1.Effects of nebulized self-developed Zangsiwei Qingfei Mixture on airway inflammation in cigarette smoke-induced COPD mice and a network pharmacology analysis.
Meizhi LI ; Fei PENG ; Quan ZHANG ; Yanna WU ; Jingping SUN ; Si LEI ; Shangjie WU
Journal of Central South University(Medical Sciences) 2025;50(7):1113-1125
OBJECTIVES:
Chronic obstructive pulmonary disease (COPD) is a major chronic respiratory condition with high morbidity and mortality, imposing a serious economic and public health burden. The World Health Organization ranks COPD among the top 4 chronic diseases worldwide. Zangsiwei Qingfei Mixture (ZSWQF), a novel Tibetan herbal formulation independently developed by our research team, has shown therapeutic potential for chronic respiratory diseases. This study aims to evaluate the effects of aerosolized ZSWQF on cigarette smoke-induced COPD in mice and explore its underlying mechanisms.
METHODS:
Thirty C57 mice were randomly divided into a Control group, a COPD group, and a ZSWQF group. The Control group received saline aerosol inhalation without cigarette smoke exposure; both the COPD group and the ZSWQF group were exposed to cigarette smoke, with the former receiving saline inhalation and the latter treated with ZSWQF aerosol. White blood cell (WBC) count was performed using a fully automatic blood cell analyzer. Serum, alanine transaminase (ALT), and serum creatinine (SCr), as well as interleukin (IL)-6, IL-8, and tumor necrosis factor (TNF)-α levels in serum and bronchoalveolar lavage fluid (BALF) were measured by enzyme-linked immunosorbent assay (ELISA). BALF cell classification was determined using a hematology analyzer. Lung function was assessed with a small animal pulmonary function system, including airway resistance (RI) and cyclic dynamic compliance (CyDN). Lung tissues were stained with hematoxylin and eosin (HE), and mean linear intercept (MLI) and destruction index (DI) were calculated to evaluate morphological changes. Network pharmacology was applied to identify disease-related and ZSWQF-related targets, followed by intersection and protein-protein interaction (PPI) network analysis, and enrichment analysis of biological functions and pathways. Primary type II alveolar epithelial cell (AEC II) from SD rats were isolated and divided into a Control group, a lipopolysaccharide (LPS) group, a normal serum group, a water extract of ZSWQF (W-ZSWQF) group, a ZSWQF containing serum group, and a MLN-4760 [angiotensin-converting enzyme (ACE) 2 inhibitor]. Western blotting was performed to assess protein expression of ACE, p38 [a mitogen-activated protein kinase (MAPK)], phospho (p)-p38, extracellular signal-regulated kinases 1 and 2 (ERK1/2), p-ERK1/2, c-Jun N-terminal kinase (JNK), p-JNK, inhibitor of nuclear factor-kappa B alpha (IκBα), p-IκBα, and p-p65 subunit of nuclear factor-kappa B (NF-κBp65).
RESULTS:
WBC counts were significantly higher in the COPD group than in controls (P<0.01) and decreased following ZSWQF treatment (P<0.05). No significant intergroup differences were found in organ weights, ALT, or SCr (all P>0.05). Serum and BALF levels of IL-6, IL-8, and TNF-α, as well as total BALF cells, neutrophils, and macrophages, were elevated in the COPD group compared with controls and reduced by ZSWQF treatment (P<0.05). COPD mice exhibited increased RI, decreased CyDN, marked alveolar congestion, inflammatory infiltration, thickened septa, and higher MLI and DI values versus controls (P<0.05); ZSWQF treatment significantly reduced MLI and DI (P<0.05). Network pharmacology identified 151 potential therapeutic targets for ZSWQF against COPD, with key nodes including TNF, IL-6, protein kinase B (Akt) 1, albumin (ALB), tumor protein p53 (TP53), non-receptor tyrosine kinase (SRC), epidermal growth factor receptor (EGFR), signal transducer and activator of transcription 3 (STAT) 3, matrix metalloproteinase (MMP)-9, and beta-catenin (CTNNB1). Enrichment analysis indicates involvement of cancer-related, phosphatidylinositol 3-kinase (PI3K)/Akt, hypoxia-inducible factor (HIF)-1, calcium, and MAPK signaling pathways. Western blotting results showed that compared with the LPS group, AEC II treated with ZSWQF-containing serum exhibited decreased expression of ACE, p-p38/p38, p-ERK1/2/ERK1/2, p-JNK/JNK, p-IκBα/IκBα, and p-NF-κBp65, while ACE2 expression was upregulated, consistent with the MAPK/nuclear factor-kappa B (NF-κB) pathway regulation predicted by network pharmacology.
