Objective To measure radiation filed distribution in the treatment room of the Varian Halcyon medical linear accelerator, and to provide a basis for shielding design and potential exposure analysis of treatment rooms for this type of accelerator. Methods Under the 6 MV X-ray (FFF) mode at a maximum dose rate of 800 MU/min and a maximum irradiation field of 28.00 cm × 28.00 cm, a total of 540 MU was delivered during gantry rotation. Radiation field distribution was measured using thermoluminescence dosimeters located at multiple points in the room. The measured data were then applied to shielding calculations, and the results were compared with those obtained using empirical formulas. Results The overall radiation levels in the treatment room were in the range of 12.2 µGy/540 MU to 5.520 Gy/540 MU, with the highest dose (5.520 Gy/540 MU) observed at the isocenter, and the lowest dose (12.2 µGy/540 MU) recorded at approximately 6.5 m from the gantry head. The radiation levels at most points were within the range of 100-1000 µGy/540 MU. At heights of 0.5, 1.1, and 1.7 m, the radiation field exhibited a rapid attenuation from the beam center outward, with a faster decay along the treatment couch direction (Y-axis) than along the perpendicular direction (X-axis). Shielding calculations based on the measured radiation field yielded required wall thicknesses of 1219 mm (east wall), 949 mm (south wall), 1235 mm (west wall), and 1252 mm (north wall), all of which were smaller than those calculated using empirical formulas. Conclusion Thermoluminescence dosimeter is suitable for multi-point in situ measurement of radiation field distribution in Halcyon accelerator treatment rooms. The measurement results can be used to optimize the shielding design of Halcyon accelerator treatment rooms.

BackgroundPrevious studies have found that patients with generalized anxiety disorder （GAD） have impaired performance in executive function， and group cognitive behavioral therapy （CBT） has been shown to be effective in alleviating negative affect in patients with GAD， while its efficacy on executive function remains unclear. ObjectiveTo explore the efficacy of group CBT on anxiety symptom and executive function in GAD patients， so as to provide references for the rehabilitation program for GAD. MethodsA total of 80 consecutive patients with GAD who were hospitalized in Sleep and Psychosomatic Medical Center of Shiyan Taihe Hospital from March 2021 to August 2022 and met the Diagnostic and Statistical Manual of Mental Disorders， fifth edition （DSM-5） diagnostic criteria for GAD were enrolled， and they were assigned into study group （n=40） and control group （n=40） using random number table methods. All patients were subjected to routine medication treatment and regular health education， based on this， study group received group CBT once a week （6 weeks， 60 to 90 minutes per session）. At the enrollment and after 6 weeks of treatment， patients were assessed using Hamilton Anxiety Scale （HAMA） and Frontal Assessment Battery （FAB）. ResultsANOVA with repeated measures on HAMA score revealed a significant time effect （F=1 870.320， P<0.01）， no significant group effect and no significant time×group interaction effect （F=1.254， 0.293， P>0.05）. Significant time effect， group effect and time×group interaction effect were reported on FAB scores （F=311.190， 4.399， 7.021， P<0.05 or 0.01）. Further analysis indicated that FAB scores of both groups after treatment were higher than those at baseline （t=200.569， 115.401， P<0.01）.And the FAB score of study group was higher than that of control group after treatment （t=-3.211， P<0.01）. ConclusionGroup CBT combined with medication treatment for GAD may alleviate the anxiety symptoms and improve executive function in GAD patients. ［Funded by Shiyan Science and Technology Bureau Pilot Scientific Research Project （number， 21Y21）］

Ferroptosis is a new programmed cell death dependent on iron ions.Ferroptosis can be induced by endogenous or exogenous pathways,and cells exhibit specific cell morphological signs and are regulated by a variety of molecular mechanisms.In recent years,more and more studies have shown that ferroptosis plays an important role in the treatment of cancer.This article summarizes the mechanism of ferroptosis in bladder cancer and the regulation of cancer cells,as well as the role of ferroptosis-related factors,non-coding RNA regulation,N6-methyladenosine(m6A),amino acid metabolism and autophagy dependent ferroptosis in the growth and proliferation of bladder cancer,with a view to provide new strategies for the treatment of bladder cancer.

