Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol （PEG） and Group B took oral solution of magnesium sodium potassium sulfate （OSS）. The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale （BBPS）. Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points （P<0.05）. The overall score of Group B was higher than that of Group A （P<0.05）. OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination （P<0.05）. There was a significant difference in nausea and vomiting symptoms between the two groups （P<0.05）, and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

ObjectiveTo observe the clinical efficacy and safety of Zhuyuwan in the treatment of hyperlipidemia. MethodsIn this study， hyperlipidemia patients treated in the Hospital of Chengdu University of Traditional Chinese Medicine （TCM） from September 2022 to December 2023 were randomly assigned into a control group and an observation group. Finally， 162 valid cases were included， encompassing 74 cases in the control group and 88 cases in the observation group. The control group was treated with atorvastatin calcium tablets， and the observation group with atorvastatin calcium tablets + Zhuyuwan extract granules. Both groups were treated for 8 weeks. The efficacy in terms of blood lipid level recovery， blood lipid levels， TCM syndrome distribution， efficacy in terms of TCM syndrome， and TCM symptom scores were compared between the two groups as well as between before and after treatment. Liver and kidney functions were monitored for safety assessment. ResultsIn terms of blood lipid level recovery， the total response rate in the observation group was 86.36% （76/88） and that in the control group was 86.49% （64/74）， with no statistically significant difference between the two groups. After treatment， both groups showed declines in levels of triglyceride （TG）， total cholesterol （TC）， and low-density lipoprotein cholesterol （LDL-C） （P<0.05） and elevations in the level of high-density lipoprotein cholesterol （HDL-C） （P<0.05）. Moreover， the observation group outperformed the control group in recovering the levels of TG， LDL-C， and HDL-C （P<0.05， P<0.01）. In terms of TCM syndrome， hyperlipidemia was mostly caused by phlegm turbidity and obstruction. The total response rate in terms of TCM syndrome in the observation group was 87.30% （55/63）， which was higher than that （63.46%， 33/52） in the control group （χ²=9.102， P<0.01）. After treatment， the scores of total TCM symptoms， primary symptoms， and secondary symptoms decreased in both groups （P<0.05）， and the observation group had lower scores than the control group （P<0.01）. The observation group was superior to the control group in alleviating obesity， chest tightness， and low food intake （P<0.05）. In terms of safety， the level of aminotransferase was slightly elevated in the control group， and no obvious adverse reaction was observed in the observation group， with no statistical significance in the incidence of adverse reactions. ConclusionZhuyuwan combined with atorvastatin can not only recover blood lipid levels and alleviate TCM symptoms but also reduce the occurrence of adverse reactions.

ObjectiveTo observe the clinical efficacy and safety of Zhuyuwan in the treatment of hyperlipidemia. MethodsIn this study， hyperlipidemia patients treated in the Hospital of Chengdu University of Traditional Chinese Medicine （TCM） from September 2022 to December 2023 were randomly assigned into a control group and an observation group. Finally， 162 valid cases were included， encompassing 74 cases in the control group and 88 cases in the observation group. The control group was treated with atorvastatin calcium tablets， and the observation group with atorvastatin calcium tablets + Zhuyuwan extract granules. Both groups were treated for 8 weeks. The efficacy in terms of blood lipid level recovery， blood lipid levels， TCM syndrome distribution， efficacy in terms of TCM syndrome， and TCM symptom scores were compared between the two groups as well as between before and after treatment. Liver and kidney functions were monitored for safety assessment. ResultsIn terms of blood lipid level recovery， the total response rate in the observation group was 86.36% （76/88） and that in the control group was 86.49% （64/74）， with no statistically significant difference between the two groups. After treatment， both groups showed declines in levels of triglyceride （TG）， total cholesterol （TC）， and low-density lipoprotein cholesterol （LDL-C） （P<0.05） and elevations in the level of high-density lipoprotein cholesterol （HDL-C） （P<0.05）. Moreover， the observation group outperformed the control group in recovering the levels of TG， LDL-C， and HDL-C （P<0.05， P<0.01）. In terms of TCM syndrome， hyperlipidemia was mostly caused by phlegm turbidity and obstruction. The total response rate in terms of TCM syndrome in the observation group was 87.30% （55/63）， which was higher than that （63.46%， 33/52） in the control group （χ²=9.102， P<0.01）. After treatment， the scores of total TCM symptoms， primary symptoms， and secondary symptoms decreased in both groups （P<0.05）， and the observation group had lower scores than the control group （P<0.01）. The observation group was superior to the control group in alleviating obesity， chest tightness， and low food intake （P<0.05）. In terms of safety， the level of aminotransferase was slightly elevated in the control group， and no obvious adverse reaction was observed in the observation group， with no statistical significance in the incidence of adverse reactions. ConclusionZhuyuwan combined with atorvastatin can not only recover blood lipid levels and alleviate TCM symptoms but also reduce the occurrence of adverse reactions.