CONCLUSIONS
Aerosolized ZSWQF provides protective effects in COPD mice by reducing airway inflammation and remodeling.
Animals
;
Pulmonary Disease, Chronic Obstructive/etiology*
;
Drugs, Chinese Herbal/therapeutic use*
;
Mice
;
Mice, Inbred C57BL
;
Male
;
Network Pharmacology
;
Smoke/adverse effects*
;
Bronchoalveolar Lavage Fluid
;
Administration, Inhalation
;
Inflammation/drug therapy*
;
Tumor Necrosis Factor-alpha
;
Lung/drug effects*
;
Interleukin-6/blood*
2.Expert consensus on apical microsurgery.
Hanguo WANG ; Xin XU ; Zhuan BIAN ; Jingping LIANG ; Zhi CHEN ; Benxiang HOU ; Lihong QIU ; Wenxia CHEN ; Xi WEI ; Kaijin HU ; Qintao WANG ; Zuhua WANG ; Jiyao LI ; Dingming HUANG ; Xiaoyan WANG ; Zhengwei HUANG ; Liuyan MENG ; Chen ZHANG ; Fangfang XIE ; Di YANG ; Jinhua YU ; Jin ZHAO ; Yihuai PAN ; Shuang PAN ; Deqin YANG ; Weidong NIU ; Qi ZHANG ; Shuli DENG ; Jingzhi MA ; Xiuping MENG ; Jian YANG ; Jiayuan WU ; Yi DU ; Junqi LING ; Lin YUE ; Xuedong ZHOU ; Qing YU
International Journal of Oral Science 2025;17(1):2-2
Apical microsurgery is accurate and minimally invasive, produces few complications, and has a success rate of more than 90%. However, due to the lack of awareness and understanding of apical microsurgery by dental general practitioners and even endodontists, many clinical problems remain to be overcome. The consensus has gathered well-known domestic experts to hold a series of special discussions and reached the consensus. This document specifies the indications, contraindications, preoperative preparations, operational procedures, complication prevention measures, and efficacy evaluation of apical microsurgery and is applicable to dentists who perform apical microsurgery after systematic training.
Microsurgery/standards*
;
Humans
;
Apicoectomy
;
Contraindications, Procedure
;
Tooth Apex/diagnostic imaging*
;
Postoperative Complications/prevention & control*
;
Consensus
;
Treatment Outcome
3.Expert consensus on difficulty assessment of endodontic therapy
Huang DINGMING ; Wang XIAOYAN ; Liang JINGPING ; Ling JUNQI ; Bian ZHUAN ; Yu QING ; Hou BENXIANG ; Chen XINMEI ; Li JIYAO ; Ye LING ; Cheng LEI ; Xu XIN ; Hu TAO ; Wu HONGKUN ; Guo BIN ; Su QIN ; Chen ZHI ; Qiu LIHONG ; Chen WENXIA ; Wei XI ; Huang ZHENGWEI ; Yu JINHUA ; Lin ZHENGMEI ; Zhang QI ; Yang DEQIN ; Zhao JIN ; Pan SHUANG ; Yang JIAN ; Wu JIAYUAN ; Pan YIHUAI ; Xie XIAOLI ; Deng SHULI ; Huang XIAOJING ; Zhang LAN ; Yue LIN ; Zhou XUEDONG
International Journal of Oral Science 2024;16(1):15-25
Endodontic diseases are a kind of chronic infectious oral disease.Common endodontic treatment concepts are based on the removal of inflamed or necrotic pulp tissue and the replacement by gutta-percha.However,it is very essential for endodontic treatment to debride the root canal system and prevent the root canal system from bacterial reinfection after root canal therapy(RCT).Recent research,encompassing bacterial etiology and advanced imaging techniques,contributes to our understanding of the root canal system's anatomy intricacies and the technique sensitivity of RCT.Success in RCT hinges on factors like patients,infection severity,root canal anatomy,and treatment techniques.Therefore,improving disease management is a key issue to combat endodontic diseases and cure periapical lesions.The clinical difficulty assessment system of RCT is established based on patient conditions,tooth conditions,root canal configuration,and root canal needing retreatment,and emphasizes pre-treatment risk assessment for optimal outcomes.The findings suggest that the presence of risk factors may correlate with the challenge of achieving the high standard required for RCT.These insights contribute not only to improve education but also aid practitioners in treatment planning and referral decision-making within the field of endodontics.
