Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.

OBJECTIVE To observe intervention effect of salvianolic acid B based on JAK2/STAT3 pathways on the rats with Escherichia coli infection-induced pyelonephritis.METHODS Totally 60 SPF grade male SD rats were in-cluded in the study and were randomly divided into the control group with 21 rats,the model group(Escherichia coli infection-induced pyelonephritis)with 18 rats and the salvianolic acid B group(Escherichia coli infection-in-duced pyelonephritis+salvianolic acid B)with 18 rats.The control group and the model group were treated with same volume of normal saline for gavage,the salvianolic acid B group was given 12.5 mg/kg salvianolic acid B wa-ter solution for gavage.The levels of related biochemical indexes[secretory immunoglobulin A(SlgA),urine cre-atinine and serum creatinine]were detected for the groups.The organ indexes and relative expression levels of JAK2/STAT3 signaling pathways were observed and compared among the groups.RESULTS There were significant differences in the levels of blood indexes among the three groups of rats(P＜0.05).The SlgA level of the model group was(13.51±1.18)μg/ml,lower than(25.64±4.51)μg/ml of the control group(P＜0.05);the SlgA level of the salvian-olic acid B group was(25.34±2.95)μg/ml,higher than that of the model group(P＜0.05).There were no significant differences in the bladder indexes among the three groups;the ratio of left kidney to right kidney and the renal indexes were higher in the model group than in the control group(P＜0.05);the ratio of left kidney to right kidney and the renal indexes were lower in the salvianolic acid B group than in the model group(P＜0.05).There were significant differences in the relative expression levels of JAK2/STAT 3 signaling pathways among the three groups(P＜0.05);the levels of JAK2 and STAT 3 of the model group were higher than those of the control group(P＜0.05);the levels of JAK2 and STAT 3 of the salvianolic acid B group were lower than those of the model group(P＜0.05).CONCLUSION The salvian-olic acid B based on JAK2/STAT3 pathways may improve the indexes of the rats with E.coli infection-induced pyelonephritis and effectively improve the overall symptoms.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

OBJECTIVE To observe intervention effect of salvianolic acid B based on JAK2/STAT3 pathways on the rats with Escherichia coli infection-induced pyelonephritis.METHODS Totally 60 SPF grade male SD rats were in-cluded in the study and were randomly divided into the control group with 21 rats,the model group(Escherichia coli infection-induced pyelonephritis)with 18 rats and the salvianolic acid B group(Escherichia coli infection-in-duced pyelonephritis+salvianolic acid B)with 18 rats.The control group and the model group were treated with same volume of normal saline for gavage,the salvianolic acid B group was given 12.5 mg/kg salvianolic acid B wa-ter solution for gavage.The levels of related biochemical indexes[secretory immunoglobulin A(SlgA),urine cre-atinine and serum creatinine]were detected for the groups.The organ indexes and relative expression levels of JAK2/STAT3 signaling pathways were observed and compared among the groups.RESULTS There were significant differences in the levels of blood indexes among the three groups of rats(P＜0.05).The SlgA level of the model group was(13.51±1.18)μg/ml,lower than(25.64±4.51)μg/ml of the control group(P＜0.05);the SlgA level of the salvian-olic acid B group was(25.34±2.95)μg/ml,higher than that of the model group(P＜0.05).There were no significant differences in the bladder indexes among the three groups;the ratio of left kidney to right kidney and the renal indexes were higher in the model group than in the control group(P＜0.05);the ratio of left kidney to right kidney and the renal indexes were lower in the salvianolic acid B group than in the model group(P＜0.05).There were significant differences in the relative expression levels of JAK2/STAT 3 signaling pathways among the three groups(P＜0.05);the levels of JAK2 and STAT 3 of the model group were higher than those of the control group(P＜0.05);the levels of JAK2 and STAT 3 of the salvianolic acid B group were lower than those of the model group(P＜0.05).CONCLUSION The salvian-olic acid B based on JAK2/STAT3 pathways may improve the indexes of the rats with E.coli infection-induced pyelonephritis and effectively improve the overall symptoms.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.

