1.Measurement and application of radiation field distribution in Halcyon linear accelerator treatment room
Yatao LIU ; Yanling YI ; Wentao ZHAO ; Haikuan LIU ; Xiangyu E ; Jingping YU ; Hongwei ZENG
Chinese Journal of Radiological Health 2025;34(5):740-745
Objective To measure radiation filed distribution in the treatment room of the Varian Halcyon medical linear accelerator, and to provide a basis for shielding design and potential exposure analysis of treatment rooms for this type of accelerator. Methods Under the 6 MV X-ray (FFF) mode at a maximum dose rate of 800 MU/min and a maximum irradiation field of 28.00 cm × 28.00 cm, a total of 540 MU was delivered during gantry rotation. Radiation field distribution was measured using thermoluminescence dosimeters located at multiple points in the room. The measured data were then applied to shielding calculations, and the results were compared with those obtained using empirical formulas. Results The overall radiation levels in the treatment room were in the range of 12.2 µGy/540 MU to 5.520 Gy/540 MU, with the highest dose (5.520 Gy/540 MU) observed at the isocenter, and the lowest dose (12.2 µGy/540 MU) recorded at approximately 6.5 m from the gantry head. The radiation levels at most points were within the range of 100-
2.Circ_EPHB4 regulates temozolomide sensitivity in glioma cells through the miR-424-5p/Wnt3 axis.
Yuxiang LIAO ; Jingping LIU ; Bo LIU ; Xiyun FEI ; Chen JIN
Journal of Southern Medical University 2025;45(5):942-953
OBJECTIVES:
To investigate the mechanism by which circ_EPHB4 regulates temozolomide (TMZ) sensitivity of glioma cells through the miR-424-5p/Wnt3 signal axis.
METHODS:
We detected the expression levels of circ_EPHB4, miR-424-5p and Wnt3 mRNA in glioma specimens from 25 patients with primary glioma and 25 patients experiencing relapse following temozolomide-based chemotherapy and in TMZ-sensitive and -resistant glioma A172 and SHG44 cells with circ_EPHB4 knockdown using qRT-PCR, and Wnt3 protein expression level was detected with Western blotting. Cell viability, colony-forming ability, and apoptosis of the cells with circ_EPHB4 knockdown were assessed, and the targeted regulation relationship between circ_EPHB4, miR-424-5p, and Wnt3 was verified by dual luciferase reporter assay and RNA immunoprecipitation (RIP) experiments. The effect of circ_EPHB4 knockdown on tumorigenesis of glioma cells was evaluated in subcutaneous tumor-bearing nude mouse models.
RESULTS:
The expression of circ_EPHB4 was significantly increased in glioma tissues and cells as compared with normal neural tissues and astrocytes (P=0.014). In TMZ-resistant glioma cells, circ_EPHB4 knockdown resulted in an obvious reduction of IC50 value of TMZ, inhibited cell colony formation, and promoted cell apoptosis, and these effects were reversed by miR-424-5p knockdown. The expressions of miR-424-5p and circ_EPHB4 were negatively correlated in glioma tissues (P=0.011). MiR-424-5p knockdown also attenuated the effect of circ_EPHB4 knockdown on expressions of PCNA, P-gp, MRP1 and bax.
CONCLUSIONS
Circ_EPHB4 regulates Wnt3 expression through "sponge adsorption" of miR-424-5p, thereby modulating TMZ-resistant glioblastoma cell clonogenesis, apoptosis, and TMZ sensitivity, suggesting the potential of circ_EPHB4 as a therapeutic target for reversing drug resistance of gliomas.
MicroRNAs/genetics*
;
Humans
;
Temozolomide
;
Glioma/genetics*
;
Animals
;
Mice, Nude
;
Cell Line, Tumor
;
Wnt3 Protein/metabolism*
;
Mice
;
Apoptosis
;
RNA, Circular
;
Drug Resistance, Neoplasm
;
Brain Neoplasms/pathology*
;
Signal Transduction
3.circ_EPHB4 synergizes with YTHDF3 to promote glioma progression via m6A-dependent stabilization of Wnt3.
