Humans ; Male ; Scoliosis/surgery* ; Female ; Adolescent ; Printing, Three-Dimensional ; Retrospective Studies ; Pedicle Screws ; Child

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients. METHODS: We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables. RESULTS: During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively). CONCLUSIONS CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.

As China accelerates its efforts in deep space exploration and long-duration space missions, including the operationalization of the Tiangong Space Station and the development of manned lunar missions, safeguarding astronauts’ physiological and cognitive functions under extreme space conditions becomes a pressing scientific imperative. Among the multifactorial stressors of spaceflight, microgravity emerges as a particularly potent disruptor of neurobehavioral homeostasis. Dopamine (DA) plays a central role in regulating behavior under space microgravity by influencing reward processing, motivation, executive function and sensorimotor integration. Changes in gravity disrupt dopaminergic signaling at multiple levels, leading to impairments in motor coordination, cognitive flexibility, and emotional stability. Microgravity exposure induces a cascade of neurobiological changes that challenge dopaminergic stability at multiple levels: from the transcriptional regulation of DA synthesis enzymes and the excitability of DA neurons, to receptor distribution dynamics and the efficiency of downstream signaling pathways. These changes involve downregulation of tyrosine hydroxylase in the substantia nigra, reduced phosphorylation of DA receptors, and alterations in vesicular monoamine transporter expression, all of which compromise synaptic DA availability. Experimental findings from space analog studies and simulated microgravity models suggest that gravitational unloading alters striatal and mesocorticolimbic DA circuitry, resulting in diminished motor coordination, impaired vestibular compensation, and decreased cognitive flexibility. These alterations not only compromise astronauts’ operational performance but also elevate the risk of mood disturbances and motivational deficits during prolonged missions. The review systematically synthesizes current findings across multiple domains: molecular neurobiology, behavioral neuroscience, and gravitational physiology. It highlights that maintaining DA homeostasis is pivotal in preserving neuroplasticity, particularly within brain regions critical to adaptation, such as the basal ganglia, prefrontal cortex, and cerebellum. The paper also discusses the dual-edged nature of DA plasticity: while adaptive remodeling of synapses and receptor sensitivity can serve as compensatory mechanisms under stress, chronic dopaminergic imbalance may lead to maladaptive outcomes, such as cognitive rigidity and motor dysregulation. Furthermore, we propose a conceptual framework that integrates homeostatic neuroregulation with the demands of space environmental adaptation. By drawing from interdisciplinary research, the review underscores the potential of multiple intervention strategies including pharmacological treatment, nutritional support, neural stimulation techniques, and most importantly, structured physical exercise. Recent rodent studies demonstrate that treadmill exercise upregulates DA transporter expression in the dorsal striatum, enhances tyrosine hydroxylase activity, and increases DA release during cognitive tasks, indicating both protective and restorative effects on dopaminergic networks. Thus, exercise is highlighted as a key approach because of its sustained effects on DA production, receptor function, and brain plasticity, making it a strong candidate for developing effective measures to support astronauts in maintaining cognitive and emotional stability during space missions. In conclusion, the paper not only underscores the centrality of DA homeostasis in space neuroscience but also reflects the authors’ broader academic viewpoint: understanding the neurochemical substrates of behavior under microgravity is fundamental to both space health and terrestrial neuroscience. By bridging basic neurobiology with applied space medicine, this work contributes to the emerging field of gravitational neurobiology and provides a foundation for future research into individualized performance optimization in extreme environments.

