ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To analyze the current status of human papillomavirus(HPV) vaccination among women aged 9-45 years in Chaoyang District of Beijing, and to provide a basis for further promoting population vaccination.Methods The HPV vaccination(including HPV2, HPV4 and HPV9) data among women aged 9-45 in Chaoyang District of Beijing as of December 31, 2024 in Beijing's immunization planning information system were derived, and the estimated HPV vaccination rate in Beijing's female population was obtained by data analysis.Results By December 31, 2024, the estimated first dose vaccination rate of HPV vaccine among women aged 9-45 years in Chaoyang District of Beijing had been 50. 88%, and the estimated full dose vaccination rate was 48. 66%. The estimated coverage of the first dose and the full dose among girls aged9-15 years was 4. 62% and 2. 87%, respectively. The estimated full dose coverage rate was 62. 73% in subdistrict and 37. 33%in district.Conclusion The estimated HPV vaccination rate of 9-45-year-old women in Chaoyang District of Beijing is higher than that in other regions of China, but the estimated vaccination rate of adolescent women aged 9-15 is significantly lower than that of other age groups. It is recommended to improve the HPV vaccination rate through multiple joint efforts to achieve the action goal of accelerating the elimination of cervical cancer in China and the world as soon as possible.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Objective To investigate the safety, economic benefits and psychological effects of day breast conserving surgery for breast cancer. Methods The demographic data and clinical data of breast cancer patients undergoing day (day surgery group) and ward (ward surgery group) breast conserving surgeries in West China Hospital of Sichuan University from March 2020 to June 2021 were retrospectively collected; the demographic data, clinical data, medical and related transportation costs, and preoperative and postoperative BREAST-Q scores of breast cancer patients undergoing day (day surgery group) and ward (ward surgery group) breast conserving surgery in West China Hospital of Sichuan University from June 2021 to June 2022 were prospectively collected. The safety, economic benefit, and psychological satisfaction of day surgery was analyzed. Results A total of 42 women with breast cancer were included in the retrospective study and 39 women with breast cancer were included in the prospective study. In both prospective and retrospective studies, the mean age of patients in both groups were <50 years. There were only statistical differences between the two groups in the aspects of hypertension (P=0.022), neoadjuvant chemotherapy (P=0.037) and postoperative pathological estrogen receptor (P=0.033) in the prospective study. In postoperative complications, there were no statistical differences in the surgical-related complications or anesthesia-related complications between the two groups in either the prospective study or the retrospective study (P>0.05). In terms of the overall cost, we found that the day surgery group was more economical than the ward surgery group in the prospective study (P=0.002). There were no statistical differences in postoperative psychosocical well-being, sexual well-being, satisfaction with breasts or chest condition between the two groups (P>0.05). Conclusion It is safe and reliable to carry out breast conserving surgery in day surgery center under strict management standards, which can save medical costs and will not cause great psychological burden to patients.

Objective To evaluate the safety and efficacy of basic anesthesia combined with local anesthesia in the preoperative localization of multiple pulmonary nodules. Methods The clinical data of patients who underwent preoperative localization for multiple pulmonary nodules resection under single-port thoracoscopy in Nanjing Brain Hospital from July 2023 to September 2023 were extracted. They were divided into a group A and a group B according to the localization method. The patients in the group A were localized under local anesthesia, and the patients in the group B were localized with basic anesthesia combined with local anesthesia. The basic clinical characteristics, localization success rate, incidence of localization complications, localization time, and pain score of the two groups were compared and analyzed. Results Finally, we included 200 patients with 100 patients in each group. There were 49 males and 51 females at age of 25-77 (50.94±14.29) years in the group A. There are 45 males and 55 females at age of 24-78 (48.25±14.04) years in the group B. The incidence of localization complications (4% vs. 13%, P=0.04), localization time [(19.90±8.66) min vs. (15.23±5.98) min, P<0.01], and pain score[ (2.01±2.09) vs. (3.29±2.54), P<0.01] in the group B were significantly lower than those in the group A, and the differences were statistically significant. The localization success rate of the group B was significantly higher than that of the group A (98% vs. 92%, P=0.04), and the difference was statistically significant.Conclusion Mobile CT combined with basic anesthesia for preoperative localization of multiple pulmonary nodules is highly safe, has a high success rate, and provides high patient comfort, making it a valuable approach for clinical promotion.