Chen JIN ; Jingping LIU ; Bo LIU ; Xiyun FEI ; Yuxiang LIAO
Journal of Southern Medical University 2025;45(11):2320-2329
OBJECTIVES:
To investigate the oncogenic role of circular RNA circ_EPHB4 in glioma and its molecular mechanism.
METHODS:
Microarray analysis was performed to identify the differentially expressed circRNAs in glioma tissues. The effects of circ_EPHB4 on glioma cell migration, invasion and epithelial-mesenchymal transition (EMT) in vitro and tumorigenicity in vivo were assessed using scratch wound healing assay, Transwell invasion assay and nude mouse models bearing subcutaneous tumors. RNA immunoprecipitation (RIP), RNA stability assays, and gene overexpression and silencing techniques were employed to validate the synergistic regulatory effect of circ_EPHB4 and the N6-methyladenosine (m6A) reader protein YTHDF3 on Wnt3 expression.
RESULTS:
Circ_EPHB4 was significantly overexpressed by 2.3 folds (|log2FC|=1.2, P<0.01) in glioma tissues compared to the adjacent tissues, and by 2.5 folds in glioma cell line U373 compared to normal cells (P<0.001). Overexpression of circ_EPHB4 significantly enhanced migration and invasion of glioma cells, and promoted the expressions of EMT markers N-cadherin and vimentin. In the tumor-bearing mouse models, the tumor volume in circ_EPHB4 overexpression group was significantly greater than that in the control group, and the lung metastatic foci increased by 4.2 folds. Overexpression of circ_EPHB4 promoted oncogenesis by upregulating Wnt3 expression, while YTHDF3 extended the half-life of Wnt3 mRNA in an m6A-dependent manner. Simultaneous knockdown of circ_EPHB4 and YTHDF3 resulted in an obvious reduction of Wnt3 mRNA expression by up to 47% compared to its level following knocking down either circ_EPHB4 or YTHDF3 alone.
CONCLUSIONS
Circ_EPHB4 and YTHDF3 promote glioma progression by jointly targeting the Wnt3 signaling pathway, which may provide a new therapeutic strategy for gliomas.
Glioma/genetics*
;
Humans
;
Animals
;
Cell Line, Tumor
;
RNA-Binding Proteins/genetics*
;
RNA, Circular
;
Epithelial-Mesenchymal Transition
;
Mice, Nude
;
Cell Movement
;
Wnt3 Protein/genetics*
;
Mice
;
Disease Progression
;
Adenosine/metabolism*
;
Brain Neoplasms/metabolism*
;
Gene Expression Regulation, Neoplastic
4.Effects of group cognitive behavioral therapy on clinical efficacy and executive function in patients with generalized anxiety disorder
Longqin LYU ; Jingping MU ; Heng LIAO ; Lizhu LIU ; Xi WANG
Sichuan Mental Health 2024;37(1):21-25
BackgroundPrevious studies have found that patients with generalized anxiety disorder (GAD) have impaired performance in executive function, and group cognitive behavioral therapy (CBT) has been shown to be effective in alleviating negative affect in patients with GAD, while its efficacy on executive function remains unclear. ObjectiveTo explore the efficacy of group CBT on anxiety symptom and executive function in GAD patients, so as to provide references for the rehabilitation program for GAD. MethodsA total of 80 consecutive patients with GAD who were hospitalized in Sleep and Psychosomatic Medical Center of Shiyan Taihe Hospital from March 2021 to August 2022 and met the Diagnostic and Statistical Manual of Mental Disorders, fifth edition (DSM-5) diagnostic criteria for GAD were enrolled, and they were assigned into study group (n=40) and control group (n=40) using random number table methods. All patients were subjected to routine medication treatment and regular health education, based on this, study group received group CBT once a week (6 weeks, 60 to 90 minutes per session). At the enrollment and after 6 weeks of treatment, patients were assessed using Hamilton Anxiety Scale (HAMA) and Frontal Assessment Battery (FAB). ResultsANOVA with repeated measures on HAMA score revealed a significant time effect (F=1 870.320, P<0.01), no significant group effect and no significant time×group interaction effect (F=1.254, 0.293, P>0.05). Significant time effect, group effect and time×group interaction effect were reported on FAB scores (F=311.190, 4.399, 7.021, P<0.05 or 0.01). Further analysis indicated that FAB scores of both groups after treatment were higher than those at baseline (t=200.569, 115.401, P<0.01).And the FAB score of study group was higher than that of control group after treatment (t=-3.211, P<0.01). ConclusionGroup CBT combined with medication treatment for GAD may alleviate the anxiety symptoms and improve executive function in GAD patients. [Funded by Shiyan Science and Technology Bureau Pilot Scientific Research Project (number, 21Y21)]
5.Primary intracranial DICER1-mutant sarcoma: a clinicopathological analysis of seven cases
Liqiong OU ; Shaoyan XI ; Lingyi FU ; Wenguang ZHANG ; Xinyi XIAN ; Yanhui LIU ; Jingping YUN ; Jing ZENG ; Wanming HU
Chinese Journal of Pathology 2024;53(12):1231-1237
Objective:To investigate the clinicopathological features, immunophenotype, molecular characteristics, and differential diagnosis of primary intracranial DICER1-mutant sarcoma in order to better understand this tumor type.Methods:A retrospective analysis was conducted on 7 cases of primary intracranial DICER1-mutant sarcoma diagnosed in the Department of Pathology, Sun Yat-sen University Cancer Center, Guangzhou, China between 2021 and 2023 using next-generation sequencing. At the same time, 10 gliosarcomas, 4 intracranial FET::CREB fusion-positive mesenchymal tumors, 4 malignant meningiomas, 3 malignant solitary fibrous tumors, 3 malignant peripheral nerve sheath tumors, 3 synovial sarcomas and 3 rhabdomyosarcomas (total 30 cases) were selected as control.Results:Among the 7 patients with primary intracranial DICER1-mutant sarcoma, 6 were male and 1 was female, aged 10-32 years (median, 23 years). The tissue morphology was predominantly spindle or pleomorphic sarcoma-like, with 6 cases exhibiting eosinophilic globules, and 3 cases showing rhabdomyoblastic or rhabdomyosarcoma-like cell differentiation. Immunohistochemistry revealed focal desmin expression in 3 cases (3/7), ATRX loss in 3 cases (3/7), and p53 mutant pattern in 4 cases (4/7). Additionally, 4 cases (4/7) showed focal or diffuse SALL4 expression, whereas the control cases (30 cases) did not exhibit SALL4 protein expression, suggesting that SALL4 may possess certain auxiliary diagnostic value. Next-generation sequencing confirmed that all 7 cases of primary intracranial DICER1-mutant sarcoma harbored mutations in the DICER1 gene, with 5 cases having the mutation site at p.E1813D. Until May 2024, all 7 patients were alive.Conclusions:Primary intracranial DICER1-mutant sarcoma is a rare tumor. Understanding its morphological characteristics, immunohistochemical and molecular markers and differential diagnosis is crucial to avoid misdiagnosis and to improve diagnostic accuracy of this tumor.
6.Research progress on ferroptosis in the treatment of bladder cancer
Jingping QIU ; Lugang ZHU ; Yuanwei CHEN ; Minghong ZHOU ; Yuwan ZHAO ; Jianjun LIU
Journal of Modern Urology 2024;29(9):830-835
Ferroptosis is a new programmed cell death dependent on iron ions.Ferroptosis can be induced by endogenous or exogenous pathways,and cells exhibit specific cell morphological signs and are regulated by a variety of molecular mechanisms.In recent years,more and more studies have shown that ferroptosis plays an important role in the treatment of cancer.This article summarizes the mechanism of ferroptosis in bladder cancer and the regulation of cancer cells,as well as the role of ferroptosis-related factors,non-coding RNA regulation,N6-methyladenosine(m6A),amino acid metabolism and autophagy dependent ferroptosis in the growth and proliferation of bladder cancer,with a view to provide new strategies for the treatment of bladder cancer.
7.Experts consensus on the procedure of dental operative microscope in endodontics and operative dentistry.