Objective:To investigate the clinicopathological features, immunophenotype, molecular characteristics, and differential diagnosis of primary intracranial DICER1-mutant sarcoma in order to better understand this tumor type.Methods:A retrospective analysis was conducted on 7 cases of primary intracranial DICER1-mutant sarcoma diagnosed in the Department of Pathology, Sun Yat-sen University Cancer Center, Guangzhou, China between 2021 and 2023 using next-generation sequencing. At the same time, 10 gliosarcomas, 4 intracranial FET::CREB fusion-positive mesenchymal tumors, 4 malignant meningiomas, 3 malignant solitary fibrous tumors, 3 malignant peripheral nerve sheath tumors, 3 synovial sarcomas and 3 rhabdomyosarcomas (total 30 cases) were selected as control.Results:Among the 7 patients with primary intracranial DICER1-mutant sarcoma, 6 were male and 1 was female, aged 10-32 years (median, 23 years). The tissue morphology was predominantly spindle or pleomorphic sarcoma-like, with 6 cases exhibiting eosinophilic globules, and 3 cases showing rhabdomyoblastic or rhabdomyosarcoma-like cell differentiation. Immunohistochemistry revealed focal desmin expression in 3 cases (3/7), ATRX loss in 3 cases (3/7), and p53 mutant pattern in 4 cases (4/7). Additionally, 4 cases (4/7) showed focal or diffuse SALL4 expression, whereas the control cases (30 cases) did not exhibit SALL4 protein expression, suggesting that SALL4 may possess certain auxiliary diagnostic value. Next-generation sequencing confirmed that all 7 cases of primary intracranial DICER1-mutant sarcoma harbored mutations in the DICER1 gene, with 5 cases having the mutation site at p.E1813D. Until May 2024, all 7 patients were alive.Conclusions:Primary intracranial DICER1-mutant sarcoma is a rare tumor. Understanding its morphological characteristics, immunohistochemical and molecular markers and differential diagnosis is crucial to avoid misdiagnosis and to improve diagnostic accuracy of this tumor.

Proprotein Convertase Subtilisin/Kexin 9 (PCSK9) inhibitor has become a new drug for the treatment of hypercholesterolemia and atherosclerotic cardiovascular disease. Recent studies have shown that the mechanism of PCSK9 in atherosclerotic cardiovascular disease is very complex, which is closely related to the increase of plasma low-density lipoprotein cholesterol level, apoptosis, autophagy, inflammation, foam cell formation and vascular smooth muscle cell calcification, which will help us better understand the " multiple effects" of PCSK9 inhibitors. This review aims to analyze the research status of PCSK9 in molecular structure, cell function and cardiovascular disease treatment, which will further consolidate the success of new treatment strategies for atherosclerosis.

The dental operative microscope has been widely employed in the field of dentistry, particularly in endodontics and operative dentistry, resulting in significant advancements in the effectiveness of root canal therapy, endodontic surgery, and dental restoration. However, the improper use of this microscope continues to be common in clinical settings, primarily due to operators' insufficient understanding and proficiency in both the features and established operating procedures of this equipment. In October 2019, Professor Jingping Liang, Vice Chairman of the Society of Cariology and Endodontology, Chinese Stomatological Association, organized a consensus meeting with Chinese experts in endodontics and operative dentistry. The objective of this meeting was to establish a standard operation procedure for the dental operative microscope. Subsequently, a consensus was reached and officially issued. Over the span of about four years, the content of this consensus has been further developed and improved through practical experience.
Humans ; Dentistry, Operative ; Consensus ; Endodontics ; Root Canal Therapy ; Dental Care

