1.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
2.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
3.Xiaoyao Shukun Decoction Treats Sequelae of Pelvic Inflammatory Disease by Regulating Neutrophil Extracellular Traps via PI3K/Akt/mTOR Pathway
Jing PAN ; Bing ZHANG ; Chunxiao DANG ; Jinxiao LI ; Pengfei LIU ; Xiao YU ; Yuchao WANG ; Jinxing LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(15):69-78
ObjectiveTo investigate how Xiaoyao Shukun decoction (XYSKD) regulates the formation and release of neutrophil extracellular traps (NETs) via the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt)/mammalian target of rapamycin (mTOR) signaling pathway, thereby reducing inflammation, inhibiting the excessive proliferation of fibroblasts in pelvic adhesion tissue, decreasing adhesion and fibrosis, and repairing the tissue damage in sequelae of pelvic inflammatory disease (SPID). MethodsA total of 84 Wistar rats were randomly allocated into seven groups: blank, model, XYSKD (8 mg·kg-1), mTOR agonist (10 mg·kg-1), mTOR agonist + XYSKD (10 mg·kg-1+8 mg·kg-1), mTOR inhibitor (2 mg·kg-1), and mTOR inhibitor + XYSKD (2 mg·kg-1+8 mg·kg-1). The rat model of SPID was constructed by starvation, fatigue, and ascending Escherichia coli infection. After 14 days of drug intervention, the ultrastructure of fibroblasts in the pelvic adhesion tissue was observed by transmission electron microscopy. The general morphology of the uterus, fallopian tube, and ovary was observed by laparotomy. The levels of interleukin-1β (IL-1β), interleukin-17 (IL-17), and tumor necrosis factor-α (TNF-α) in the peritoneal flushing fluid were determined by enzyme-linked immunosorbent assay (ELISA). The expression of myeloperoxidase (MPO) and citrullinated histone 3 (H3) in the fallopian tube was detected by immunofluorescence. Western blot and Real-time quantitative polymerase chain reaction (Real-time PCR) were employed to determine the relative protein and mRNA levels, respectively, of neutrophil elastase (NE), intercellular adhesion molecule-1 (CD54), α-smooth muscle actin (α-SMA), H3, PI3K, and Akt. ResultsCompared with the blank group, the model group presented a large number of collagen fibers in bundles, numerous cytoplasmic folds of fibroblasts, reduced or absent mitochondrial cristae, and disordered and expanded endoplasmic reticulum. By laparotomy, extensive pelvic congestion, connective tissue hyperplasia, thickening and hardening of the tubal end near the uterus, and tubal and ovarian adhesion or cyst were observed in the model group. In addition, the model group showed raised levels of IL-1β, IL-17, and TNF-α in the peritoneal flushing fluid (P<0.01), increased average fluorescence intensities of MPO and H3 (P<0.01), and up-regulated protein and mRNA levels of NE, H3, CD54, PI3K, and Akt (P<0.01). Compared with the model group, the mTOR agonist group showed increased fibroblasts and cytoplasmic folds, absence of mitochondrial cristae, endoplasmic reticulum dilation, and evident collagen fiber hyperplasia. Pelvic adhesions were observed to cause aggravated damage to the uterine, fallopian tube, and ovarian tissues. The levels of IL-1β, IL-17, and TNF-α in the peritoneal lavage fluid elevated (P<0.01) and the average fluorescence intensities of MPO and H3 enhanced (P<0.01) in the mTOR agonist group. In contrast, the XYSKD group and the mTOR inhibitor group showcased decreased fibroblasts and collagen fibers, alleviated mitochondrial crista loss and endoplasmic reticulum dilation, improved morphology and appearance of the uterine, fallopian tube, and ovarian tissues, lowered levels of IL-1β, IL-17, and TNF-α in the peritoneal