Objective:To investigate the infection status of Yersinia in the main host animals of plague in Xiahe and Luqu counties, the Himalayan marmot plague foci of Gansu Province, and to provide a basis for exploring the epidemic status of plague in these foci. Methods:Samples of the ileocecal region and contents, pharyngeal swabs (or tongue roots), and blood of the main host animals of plague in Xiahe County and Luqu County where the plague were active in the 1950s and 1960s were collected from 2014 to 2018. The Yersinia isolation, virulence determination and F1 antibody detection were performed, respectively. Results:Totally 24 strains of Yersinia were detected in 958 samples of ileocecal region and contents with a bacterial detection rate of 2.51%, which were 13 strains of Yersinia enterocolitia (Y.e), 1 strain of Yersinia kristensenii (Y.k), 2 strains of Yersinia frederiksenii/ intermedia (Y.f/i), 6 strains of Yersinia intermedia (Y.i), 1 strain of Yersinia aldouae (Y.a) and 1 strain of Yersinia massiliensis (Y.m). Totally 19 strains of Yersinia were detected in 958 samples of pharyngeal swabs (or tongue roots), and the detection rate was 1.98%, which were 8 strains of Y.e, 1 strain of Yersinia pseudotuberculosis (Y.p), 4 strains of Y.k, 1 strain of Y.f/i, 4 strains of Y.i, and 1 strain of Yersinia ruckeri (Y.r). The virulence types of 21 strains of Y.e were ail -ystA -ystB +yadA -virF -rfbc -, ail -ystA -ystB -yadA -virF -rfbc -, respectively, accounting for 9.52% (2/21) and 90.48% (19/21), none were pathogenic. The results of F1 antibody in 1 079 serum samples were all negative. Conclusions:Yersinia are widely found in the pharynx and intestines of the main host animals of plague in Xiahe and Luqu counties, and the Y.e detected are all non-pathogenic strains. The results of this investigation can provide clues for further study on the preservation of Yersinia pestis in host animals and their living environment.

Objective:To summarize the clinical characteristics, diagnosis and treatment of caspase recruitment domain-containing protein 9 (CARD9) gene deficiency associated invasive candidiasis, and report a novel mutation in CARD9 gene.Methods:The clinical characteristics, laboratory tests, treatment and the outcome of follow-up in a boy with invasive candidiasis were described. The boy′s main clinical manifestations were central nervous system infection and retroperitoneal mass. Whole-exome sequencing was performed and Sanger sequencing was verified to identify the CARD9 gene mutations in the patient and his parents. A literature search for “CARD9”and “invasive candidiasis”was conducted in PubMed, Wanfang and CNKI databases from their establishment to May 2020.Results:A 10-year-old boy suffered onset symptom of chronic diarrhea, which lasted for two months. The symptom was followed by progressive neurological symptoms such as headache, vomiting, seizures and disorder of consciousness. His unusual medical history was absent. Candida albicans were cultured several times in cerebrospinal fluid and blood, and yeast-like fungi were found in the stool high power field of vision. Cerebral magnetic resonance imaging indicated obstructive hydrocephalus and abdominal CT scan showed retroperitoneal mass and thickening of the intestinal wall. The whole-exome sequencing analyses of blood samples from the boy and his parents were performed. The results showed that there was a homozygous mutation of c.952-12_956delinsAG in the CARD9 gene, which was an unreported pathogenic mutation. This was confirmed by Sanger sequencing. There was no significant relief from intravenous combined antifungal medications. After lateral ventricular drainage surgery and injection of amphotericin B into the lateral ventricle, improvement of clinical symptoms and cerebral spinal fluid abnormalities was observed after nine weeks, and the retroperitoneal mass shrank. At follow-up after four-month oral combined antifungal medications, the child had no complaint except fatigue. However, cerebral spinal fluid analysis showed increased protein level and decreased glucose. Persistent hydrocephalus and periventricular white matter abnormal signals were revealed on the brain magnetic resonance imaging and the smaller retroperitoneal mass than before on the abdominal CT scan. In addition to this case, totally 21 cases with CARD9 gene deficiency associated invasive candidiasis have been reported worldwide, most of which featured central nervous system infections.Conclusions:CARD9 gene deficiency is an autosomal recessive primary immunodeficiency that confers human susceptibility to fungal disease. The associated invasive candidiasis often affects the central nervous system and makes the patient severely ill. Adequate systemic antifungal therapies should be given, and patients with hydrocephalus need surgical treatment. A novel mutation is reported that expands the variant diversity of CARD9 gene. For patients with unexplained invasive candidiasis, including those without a history of previous recurrent infection, genetic testing is recommended for primary immunodeficiency including CARD9 gene deficiency.