Functional cure is currently recommended by guidelines as the ideal treatment goal for the prevention and treatment of chronic hepatitis B （CHB） in China and globally， and it is defined as sustained and undetectable serum HBsAg and HBV DNA， HBeAg clearance， and presence or absence of HBsAg seroconversion， accompanied by resolution of liver inflammation， histopathological improvements， and a significant reduction in the incidence rate of end-stage liver disease. HBV can integrate into the host genome and contribute to the continuous production of HBsAg， which can occur in the early stage of chronic HBV infection. In addition to the covalently closed circular DNA that is hard to be eliminated in liver tissue， HBsAg derived from HBV integration independent of viral replication may be the most important factor for the difficulty in achieving functional cure after antiviral therapy in patients with hepatitis B. This article reviews the research advances in HBV integration in recent years and discusses its impact on functional cure.

ObjectiveTo investigate the efficacy of Xingpi capsules （XPC） in treating diarrhea-predominant irritable bowel syndrome （IBS-D） with spleen deficiency and elucidate its potential molecular mechanisms. MethodsA rat model of IBS-D with spleen deficiency was established by administering senna leaf in combination with restrained stress and swimming fatigue for 14 d. Ten specific pathogen free （SPF）-grade healthy rats were used as the normal control group. After successful modeling， SPF-grade rats were randomly divided into a model group， a pinaverium bromide group （1.5 mg·kg^-1）， and low- and high-dose XPC groups （0.135 and 0.54 g·kg^-1）， with 10 rats in each group. Rats in the normal control group and the model group were given distilled water by gavage， while the remaining groups were administered corresponding drug solutions by gavage once a day for 14 consecutive days. The rat body weights and fecal condition were observed every day， and the Bristol score was recorded. Enzyme-linked immunosorbent assay （ELISA） was used to determine the levels of 5-hydroxytryptamine （5-HT） in serum and colon tissue. Transmission electron microscopy was used to observe the microvilli and tight junctions in the colon. The integrity of the colonic barrier， intestinal motility， and expression of related pathway proteins were evaluated by hematoxylin-eosin （HE） staining， immunohistochemistry， and Western blot. ResultsCompared with those in the normal control group， rats in the model group showed a significantly decreased body weight and increased diarrhea rate， diarrhea grade， and Bristol score （P<0.01）. HE staining revealed incomplete colonic mucosa in the model group， with evident congestion and edema observed. Electron microscopy results indicated decreased density and integrity of the colonic barrier， shedding and disappearance of microvilli， and significant widening of tight junctions. The expression levels of colonic tight junction proteins Occludin and Claudin-5 were downregulated （P<0.01）， and the levels of 5-HT in serum and colon tissue were elevated （P<0.01）. The small intestine propulsion rate significantly increased （P<0.01）， and the expression of contractile proteins Ras homolog family member A （RhoA） and Rho-associated coiled-coil containing protein kinase 2 （ROCK2） in colon and phosphorylation of myosin light chain （MLC₂₀） were upregulated （P<0.01）. Compared with the model group， the treatment groups showed alleviated diarrhea， diarrhea-associated symptoms， and pathological manifestations of colon tissue to varying degrees. Specifically， high-dose XPC exhibited effectively relieved diarrhea， promoted recovery of colonic mucosal structure， significantly reduced congestion and edema， upregulated expression of Occludin and Claudin-5 （P<0.01）， decreased levels of 5-HT in serum and colon tissue （P<0.05，P<0.01）， significantly slowed small intestine propulsion rate （P<0.01）， and significantly downregulated expression of contractile proteins RhoA and ROCK2 in colon and phosphorylation of MLC₂₀ （P<0.05，P<0.01）. ConclusionXPC effectively alleviates symptoms of spleen deficiency and diarrhea and regulates the secretion of brain-gut peptide. The characteristics of XPC are mainly manifested in alleviating IBS-D with spleen deficiency from the aspects of protecting intestinal mucosa and inhibiting smooth muscle contraction， and the mechanism is closely related to the regulation of the 5-HT-RhoA/ROCK2 pathway expression.