lavage fluid (P<0.01), decreased average fluorescence intensities of MPO and H3 (P<0.01), and down-regulated protein and mRNA levels of NE, H3, CD54, PI3K, and Akt (P<0.05). Compared with the mTOR agonist group, the mTOR agonist + XYSKD group showed alleviated pathological changes in the pelvic tissue, declined levels of IL-1β, IL-17, and TNF-α (P<0.01), decreased average fluorescence intensities of MPO and H3 (P<0.01), and down-regulated protein levels of NE, H3, CD54, α-SMA, p-PI3K/PI3K, and p-Akt/Akt (P<0.01) and mRNA levels of NE, H3, CD54, α-SMA, PI3K, and Akt (P<0.01). Compared with the mTOR inhibitor group, the mTOR inhibitor + XYSKD group demonstrated reduced pathological severity of the pelvic tissue, reduced levels of IL-1β, IL-17, and TNF-α (P<0.01), decreased average fluorescence intensities of MPO and H3 (P<0.01), and down-regulated protein and mRNA levels of NE and CD54 (P<0.05). ConclusionXYSKD can inhibit the excessive formation and release of NETs via PI3K/Akt/mTOR to ameliorate the inflammatory environment and reduce fibrosis and adhesion of the pelvic tissue, thereby playing a role in the treatment of SPID. It may exert the effects by lowering the levels of IL-1β, IL-17, and TNF-α and down-regulating the expression of NE, H3, CD54, α-SMA, PI3K, and Akt in the pelvic adhesion tissue.
4.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
5.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
6.Corrective effect of femtosecond laser assisted laser in situ keratomileusis Xtra on patients with moderate to high myopia after 2a postoperatively
Jinxiao LI ; Di SHEN ; Kun ZHOU ; Xiyu SUN ; Yani WANG ; Wei WEI
International Eye Science 2024;24(2):295-300
AIM:To evaluate corrective effect and stability of corneal morphology in patients with moderate to high myopia after 2a treatment of femtosecond laser assisted laser in situ keratomileusis(FS-LASIK)Xtra.METHODS:Retrospective case-control study. A total of 30 cases(58 eyes)Patients with moderate to high myopia combined with astigmatism who planned to undergo refractive surgery in our hospital from August 2019 to August 2020 were included, and different types of surgery were performed respectively based on the relevant index of keratoconus screening in the preoperative corneal topography. They were divided into FS-LASIK group and Xtra group, with 15 cases(29 eyes)in each group. Uncorrected visual acuity(UCVA), best corrected visual acuity(BCVA), spherical equivalent(SE)and the corneal curvature of the anterior and posterior surfaces of different diameters(3, 5 and 7 mm)measured by Sirius three-dimensional corneal topography were observed preoperatively and 3 mo, 1 and 2 a postoperatively.RESULTS: The UCVA of the two groups of patients at different time points after surgery was significantly increased compared with preoperatively(both P<0.01), and there was no difference in UCVA and SE between the two groups(P>0.05). After 2 a postoperatively, residual astigmatism was -0.25-0 D in 25 eyes(86%)of the FS-LASIK Xtra group and 24 eyes(83%)of the FS-LASIK group. The actual corrected SE and expected corrected SE of both groups were positively correlated(both P<0.05). There were differences in corneal curvature on the surface of different diameter areas(3, 5, and 7 mm)between the two groups at 3 mo, 1, and 2 a postoperatively compared with preoperatively. After 1 and 2 a postoperatively, the corneal posterior surface curvature of the FS-LASIK Xtra group with corneal diameter of 3 and 5 mm was higher than that of the FS-LASIK group(P<0.05).CONCLUSIONS:FS-LASIK Xtra has good safety, efficacy and predictability in correcting patients with moderate to high myopia.