In view of the few studies on the influence of Armillaria spp. infection on the content of the chemical components in different parts of Polyporus umbellatus sclerotia, this study determined the biomass of P. umbellatus sclerotia and the contents of ergosterol, polyporusterone A, polyporusterone B and polysaccharide in the separated cavity wall of the sclerotia and the uninfected part of the sclerotia in different harvesting years under the conditions of A. gallica and A. mellea infection respectively. According to the difference of content and dynamic changes of the polysaccharide and the steroid substances, the superior Armillaria sp. was screened to obtain the best harvest years of P. umbellatus. Using HPLC and UV-VIS spectrophotometry methods, the contents of ergosterol, polyporusterone A, polyporusterone B and polysaccharide in P. umbellatus sclerotia infected by the two Armillaria spp. in different years were determined. In addition, the differentially expressed genes related to P. umbellatus polysaccharide synthesis were screened according to the transcriptomic data of different parts of P. umbellatus after A. mellea infection. With the increase of years, the biomass of sclerotia infected by different Armillaria spp. had significant differences, and there were significant differences in the four components of sclerotia. The four components of the separated cavity wall of the sclerotia were significantly higher than those of the uninfected part. The best harvest time was the third year after cultivation. Transcriptomic analysis showed that the infection of Armillaria spp. could significantly promote polysaccharide synthesis, which provided a basis for polysaccharide content determination at the molecular level. The study clarified the influence of different Armillaria spp. infection on the accumulation of chemical components of P. umbellatus sclerotia, laying a foundation for exploring the symbiosis mechanism and provided a scientific clue for screening superior Armillaria sp. and guiding the artificial cultivation of P. umbellatus sclerotia.

Objective:To investigate the adjunctive diagnostic value of retinal imaging structural parameters combined with apolipoprotein E (ApoE) gene polymorphisms for Alzheimer′s disease (AD).Methods:It was a case-control study, 71 confirmed AD patients who attended the Department of Neurology in Sichuan Provincial People′s Hospital from May 2023 to June 2024 and 156 healthy medical checkups who participated in medical checkups in the Health Management Center were continuously with convenience sampling method; the subjects were included as the AD case group and healthy control group, respectively. Optical coherence tomography (OCT) was used to measure the structural parameters of retinal imaging such as the thickness of the retinal nerve fiber layer (RNFL) and the retinal nerve fiber layer-inner plexiform layer (RNFL-IPL) in the study subjects. Information on demographic characteristics and disease history of the study participants were collected through a questionnaire, and venous blood was collected to test for ApoE gene polymorphisms. The retinal imaging structural parameters, ApoE gene polymorphisms and other related indicators were included in a multifactorial logistic regression model to analyze the main factors affecting the risk of AD. Based on the results of the multifactorial analysis, the receiver operating characteristic (ROC) curves were plotted and the areas under the curve (AUC) were calculated to evaluate the efficacy of different models in the adjunctive diagnosis of AD.Results:Of the 227 study subjects included in the analysis, 153 were females and 74 were males; there were 71 cases in the AD case group with a mean age of (66.73±8.83) years, and there were 156 subjects in the healthy control group with an average age of (61.95±8.21) years. Educational attainment of elementary school and below ( OR=4.683, 95% CI: 2.133-10.282), living visual acuity<0.5 ( OR=2.716, 95% CI: 1.12-6.583), and carrying ≥1 ApoE ε4 genes ( OR=5.331, 95% CI: 2.309-11.891) were positively correlated with the risk of AD. RNFL thickening ( OR=0.923, 95% CI: 0.854-0.998) was negatively associated with the risk of AD (all P<0.05). The AD risk assessment model (Model 4), which included fundus imaging features and ApoE gene polymorphisms, had the highest predictive efficacy (AUC=0.857, P<0.001). Conclusion:Retinal imaging structural parameters differ significantly between AD patients and healthy examinees, and a risk assessment model combining retinal imaging structural parameters and ApoE gene polymorphisms has high predictive value and is expected to serve as an auxiliary diagnostic tool for AD.