4.Clinical efficacy and safety of the self-developed Zangsiwei Qingfei Mixture combined with conventional treatment in patients with acute exacerbation of chronic obstructive pulmonary disease
Qiong YI ; Fang LI ; Si LEI ; Fei PENG ; Quan ZHANG ; Yanna WU ; Jingping SUN ; Shangjie WU
Journal of Central South University(Medical Sciences) 2024;49(6):921-931
Objective:Chronic obstructive pulmonary disease(COPD)is a significant global public health issue.Modern medical treatments have both benefits and limitations,prompting increasing attention from scholars worldwide on traditional ethnic medicine,and the Zangsiwei Qingfei Mixture is a newly developed formula derived from the effective components of classical Tibetan medicine to treat chronic respiratory diseases.This study aims to investigate the clinical efficacy and safety of the Zangsiwei Qingfei Mixture combined with conventional treatment in patients with acute exacerbation of chronic obstructive pulmonary disease(AECOPD). Methods:Sixty AECOPD patients admitted to the Second Xiangya Hospital of Central South University from May 2021 to May 2023 were enrolled and randomly divided into 2 groups,with 30 patients in each group.The control group received conventional treatment,including bronchodilators,anti-infection agents,expectorants,and oxygen therapy.The experimental group received the Zangsiwei Qingfei Mixture in addition to conventional treatment.The treatment duration was 7 d for both groups.Baseline data such as gender,age,body mass index(BMI),smoking status,Global Initiative for Chronic Obstructive Lung Disease(GOLD)classification,COPD course,and the number of COPD exacerbations in the past year were collected.The primary efficacy indicators were assessed using the modified Medical Research Council(mMRC)dyspnea scale and the modified Borg scale.Secondary indicators included arterial lactic acid(LAC)and serum tumor necrosis factor alpha(TNF-α)levels.Safety indicators included liver and kidney function[alanine transaminase(ALT),aspartate transaminase(AST),serum creatinine(SCr),serum uric acid(SUA)],coagulation function[activated partial thromboplastin time(APTT),prothrombin time(PT),fibrinogen(FIB),and D-dimer].The generalized linear mixed model(GLMM)was used to evaluate the clinical efficacy and safety of the Zangsiwei Qingfei Mixture. Results:Before treatment,there were no statistically significant differences in general baseline data,grading of mMRC dyspnea scale,score of modified Borg scale,arterial LAC,ALT,AST,SCr,SUA,APTT,FIB,and D-dimer between the 2 groups(all P>0.05).However,serum TNF-α and PT levels in the experimental group were significantly lower than those in the control group(both P<0.05).GLMM analysis showed that after adjusting for pre-and post-treatment,gender,age,BMI,smoking status,GOLD classification,COPD course,and the number of COPD exacerbations in the past year,the experimental group demonstrated significantly lower grading of mMRC dyspnea scale(coefficient=-0.329,P=0.036),score of modified Borg scale(coefficient=-1.077,P=0.001),serum TNF-α level(coefficient=-14.378,P<0.001),and arterial LAC level(coefficient=-0.409,P=0.012)compared to the control group.The Zangsiwei Qingfei Mixture had no significant effect on liver,kidney,or coagulation function indicators(all P>0.05). Conclusion:The Zangsiwei Qingfei Mixture combined with conventional treatment can improve clinical symptoms and promote homeostasis in AECOPD patients,demonstrating safety and reliability.Combining modem medicine with traditional ethnic medicine offers a feasible approach to treating chronic respiratory diseases in the future.