7.Characteristics of quantitative EEG parameters in patients with acute ischemic stroke
Jiamei LI ; Jinxiao CAI ; Xin YU
Journal of Navy Medicine 2024;45(8):842-846
Objective To analyze the characteristics of quantitative electroencephalogram(qEEG)parameters in patients with acute ischemic stroke.Methods The clinical data of 81 AIS patients who were admitted to No.971 Hospital of PLA Navy from August 2022 to August 2023 and 68 healthy controls were collected.All the subjects were examined by qEEG.Stroke patients were assessed by National Institutes of Health Stroke Scale(NIHSS)and the locations of infarction were determined by imaging examination.Basic data and qEEG parameters were compared between AIS patients and healthy controls.The qEEG parameters were compared in AIS patients with different NIHSS scores,infarction sites,anterior or posterior circulation.The correlations between qEEG parameters and NIHSS scores were analyzed.Results The δ and θ wave power values,DAR(δ/α)and DTABR([δ+θ]/[α+β])values of qEEG in AIS patients were significantly higher than those in the healthy controls(all P<0.05).The values of DAR and DTABR in patients with NIHSS>5 were higher than those in patients with NIHSS≤5(P<0.05).The δ,θ and β wave power in patients with subcortical infarction were significantly higher than those in patients with brainstem infarction(all P<0.05).There were no significant differences in qEEG parameters between patients with anterior and posterior circulation.Pearson correlation analysis showed that DAR and DTABR values were positively correlated with NIHSS score(P<0.05).Conclusion AIS can affect the changes of qEEG parameters.qEEG parameters are related to neurological impairment in AIS patients,which may help to evaluate neurological impairment in patients with stroke.
8.Predictive value of serum N-terminal pro-B-type natriuretic peptide concentration for postoperative acute kidney injury in neonates undergoing cardiac surgery: based on pROCK criteria
Peiyao ZHANG ; Yuanyuan TONG ; Yixuan LI ; Liting BAI ; Yu JIN ; Peng GAO ; Wenting WANG ; Jinxiao HU ; Jinping LIU
Chinese Journal of Anesthesiology 2022;42(4):389-393
Objective:To evaluate the predictive value of the serum N-terminal pro-B-type natriuretic peptide (NT-proBNP) concentration for postoperative acute kidney injury (AKI) in neonates undergoing cardiac surgery.Methods:Perioperative data of 110 consecutive neonates (≤28 days) who underwent cardiac surgery in our hospital from October 2017 to May 2021, were collected retrospectively.According to pROCK criteria, the patients were divided into AKI group and non-AKI group.Demographics, predominant diagnosis, laboratory examination, perioperative management and postoperative outcomes were compared between two groups.The concentration of serum NT-proBNP was routinely measured within 12 h after operation.Multivariate logistic regression analysis was performed for the association between serum NT-proBNP and postoperative AKI.Receiver operating characteristic curve was drawn, and the predictive value of serum NT-proBNP for postoperative AKI was determined according to the area under the curve.Results:A total of 106 neonates were enrolled, and the incidence of postoperative AKI was 54.7%.There were significant difference in the baseline hemoglobin concentration, hematocrit and serum creatinine and serum NT-proBNP concentration between AKI group and non-AKI group ( P<0.05). Multivariate logistic regression analysis indicated that NT-proBNP level was an independent risk factor for AKI after cardiac surgery in neonates ( odds ratio 2.49, 95% confidence interval 1.183-5.23, P=0.016). The area under the curve of NT-proBNP predicting AKI after cardiac surgery was 0.66 (95% confidence interval 0.56-0.76, P=0.007). Conclusions:Elevated serum NT-proBNP concentration is an independent risk factor for AKI after cardiac surgery in neonates and has a certain predictive value for AKI, and close monitoring of perioperative NT-proBNP level is helpful for early identification of high-risk neonates.