Bin LIU ; Xuedong ZHOU ; Lin YUE ; Benxiang HOU ; Qing YU ; Bing FAN ; Xi WEI ; Lihong QIU ; Zhengwei HUANG ; Wenwei XIA ; Zhe SUN ; Hanguo WANG ; Liuyan MENG ; Bin PENG ; Chen ZHANG ; Shuli DENG ; Zhaojie LU ; Deqin YANG ; Tiezhou HOU ; Qianzhou JIANG ; Xiaoli XIE ; Xuejun LIU ; Jiyao LI ; Zuhua WANG ; Haipeng LYU ; Ming XUE ; Jiuyu GE ; Yi DU ; Jin ZHAO ; Jingping LIANG
International Journal of Oral Science 2023;15(1):43-43
The dental operative microscope has been widely employed in the field of dentistry, particularly in endodontics and operative dentistry, resulting in significant advancements in the effectiveness of root canal therapy, endodontic surgery, and dental restoration. However, the improper use of this microscope continues to be common in clinical settings, primarily due to operators' insufficient understanding and proficiency in both the features and established operating procedures of this equipment. In October 2019, Professor Jingping Liang, Vice Chairman of the Society of Cariology and Endodontology, Chinese Stomatological Association, organized a consensus meeting with Chinese experts in endodontics and operative dentistry. The objective of this meeting was to establish a standard operation procedure for the dental operative microscope. Subsequently, a consensus was reached and officially issued. Over the span of about four years, the content of this consensus has been further developed and improved through practical experience.
Humans
;
Dentistry, Operative
;
Consensus
;
Endodontics
;
Root Canal Therapy
;
Dental Care
8.Targeting Kindlin-2 in adipocytes increases bone mass through inhibiting FAS/PPARγ/FABP4 signaling in mice.
Wanze TANG ; Zhen DING ; Huanqing GAO ; Qinnan YAN ; Jingping LIU ; Yingying HAN ; Xiaoting HOU ; Zhengwei LIU ; Litong CHEN ; Dazhi YANG ; Guixing MA ; Huiling CAO
Acta Pharmaceutica Sinica B 2023;13(11):4535-4552
Osteoporosis (OP) is a systemic skeletal disease that primarily affects the elderly population, which greatly increases the risk of fractures. Here we report that Kindlin-2 expression in adipose tissue increases during aging and high-fat diet fed and is accompanied by decreased bone mass. Kindlin-2 specific deletion (K2KO) controlled by Adipoq-Cre mice or adipose tissue-targeting AAV (AAV-Rec2-CasRx-sgK2) significantly increases bone mass. Mechanistically, Kindlin-2 promotes peroxisome proliferator-activated receptor gamma (PPARγ) activation and downstream fatty acid binding protein 4 (FABP4) expression through stabilizing fatty acid synthase (FAS), and increased FABP4 inhibits insulin expression and decreases bone mass. Kindlin-2 inhibition results in accelerated FAS degradation, decreased PPARγ activation and FABP4 expression, and therefore increased insulin expression and bone mass. Interestingly, we find that FABP4 is increased while insulin is decreased in serum of OP patients. Increased FABP4 expression through PPARγ activation by rosiglitazone reverses the high bone mass phenotype of K2KO mice. Inhibition of FAS by C75 phenocopies the high bone mass phenotype of K2KO mice. Collectively, our study establishes a novel Kindlin-2/FAS/PPARγ/FABP4/insulin axis in adipose tissue modulating bone mass and strongly indicates that FAS and Kindlin-2 are new potential targets and C75 or AAV-Rec2-CasRx-sgK2 treatment are potential strategies for OP treatment.
9.Research progress of PCSK9 in the mechanism of atherosclerotic cardiovascular disease
Yao ZHANG ; Jinjing YANG ; Jingyi LIU ; Jingping WANG
Journal of Chinese Physician 2023;25(8):1260-1264
Proprotein Convertase Subtilisin/Kexin 9 (PCSK9) inhibitor has become a new drug for the treatment of hypercholesterolemia and atherosclerotic cardiovascular disease. Recent studies have shown that the mechanism of PCSK9 in atherosclerotic cardiovascular disease is very complex, which is closely related to the increase of plasma low-density lipoprotein cholesterol level, apoptosis, autophagy, inflammation, foam cell formation and vascular smooth muscle cell calcification, which will help us better understand the " multiple effects" of PCSK9 inhibitors. This review aims to analyze the research status of PCSK9 in molecular structure, cell function and cardiovascular disease treatment, which will further consolidate the success of new treatment strategies for atherosclerosis.
10.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Result Analysis
Print
Save
E-mail