5.Analysis of the characteristics and therapeutic effect of consonant errors in children with functional articulation disorders at different ages
WU Xiaolu ; YU Guoxia ; CHEN Renji ; WANG Li ; HAO Jingping
Journal of Prevention and Treatment for Stomatological Diseases 2023;31(12):871-876
Objective:
Analyzing the characteristics of consonant errors in children with functional dysarthria in different age groups and the effect of speech training provides a reference for clinical treatment.
Methods :
This study followed medical ethics, and informed consent has been obtained from patients. Speech data from 388 patients with functional dysarthria were retrospectively studied. They were divided into two groups at the age of 6, namely, the preschool group (4-6 years old) of 226 patients and the school age group (6-13 years old, including 6 years old) of 162 patients. The characteristics of consonant pronunciation errors from four aspects were analyzed: average number of errors, pronunciation location, pronunciation method, and error type. One-on-one speech training was conducted, with a training frequency of once a week and once for 30 minutes. The training method was carried out in the order of phoneme training, syllable training, vocabulary training, sentence training, and short text and conversation training. The effects of speech training in the two groups were compared.
Results:
Analysis by pronunciation location: both age groups had the highest frequency of errors in tongue tip posterior sounds; the school age group had the lowest error frequency for labiodental consonants, and the preschool group had the lowest error frequency for bilabial consonants. According to the analysis of pronunciation mode, both age groups had the highest error frequency of aspirated affricate and the lowest error frequency of nasal sound. Analysis by error type: both age groups are mainly characterized by substitution and omission. Compared with the preschool group, most consonants of patients in the school group tend to improve in terms of pronunciation location, pronunciation mode, and error types. Compared with the preschool group, the two types of errors-palatalization and lateralization-increased in frequency in the school group, but the trend of increased lateralization was not statistically significant. After 6.7 and 5.5 sessions of speech training, the pronunciation of the preschool group and the school-age group significantly improved; the cure rate of the school-age group was 84.9% (118/139), and that of the preschool group was 77.1% (91/118). There was no statistically significant difference in the cure rate between the two groups.
Conclusion
Functional dysarthria may improve with age, but it may not completely self-heal. Children of different age groups can achieve good treatment results through scientific and reasonable speech training.
6.The effectiveness and safety of concurrent chemoradiotherapy combined with nimotuzumab for patients with inoperable esophageal squamous cell carcinoma
Lichen DAI ; Jianfeng HUANG ; Lijun HU ; Jia WU ; Jianlin WANG ; Qinghong MENG ; Fei SUN ; Qiuhua DUAN ; Jingping YU
Chinese Journal of Radiological Medicine and Protection 2023;43(3):182-188
Objective:To evaluate the effectiveness and safety of concurrent chemoradiotherapy combined with nimotuzumab in the treatment of patients with inoperable esophageal squamous cell carcinoma (ESCC).Methods:A retrospective analysis was conducted on the clinical data of 503 patients with inoperable ESCC who underwent concurrent chemoradiotherapy in the Department of Radiation Oncology, Changzhou No. 2 People′s Hospital Affiliated to Nanjing Medical University and Department of Radiation Oncology, Affiliated Hospital of Jiangnan University from 2014 to 2020. Among these patients, 69 received concurrent chemoradiotherapy combined with nimotuzumab (the combined therapy