9.Investigation of infection status of Yersinia in main host animals of plague in Xiahe and Luqu counties of Gansu Province
Daqin XU ; Jinxiao XI ; Hua CHUN ; Yanyan HUANG ; Li WANG ; Chen ZHANG ; Binguo RONG ; Donghui ZHAN ; Jiagui FENG
Chinese Journal of Endemiology 2021;40(4):303-308
Objective:To investigate the infection status of Yersinia in the main host animals of plague in Xiahe and Luqu counties, the Himalayan marmot plague foci of Gansu Province, and to provide a basis for exploring the epidemic status of plague in these foci. Methods:Samples of the ileocecal region and contents, pharyngeal swabs (or tongue roots), and blood of the main host animals of plague in Xiahe County and Luqu County where the plague were active in the 1950s and 1960s were collected from 2014 to 2018. The Yersinia isolation, virulence determination and F1 antibody detection were performed, respectively. Results:Totally 24 strains of Yersinia were detected in 958 samples of ileocecal region and contents with a bacterial detection rate of 2.51%, which were 13 strains of Yersinia enterocolitia (Y.e), 1 strain of Yersinia kristensenii (Y.k), 2 strains of Yersinia frederiksenii/ intermedia (Y.f/i), 6 strains of Yersinia intermedia (Y.i), 1 strain of Yersinia aldouae (Y.a) and 1 strain of Yersinia massiliensis (Y.m). Totally 19 strains of Yersinia were detected in 958 samples of pharyngeal swabs (or tongue roots), and the detection rate was 1.98%, which were 8 strains of Y.e, 1 strain of Yersinia pseudotuberculosis (Y.p), 4 strains of Y.k, 1 strain of Y.f/i, 4 strains of Y.i, and 1 strain of Yersinia ruckeri (Y.r). The virulence types of 21 strains of Y.e were ail -ystA -ystB +yadA -virF -rfbc -, ail -ystA -ystB -yadA -virF -rfbc -, respectively, accounting for 9.52% (2/21) and 90.48% (19/21), none were pathogenic. The results of F1 antibody in 1 079 serum samples were all negative. Conclusions:Yersinia are widely found in the pharynx and intestines of the main host animals of plague in Xiahe and Luqu counties, and the Y.e detected are all non-pathogenic strains. The results of this investigation can provide clues for further study on the preservation of Yersinia pestis in host animals and their living environment.
10.Genotyping of Yersinia pestis isolated from Gansu Province by clustered regularly interspaced short palindromic repeats
Yajun GE ; Pengfei GE ; Jinxiao XI ; Wei LI ; Hong ZHANG ; Na MA ; Bin WU ; Limin GUO ; Daqin XU
Chinese Journal of Endemiology 2017;36(6):404-407
Objective To type Yersinia pestis isolated from Gansu Province,and to study the trend of diffreent strains in different administrative regions and different years.Methods Totally 193 strains were enrolled in this study,including 9 strains of Ganning Dauricus type,18 strains of Aerjin type,45 strains of Qilian type and 121 strains of Qingzang type.These strains were genotyped by clustered regularly interspaced short palindromic repeats (CRISPR),and genotypes were named according to international standard.Genotyping by CRISPR in different administrative regions and different years of Gansu Province was explored.Results Two clusters (Ca7 and Cb4),including four genotypes (genotypes 7,22,24 and 26) were classified by CRISPR.From the point of view of origin,genotype 24 was the main genotype in Akesai 36.36% (16/44),Subei 36.17% (17/47),Yumen 50.00% (5/10) and Su'nan 38.67% (29/75);the main genotype of Xiahe and Huining was genotype 26 (4/7);the main genotype of Shandan was genotype 22 (1/1).From the point of view of time,the main genotype of Yersiniapestis in Gansu Province during the years of 1960-1969,1970-1979 and 1980-1989 was genotype 26 [53.33% (8/15),60.00% (6/10) and 48.28% (14/29)];the main genotype was genotype 22 [40.91% (18/44)] during the years of 1990-1999;and the main genotype was genotype 24 [43.16% (41/95)] during the years of 2000-2009.Conclusion Four genotypes of Yersiniapestis in Gansu Province are quite different in different administrative regions and different years.

Result Analysis
Print
Save
E-mail