OBJECTIVE: To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM). METHODS: This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis. RESULTS: Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings. CONCLUSIONS RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Arthritis, Rheumatoid/drug therapy* ; Glucocorticoids/therapeutic use* ; Medicine, Chinese Traditional ; Retrospective Studies

Objective:To observe the characteristics of multi-muscle surface electromyography (sEMG) network indices during static standing among hemiplegic stroke survivors, and to evaluate the value of the indices in assessing neuromuscular dysfunction.Methods:Ten male stroke survivors with hemiplegia were recruited into the hemiplegia group, and 10 age-matched healthy males were chosen as the control group. Both groups were required to perform 30s static standing tasks with their eyes open and closed. The sEMG signals from the bilateral gluteus maximus (GM), rectus femoris (RF) and biceps femoris (BF) muscles were synchronously collected. Linear time-frequency domain indices were then calculated from the sEMG signals, including the root mean square (RMS) and median frequency (MF). Network indices were extracted from the multiplex recurrence network and weighted networks were constructed from the sEMG signals, including the average interlayer mutual information (I), average edge overlap (ω), clustering coefficient (C), average shortest path length (L) and degree of centrality (DC).Results:With the eyes closed, the RMS values of the bilateral GMs of the hemiplegia group, as well as the values for the RF and BF on the unaffected side were significantly higher than the control group′s values. In the hemiplegia group, the RMS values of the RF and BF muscles on the unaffected side were significantly higher than on the affected side during standing with the eyes closed. For the RF muscles the RMS values on the unaffected side were, on average, significantly higher than with the eyes open. The MF of the GM muscles on the unaffected side in the hemiplegia group was significantly lower than the average MF values of the bilateral GM muscles in the control group with the eyes open or closed. With the eyes closed, the MF of the unaffected-side GM was significantly lower than that of the affected-side GM in the hemiplegia group. Compared with the control group, the hemiplegia group showed a significant increase in I and ω values, but a significant decrease in L values with the eyes open or closed. The DC values of the bilateral GM, RF and BF muscles in the hemiplegia group were significantly higher than among the control group with the eyes open, which was also true of the bilateral GM and RF muscles with the eyes closed. With the BF muscles it was true only of the unaffected side. In the hemiplegia group, the DC values of the unaffected-side GM with the eyes open or closed, and of the unaffected-side BF with the eyes closed.Conclusions:When standing still, hemiplegic stroke survivors exhibit increased overall synchronous muscle adjustment with involvement of unaffected-side muscles, especially the GM. sEMG network indices such as I, ω, L and DC can assess multi-muscle synchronous adaptability and the involvement of single muscles. sEMG network algorithms thus have potential as a new method for localizing and quantitatively assessing neuromuscular dysfunction among such patients.

Objective:To develop a treatment-related quality of life scale for Chinese patients with multiple myeloma (MM) and to test its reliability and validity.Methods:The initial scale was constructed through a literature search, Delphi expert correspondence, and cognitive testing. This study conducted a preliminary survey of 379 patients with MM and a formal survey of 865 patients from the hematology departments of 155 hospitals nationwide from February 2024 to March 2024. The final scale was obtained after conducting item analysis and reliability and validity tests on the initial scale.Results:The constructed scale contains 36 items covering six domains: physiological, psychological, social, treatment side effects, general health, and others. In the preliminary survey, the Cronbach’s alpha coefficient of each item ranged from 0.597 to 0.939, and the test-retest reliability was 0.747 ( P<0.001). Exploratory factor analysis extracted eight common factors with a cumulative variance contribution of 60.058%. In the formal survey, the Cronbach’s alpha coefficient of each item ranged from 0.484 to 0.930, and the test-retest reliability was 0.835 ( P<0.001). Confirmatory factor analysis revealed a comparative fit index of 0.750, a root-mean-square error of approximation of 0.090, and a root-mean-square residual of 0.067. Conclusion:The treatment-related quality of life scale for Chinese patients with MM designed in this study exhibited good reliability and validity, reflecting the impact of treatment on the quality of life of patients. This scale can provide a reference to clinicians for assessing the disease status of patients.