group) and 434 received concurrent chemoradiotherapy alone (the concurrent chemoradiotherapy group). Patients of both groups were matched at a ratio of 1∶2 using the propensity score matching (PSM) method. As a result, 168 patients were determined for clinical analysis, including 61 in the combined therapy group and 107 in the concurrent chemoradiotherapy group. The short-term efficacy and adverse reactions of both groups were compared. The overall survival (OS) curves and progression-free survival (PFS) curves were plotted using the Kaplan-Meier method for the Log-rank test.Results:The two groups showed no statistical difference ( P > 0.05) in clinical baseline characteristics after the PSM. The objective response rate (ORR) of the combined therapy group was significantly higher than that of the concurrent chemoradiotherapy group with statistically significant differences (85.2% vs. 71.0%, χ2 = 4.33, P = 0.037). There was no statistical difference (98.4% vs. 91.6%, P > 0.05) in the disease control rate (DCR) between the two groups. The combined therapy group had median PFS of 28.07 months and 1-, 3-, and 5-year PFS ratios of 78.2%, 37.5% and 29.1%, respectively. The concurrent chemoradiotherapy group had mPFS of 19.54 months and 1-, 3-, and 5-year PFS ratios of 72.9%, 28.3% and 21.3%, respectively. Both groups showed statistically significant differences in PFS ( χ2 = 4.49, P = 0.034). The combined group had median OS of 34.93 months and 1-, 3-, and 5-year OS ratios of 88.5%, 46.8% and 37.4%, respectively. The concurrent chemoradiotherapy group had mOS of 24.30 months and 1-, 3-, and 5-year OS ratios of 81.3%, 35.2% and 28.0%, respectively. Both groups showed statistically significant differences in OS (χ 2= 5.11, P = 0.024), but did not show statistical differences ( P > 0.05) in the severity degree of each adverse effect during the treatment. Conclusions:Concurrent chemoradiotherapy combined with nimotuzumab can improve the ORR and prolong the PFS and OS of patients with inoperable ESCC compared with concurrent chemoradiotherapy alone. Furthermore, combining with nimotuzumab does not increase adverse effects and can be tolerated by patients with high safety.
7.Emodin attenuates severe acute pancreatitis-associated acute lung injury by suppressing pancreatic exosome-mediated alveolar macrophage activation.
Qian HU ; Jiaqi YAO ; Xiajia WU ; Juan LI ; Guixiang LI ; Wenfu TANG ; Jingping LIU ; Meihua WAN
Acta Pharmaceutica Sinica B 2022;12(10):3986-4003
Severe acute pancreatitis-associated acute lung injury (SAP-ALI) is a serious disease associated with high mortality. Emodin has been applied to alleviate SAP-ALI; however, the mechanism remains unclear. We report that the therapeutic role of emodin in attenuating SAP-ALI is partly dependent on an exosomal mechanism. SAP rats had increased levels of plasma exosomes with altered protein contents compared to the sham rats. These infused plasma exosomes tended to accumulate in the lungs and promoted the hyper-activation of alveolar macrophages and inflammatory damage. Conversely, emodin treatment decreased the plasma/pancreatic exosome levels in the SAP rats. Emodin-primed exosomes showed less pro-inflammatory effects in alveolar macrophages and lung tissues than SAP exosomes. In detail, emodin-primed exosomes suppressed the NF-κB pathway to reduce the activation of alveolar macrophage and ameliorate lung inflammation by regulating PPARγ pathway, while these effects were amplified/abolished by PPARγ agonist/antagonist. Blockage of pancreatic acinar cell exosome biogenesis also exhibited suppression of alveolar macrophage activation and reduction of lung inflammation. This study suggests a vital role of exosomes in participating inflammation-associated organ-injury, and indicates emodin can attenuate SAP-ALI by reducing the pancreatic exosome-mediated alveolar macrophage activation.