Objective:To observe the clinical characteristics of paroxysmal sympathetic hyperactivity (PSH) in children with acute brain injury.Methods:The clinical characteristics, hospitalization data, hospitalization cost, and prognoses of 40 children with acute brain injury admitted to our hospital from June 2018 to June 2020 were retrospectively summarized. In addition, the differences of above data between children with PSH and children without PSH were comparatively analyzed.Results:Nine children were with PSH, with an incidence of 22.5%; five were with anti- N-methyl- D-aspartate receptor (NMDAR) encephalitis, two were with acute necrotizing encephalopathy, and two were with severe viral encephalitis. Thirty-one children were without PSH; five were with metabolic encephalopathy, 19 were with viral encephalitis, three were with anti-NMDAR encephalitis, one was with acute cerebral infarction, one was with primary central nervous system lymphoma, one was with acute necrotizing encephalopathy, and one was with severe closed head injury. The patients with PSH had significantly higher proportion of patients with anti-NMDAR encephalitis, significantly higher hospitalization cost, statistically longer duration of disorder of consciousness and hospital stays, and significantly lower Glasgow coma scale (GCS) scores at discharge than the patients without PSH ( P<0.05). Conclusion:PSH is common in children with acute brain injury; PSH can lead to a long period of disorders of consciousness, long hospital stays, high hospitalization cost, and poor prognosis, which causes an increase in family and social burdens.

Objective: To explore the application value of B-ultrasound examination in gynecological acute abdomen. Methods: From October 2015 to October 2017, 150 patients with suspected gynecological acute abdomen were selected in the People's Hospital of Lishui.The effect of B-ultrasound examination in diagnosis of gynecological acute abdomen was analyzed. Results: The sensitivity, specificity and total accuracy of abdominal ultrasound in the diagnosis of gynecological acute abdomen were 75.00%(99/132), 44.44%(8/18) and 71.33%(107/150), respectively.The sensitivity, specificity and total accuracy of transvaginal ultrasound in the diagnosis of gynecological acute abdomen were 87.12%(115/132), 72.22%(13/18) and 85.33%(128/150), respectively.The sensitivity, specificity and total accuracy of abdominal combined with transvaginal ultrasonography in the diagnosis of gynecological acute abdomen were 98.48%(130/132), 94.44%(17/18) and 98.00%(147/150), respectively.The sensitivity, specificity and total accuracy of abdominal combined with transvaginal ultrasound in the diagnosis of gynecological acute abdomen were significantly higher than those of abdominal ultrasound and transvaginal ultrasound(χ²=8.658, 10.699, 9.075, all P<0.05). The diagnosis of acute pelvic inflammation, ectopic pregnancy, rupture of luteal cyst and torsion of ovarian cyst by abdominal combined with transvaginal ultrasound was better than abdominal ultrasound(χ²=13.748, 5.984, 13.524, 6.874, all P<0.05). Conclusion Abdominal ultrasound and transvaginal ultrasound can be used to diagnose gynecological acute abdomen.However, abdominal combined with vaginal ultrasound is more effective in the diagnosis of gynecological acute abdomen, and it can effectively improve the accuracy of diagnosis.