Osteoporosis (OP) is a systemic skeletal disease that primarily affects the elderly population, which greatly increases the risk of fractures. Here we report that Kindlin-2 expression in adipose tissue increases during aging and high-fat diet fed and is accompanied by decreased bone mass. Kindlin-2 specific deletion (K2KO) controlled by Adipoq-Cre mice or adipose tissue-targeting AAV (AAV-Rec2-CasRx-sgK2) significantly increases bone mass. Mechanistically, Kindlin-2 promotes peroxisome proliferator-activated receptor gamma (PPARγ) activation and downstream fatty acid binding protein 4 (FABP4) expression through stabilizing fatty acid synthase (FAS), and increased FABP4 inhibits insulin expression and decreases bone mass. Kindlin-2 inhibition results in accelerated FAS degradation, decreased PPARγ activation and FABP4 expression, and therefore increased insulin expression and bone mass. Interestingly, we find that FABP4 is increased while insulin is decreased in serum of OP patients. Increased FABP4 expression through PPARγ activation by rosiglitazone reverses the high bone mass phenotype of K2KO mice. Inhibition of FAS by C75 phenocopies the high bone mass phenotype of K2KO mice. Collectively, our study establishes a novel Kindlin-2/FAS/PPARγ/FABP4/insulin axis in adipose tissue modulating bone mass and strongly indicates that FAS and Kindlin-2 are new potential targets and C75 or AAV-Rec2-CasRx-sgK2 treatment are potential strategies for OP treatment.

Severe acute pancreatitis-associated acute lung injury (SAP-ALI) is a serious disease associated with high mortality. Emodin has been applied to alleviate SAP-ALI; however, the mechanism remains unclear. We report that the therapeutic role of emodin in attenuating SAP-ALI is partly dependent on an exosomal mechanism. SAP rats had increased levels of plasma exosomes with altered protein contents compared to the sham rats. These infused plasma exosomes tended to accumulate in the lungs and promoted the hyper-activation of alveolar macrophages and inflammatory damage. Conversely, emodin treatment decreased the plasma/pancreatic exosome levels in the SAP rats. Emodin-primed exosomes showed less pro-inflammatory effects in alveolar macrophages and lung tissues than SAP exosomes. In detail, emodin-primed exosomes suppressed the NF-κB pathway to reduce the activation of alveolar macrophage and ameliorate lung inflammation by regulating PPARγ pathway, while these effects were amplified/abolished by PPARγ agonist/antagonist. Blockage of pancreatic acinar cell exosome biogenesis also exhibited suppression of alveolar macrophage activation and reduction of lung inflammation. This study suggests a vital role of exosomes in participating inflammation-associated organ-injury, and indicates emodin can attenuate SAP-ALI by reducing the pancreatic exosome-mediated alveolar macrophage activation.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Objective:To explore the status and influencing factors of incontinence-associated dermatitis among elderly inpatients in 52 hospitals nationwide, and to analyze the nursing of elderly inpatients with incontinence, so as to provide a reference for clinical intervention.Methods:On March 31, 2021, convenience sampling was used to select 14 675 elderly inpatients from 52 hospitals across the country as the research object. The self-designed Incontinence-associated Dermatitis Questionnaire for Elderly Inpatients was used to collect general demographic data, health status, incontinence, and skin nursing. Binomial Logistic regression was used to investigate the influencing factors of incontinence-associated dermatitis in elderly inpatients.Results:Among 14 675 elderly inpatients, the prevalence rates of xerosis cutis, incontinence and incontinence-associated dermatitis were 38.78% (5 691/14 675) , 11.06% (1 623/14 675) and 1.91% (280/14 675) , respectively. The prevalence of mild, moderate and severe incontinence-associated dermatitis were 1.27% (186/14 675) , 0.55% (81/14 675) , and 0.09% (13/14 675) , respectively. Among the nursing of 1 623 elderly inpatients with incontinence, the items with low implementation rate were the use neutral lotion to clean skin (14.17%, 230/1 623) , use of skin protectant after moisturizing (17.68%, 287/1 623) , moisturizing after cleansing the skin (28.90%, 469/1 623) . The results of binomial Logistic regression analysis showed that xeroderma, fecal incontinence, urinary and fecal incontinence, ≥2 kinds of combined medication, and hospital stay >30 days were risk factors for incontinence-associated dermatitis in elderly inpatients.Conclusions:The risk factors of incontinence-associated dermatitis in elderly inpatients mainly include xerosis cutis, type of incontinence, ≥2 kinds of combined medication, and hospital stay >30 days.