ObjectiveFor prepubertal and urgently treated malignant tumor patients, ovarian tissue cryopreservation and transplantation represent more appropriate fertility preservation methods. Current clinical practices often involve freezing ovarian tissue with high concentrations of cryoprotectants (CPAs) and thawing with water baths. These processes lead to varying degrees of toxicity and devitrification damage to ovarian tissue. Therefore, this paper proposes optimized methods for vitrification of ovarian tissues based on sodium alginate hydrogel encapsulation and magnetic induction nanowarming technology. MethodsFirstly, the study investigated the effects of sodium alginate concentration, the sequence of hydrogel encapsulation and CPAs loading on vitrification efficiency of encapsulated ovarian tissue. Additionally, the capability of sodium alginate hydrogel encapsulation to reduce the required concentration of CPAs was validated. Secondly, a platform combining water bath and magnetic induction nanowarming was established to rewarm ovarian tissue under various concentrations of magnetic nanoparticles and magnetic field strengths. The post-warming follicle survival rate, antioxidant capacity, and ovarian tissue integrity were evaluated to assess the efficacy of the method. ResultsThe study found that ovarian tissue encapsulated with 2% sodium alginate hydrogel exhibited the highest follicle survival rate after vitrification. The method of loading CPAs prior to encapsulation proved more suitable for ovarian tissue cryopreservation, effectively reducing the required concentration of CPAs by 50%. A combination of 8 g/L Fe₃O₄ nanoparticles and an alternating magnetic field of 300 Gs showed optimal warming effectiveness for ovarian tissue. Combining water bath rewarming with magnetic induction nanowarming yielded the highest follicle survival rate, enhanced antioxidant capacity, and preserved tissue morphology. ConclusionSodium alginate hydrogel encapsulation of ovarian tissue reduces the concentration of CPAs required during the freezing process. The combination of magnetic induction nanowarming with water bath provides an efficient method ovarian tissue rewarming. This study offers novel approaches to optimize ovarian tissues vitrification.

In the field of oral medicine, 3D-printed individualized titanium mesh technology is gradually becoming an important means for the treatment of severe alveolar bone defect augmentation. This article provides a comprehensive analysis of the advantages of this technology, the evaluation of osteogenic effects, and the progress of research in clinical applications. In response to the current issue of variability in bone augmentation outcomes, this paper delves into multiple factors affecting bone augmentation effects, including individualized titanium mesh design (involving the thickness, pore size, pore shape, porosity, contour shape, selection of titanium alloy materials, and 3D printing technology), intraoperative procedures (the accuracy of placement during 3D-printed individualized titanium mesh surgery), and postoperative care (including the prevention of complications, formation of pseudoperiosteum, and stability of the titanium mesh). By integrating the clinical experience and research findings of our team, we propose a series of targeted optimization strategies, including designing, manufacturing, and clinically applying self-positioning individualized titanium meshs (positioning wings + individualized titanium meshs) to improve the positioning accuracy of the titanium mesh; propose individualized treatment processes and titanium mesh design schemes based on specific conditions of alveolar bone defects and soft tissue status; and emphasize the importance of long-term stable fixation of the titanium mesh to reduce the risk of postoperative mesh loosening and displacement. In addition, we appropriately summarize the evaluation methods for the bone augmentation effects of 3D-printed individualized titanium meshes, covering the following key indicators: (1) vertical bone augmentation and horizontal bone augmentation; (2) changes in bone contour morphology; (3) bone volume increase; (4) clinical indicators (surgical success rate, titanium mesh exposure, infection rate, and postoperative recovery); (5) aesthetic effect evaluation; (6) long-term stability; (7) radiological assessment; (8) patient satisfaction; and (9) precision of surgical operation, aiming to assist doctors in comprehensively assessing and in-depth analyzing the surgical outcomes to achieve the best therapeutic effects. The purpose of this article is to provide a reference for the optimization and clinical application of 3D-printed individualized titanium mesh technology and to lay a theoretical foundation for achieving the best osteogenic effects.