Metabonomics and proteomics were employed to investigate the mechanism of Yuzhi Zhixue Granules in treating polycystic ovary syndrome with insulin resistance(PCOS-IR). The disease model was established by feeding a high-fat diet and gavage of letrozole solution and it was then treated with different doses of Yuzhi Zhixue Granules. The therapeutic effect of Yuzhi Zhixue Granules was evaluated based on the body mass, homeostasis model assessment of insulin resistance and insulin sensitivity index, serum levels of adipokines, and histopathological changes of rats. Metabolomics and proteomics were employed to find the action pathways of Yuzhi Zhixue Granules. The results showed that Yuzhi Zhixue Granules reduced the body mass, improved the insulin sensitivity and aromatase activity, improved the levels of leptin, adiponectin and other adipokines, and alleviated insulin resistance, histopathological changes, and metabolic disorders in PCOS-IR rats. Metabolomics results revealed 14 metabolites with altered levels in the ovarian tissue, which were closely related to glutathione metabolism and pyruvate metabolism. Proteomics results showed that the therapeutic effect of Yuzhi Zhixue Granules was mainly related to the adipokine, adenosine 5'-monophosphate(AMP)-activated protein kinase(AMPK), phosphatidylinositol 3-kinase/protein kinase B(PI3K/Akt), forkhead box protein O(FoxO), and mechanistic target of rapamycin(mTOR) signaling pathways. Western blot results showed that compared with the model group, Yuzhi Zhixue Granules treatment decreased the p-AMPK/AMPK and p-FoxO1/FoxO1 levels, increased the p-mTOR/mTOR level, and up-regulated the expression level of recombinant glucose transporter 4(GLUT4). Yuzhi Zhixue Granules can balance amino acid metabolism and pyruvate metabolism by regulating the AMPK/mTOR/FoxO/GLUT pathway to maintain the homeostasis of the ovarian environment and alleviate insulin resistance, thus treating PCOS-IR.
Animals ; Female ; Insulin Resistance ; Polycystic Ovary Syndrome/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Metabolomics ; Proteomics ; Rats, Sprague-Dawley ; Humans ; Ovary/metabolism* ; Signal Transduction/drug effects*

This study aimed to investigate the effects of Zhiwei Fuwei Pills on mitochondrial apoptosis in the rat model of precancerous lesions of gastric cancer(PLGC) based on the microRNA-21(miRNA-21)/B-cell lymphoma-2(Bcl-2) signaling pathway. Eighty-five 5-week-old male SPF-grade SD rats were selected, of which 75 were fed with N-methyl-N'-nitro-N-nitrosoguanidine(MNNG) for multifactorial modeling, and the PLGC model was established after 26 weeks. The rats were randomly grouped as follows: model, folic acid(0.002 g·kg~(-1)), low-dose(0.42 g·kg~(-1)) Zhiwei Fuwei Pills, medium-dose(0.84 g·kg~(-1)) Zhiwei Fuwei Pills, and high-dose(1.67 g·kg~(-1)) Zhiwei Fuwei Pills, with 15 rats in each group. Additionally, 10 rats were assigned to a blank group and administrated with an equivalent volume of normal saline by gavage. After four weeks of continuous drug administration, the gastric mucosal tissue was collected. Hematoxylin-eosin(HE) staining was performed to reveal the pathological changes in the gastric mucosa. Terminal deoxynucleotidyl transferase dUTP nick end labeling(TUNEL) was employed to detect apoptosis in gastric mucosal epithelial cells. RT-PCR was adopted to determine the mRNA levels of miRNA-21, phosphatase and tensin homolog(PTEN), Bcl-2, Bcl-2-associated X protein(Bax), and cysteinyl aspartate-specific protease 3(caspase-3). Western blot was employed to determine the protein levels of PTEN, Bcl-2, Bax, and caspase-3. Immunohistochemistry(IHC) was used to detect the positive expression of PTEN, Bcl-2, and Bax in the gastric mucosal tissue. Transmission electron microscopy(TEM) was employed to observe the morphological and structural changes in mitochondria. The results showed that compared with model group, the drug administration groups showed alleviated pathological changes, with increased apoptotic cells, down-regulated mRNA levels of miRNA-21 and Bcl-2, up-regulated mRNA and protein levels of PTEN, Bax, and caspase-3, and down-regulated protein level of Bcl-2. In addition, the drug administration groups exhibited mitochondrial swelling and rupture and reduction of cristae, which indicated mitochondrial apoptosis. These findings suggest that Zhiwei Fuwei Pills can effectively improve mitochondrial apoptosis in PLGC cells by regulating the miRNA-21/Bcl-2 signaling pathway.
Animals ; MicroRNAs/metabolism* ; Male ; Apoptosis/drug effects* ; Stomach Neoplasms/physiopathology* ; Proto-Oncogene Proteins c-bcl-2/genetics* ; Rats ; Rats, Sprague-Dawley ; Drugs, Chinese Herbal/administration & dosage* ; Mitochondria/genetics* ; Signal Transduction/drug effects* ; Precancerous Conditions/drug therapy* ; Humans ; PTEN Phosphohydrolase/genetics*