8.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
9.The role of Caspase-1/GSDMD-mediated cell pyroptosis in anti-tumor effect of cisplatin in triple-negative breast cancer
Honglin YAN ; Jingping YUAN ; Juan WU ; Feng GUAN ; Bin LUO ; Xiaoyan WU ; Xiaokang KE ; Xiuxue YUAN
Chinese Journal of Endocrine Surgery 2022;16(2):137-143
Objective:To investigate the role of Caspase-1/gasdermin D (GSDMD) -mediated cell pyroptosis in anti-tumor effect of cisplatin (DDP) in triple-negative breast cancer (TNBC) .Methods:HE staining and immunohistochemical staining were performed to detect the morphological changes and the expression of pyroptosis/apoptosis pathway related proteins in TNBC tissues before and after DDP-based neoadjuvant chemotherapy (NACT) . The TNBC cell line MDA-MB-231 was treated with DDP and the morphological changes were observed. The type of cell death induced by DDP was analyzed by Annexin V-FITC/PI double staining and flow cytometry. Lactate dehydrogenase (LDH) release assay and ELISA were performed to detect the release of LDH and inflammatory factors (IL-18 and IL-1β) in cell culture supernatant after DDP treatment. Western blot (WB) was performed to detect the expression of pyroptosis/apoptosis pathway related proteins in cells after DDP treatment. MDA-MB-231 cells treated with DDP were co-treated with caspase-1 specific inhibitor to inhibit pyroptois or co-treated with caspase-3 specific inhibitor to inhibit apoptosis. The effect of caspase-1 inhibitor or caspase-3 inhibitor on the anti-tumor effect of DDP was detected by MTT assay, clone formation assay, transwell assay and would healing test.Results:Reactive changes in the breast surgical specimen after DDP-based NACT included cell swelling and inflammatory cell aggregation around the tumor bed, which were more similar to pyroptosis. The up-regulation of key molecules of pyroptosis pathway post-NACT was significantly higher than that of key molecules of apoptosis pathway. Further experiments in vitro showed that DDP could induce MDA-MB-231 cells to show pyroptosis-like changes characterized by large bubbles blowing from the cellular membrane. Flow-cytometry analyses showed that the death type of MDA-MB-231 cells caused by DDP was mainly Annexin V +PI + cells (mainly lytic cells, such as pyroptosis) . Additionally, DDP treatment induced significant activation of caspase-1 and GSDMD, increased the release of LDH, IL-18 and IL-1β, however, the activation level of caspase-3, which dominates the apoptosis pathway, was significantly lower than that of caspase-1/GSDMD. Moreover, caspase-1 inhibitors (blocking the classical pyroptosis pathway) had a significantly greater inhibitory effect on the anti-tumor effect of DDP than caspase-3 inhibitors (blocking the apoptosis pathway) . Conclusion:Caspase-1/GSDMD mediated pyroptosis may play a leading role in the anti-tumor effect of DDP in triple-negative breast cancer.
10.Items selection of Negative Emotion Screening Scale for Inpatients based on Delphi method
Xiaomei DENG ; Jingping ZHANG ; Ming WU ; Xiulan DENG
Chinese Journal of Modern Nursing 2022;28(3):289-295
Objective:To construct a preliminary test items pool of Negative Emotion Screening Scale for Inpatients, so as to lay the foundation for subsequent scale construction and reliability and validity test.Methods:From September 2020 to January 2021, using the psychological stress theory as a reference model, a pool of items for negative emotion assessment of non-psychiatric inpatients was established based on literature research, expert interviews and patient consultation. The Delphi method was used to select 25 experts from related fields in China for 2 rounds of consultation and the consultation results were statistically analyzed.Results:After 2 rounds of expert letter inquiries, a preliminary test item database with 35 items covering 4 dimensions of anxiety, depression, fear of illness and anger was obtained. The effective recovery rates of the two rounds of expert letter questionnaires were 92.59% (25/27) and 100.00% (25/25) , the expert authority coefficient was 0.912 and the Kendall's coordination of the secondary indicators coefficient was 0.191 and 0.126 ( P<0.01) . Conclusions:The application of the Delphi method can obtain relatively reliable results by gathering expert opinions and provide a basis for the construction of Negative Emotion Screening Scale for Inpatients.


Result Analysis
Print
Save
E-mail