Sepsis is a systemic inflammatory response caused by severe infection or trauma, and is one of the common causes of acute lung injury(ALI) and acute respiratory distress syndrome(ARDS). Sepsis-acute lung injury(SALI) is a critical clinical condition with high morbidity and mortality. Its pathogenesis is complex and not yet fully understood, and there is currently a lack of targeted and effective treatment options. Pyroptosis, a novel form of programmed cell death, plays a key role in the pathological process of SALI by activating inflammasomes and releasing inflammatory factors, making it a potential therapeutic target. In recent years, the role of traditional Chinese medicine(TCM) in regulating signaling pathways related to pyroptosis through multi-components and multi-targets has attracted increasing attention. TCM may intervene in pyroptosis by inhibiting the activation of NLRP3 inflammasomes and regulating the expression of Caspase family proteins, thus alleviating inflammatory damage in lung tissues. This paper systematically reviews the molecular regulatory network of pyroptosis in SALI and explores the potential mechanisms and research progress on TCM intervention in cellular pyroptosis. The aim is to provide new ideas and theoretical support for basic research and clinical treatment strategies of TCM in SALI.
Pyroptosis/drug effects* ; Humans ; Sepsis/genetics* ; Acute Lung Injury/physiopathology* ; Animals ; Drugs, Chinese Herbal/therapeutic use* ; Medicine, Chinese Traditional ; Inflammasomes/metabolism* ; NLR Family, Pyrin Domain-Containing 3 Protein/genetics*

Subtype classification of age-related macular degeneration (AMD) based on optical coherence tomography (OCT) images serves as an effective auxiliary tool for clinicians in diagnosing disease progression and formulating treatment plans. To improve the classification accuracy of AMD subtypes, this study proposes a keypoint-based, attention-enhanced residual network (KPA-ResNet). The proposed architecture adopts a 50-layer residual network (ResNet-50) as the backbone, preceded by a keypoint localization module based on heatmap regression to outline critical lesion regions. A two-dimensional relative self-attention mechanism is incorporated into convolutional layers to enhance the representation of key lesion areas. Furthermore, the network depth is appropriately increased and an improved residual module, ConvNeXt, is introduced to enable comprehensive extraction of high-dimensional features and enrich the detail of lesion boundary contours, ultimately achieving higher classification accuracy of AMD subtypes. Experimental results demonstrate that KPA-ResNet achieves significant improvements in overall classification accuracy compared with conventional convolutional neural networks. Specifically, for the wet AMD subtypes, the classification accuracies for inactive choroidal neovascularization (CNV) and active CNV reach 92.8% and 95.2%, respectively, representing substantial improvement over ResNet-50. These findings validate the superior performance of KPA-ResNet in AMD subtype classification tasks. This work provides a high-accuracy, generalizable network architecture for OCT-based AMD subtype classification and offers new insights into integrating attention mechanisms with convolutional neural networks in ophthalmic image analysis.
Tomography, Optical Coherence/methods* ; Humans ; Macular Degeneration/diagnostic imaging* ; Neural Networks, Computer

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.