BACKGROUND:Previous studies of the research group have found that icariin-containing serum can delay the progression of knee osteoarthritis,promote chondrocyte proliferation and stem cell cartilage differentiation in rats,but there is still a lack of sufficient basis for clinical application.OBJECTIVE:To investigate the repair effect of icariin-containing serum on lipopolysaccharide-induced inflammatory damage of human chondrocytes.METHODS:The effect of icariin-containing serum on chondrocyte viability was detected by cell counting kit-8 method,and the optimal volume fraction and time of icariin-containing serum were screened.The cells were then divided into blank group,lipopolysaccharide group,icariin-containing serum group and lipopolysaccharide+icariin-containing serum group.After grouping,immunofluorescence was used to detect the secretion of type Ⅱ collagen in chondrocytes in each group.Real-time PCR was used to detect the expression of related genes.RESULTS AND CONCLUSION:(1)Icariin-containing serum showed good biosafety characteristics for human chondrocytes,and the cell viability reached the highest level after 48 hours of intervention when the icariin-containing serum volume fraction was 15％,and the follow-up experiments were carried out according to the conditions.(2)Compared with the blank group,lipopolysaccharide significantly inhibited the expression of type Ⅱ collagen in chondrocytes,while icariin-containing serum showed a positive mobilization effect,which could effectively promote the secretion of type Ⅱ collagen in chondrocytes under normal and inflammatory conditions.(3)The mRNA expression of type Ⅱ collagen and Aggrecan in chondrocytes decreased significantly under lipopolysaccharide stimulation,and the mRNA expression levels of matrix metalloproteinase 13 and a disintegrin-like and metalloproteinase with thrombospondin motifs-5 increased significantly.Icariin-containing serum promoted the mRNA expression of type Ⅱ collagen in human chondrocytes under inflammatory conditions and reduced the mRNA expression of matrix metalloproteinase 13 and a disintegrin-like and metalloproteinase with thrombospondin motifs-5 in chondrocytes after lipopolysaccharide intervention.Therefore,these findings indicate that the icariin-containing serum has good safety for human chondrocytes and plays an important role in maintaining the normal physiological functions of chondrocytes,promoting the synthesis of extracellular matrix,and inhibiting the secretion of inflammatory factors.

BACKGROUND:Previous studies of the research group have found that icariin-containing serum can delay the progression of knee osteoarthritis,promote chondrocyte proliferation and stem cell cartilage differentiation in rats,but there is still a lack of sufficient basis for clinical application.OBJECTIVE:To investigate the repair effect of icariin-containing serum on lipopolysaccharide-induced inflammatory damage of human chondrocytes.METHODS:The effect of icariin-containing serum on chondrocyte viability was detected by cell counting kit-8 method,and the optimal volume fraction and time of icariin-containing serum were screened.The cells were then divided into blank group,lipopolysaccharide group,icariin-containing serum group and lipopolysaccharide+icariin-containing serum group.After grouping,immunofluorescence was used to detect the secretion of type Ⅱ collagen in chondrocytes in each group.Real-time PCR was used to detect the expression of related genes.RESULTS AND CONCLUSION:(1)Icariin-containing serum showed good biosafety characteristics for human chondrocytes,and the cell viability reached the highest level after 48 hours of intervention when the icariin-containing serum volume fraction was 15％,and the follow-up experiments were carried out according to the conditions.(2)Compared with the blank group,lipopolysaccharide significantly inhibited the expression of type Ⅱ collagen in chondrocytes,while icariin-containing serum showed a positive mobilization effect,which could effectively promote the secretion of type Ⅱ collagen in chondrocytes under normal and inflammatory conditions.(3)The mRNA expression of type Ⅱ collagen and Aggrecan in chondrocytes decreased significantly under lipopolysaccharide stimulation,and the mRNA expression levels of matrix metalloproteinase 13 and a disintegrin-like and metalloproteinase with thrombospondin motifs-5 increased significantly.Icariin-containing serum promoted the mRNA expression of type Ⅱ collagen in human chondrocytes under inflammatory conditions and reduced the mRNA expression of matrix metalloproteinase 13 and a disintegrin-like and metalloproteinase with thrombospondin motifs-5 in chondrocytes after lipopolysaccharide intervention.Therefore,these findings indicate that the icariin-containing serum has good safety for human chondrocytes and plays an important role in maintaining the normal physiological functions of chondrocytes,promoting the synthesis of extracellular matrix,and inhibiting the secretion of inflammatory factors.

Cuproptosis, recently defined as a unique form of cell death distinct from programmed cell death, is triggered by copper overload within mitochondria. Genes associated with cuproptosis have been found to correlate with tumorigenesis and tumor progression, making the targeting of cuproptosis pathways a promising direction for anti-tumor therapies. Copper ion carriers can transport copper ions into cells, inducing cuproptosis and laying the foundation for its application in cancer treatment. This article elaborates on the homeostasis of copper and the mechanisms related to cuproptosis, further clarifying the relationship between cuproptosis and lung cancer treatment targets. This review aims to summarize current progress in research related to cuproptosis and lung cancer, providing new theories and bases for the clinical treatment of lung cancer.

In recent years， repetitive transcranial magnetic stimulation （rTMS） has garnered significant attention as a therapeutic approach for sleep disorders in the elderly. However， the prevailing rTMS protocols are predominantly developed based on normative neurophysiological data derived from young adults and fail to incorporate individualized parameters tailored to the brain characteristics of the elderly. To address this gap， the consensus development group synthesized the latest evidence from 2010 to 2025 and established a standardized rTMS protocol specifically for elderly patients with sleep disorders. Adhering to the Appraisal of Guidelines for Research and Evaluation II （AGREE II） framework， systematically screened randomized controlled trials （RCTs） and systematic reviews regarding rTMS in the treatment of sleep disorders across various conditions. Meanwhile， the Grading of Recommendations Assessment， Development and Evaluation （GRADE） system was employed to rigorously grade the quality of evidence and the strength of recommendations. This consensus guideline delineates precise rTMS protocols for the management of sleep disorders in the elderly， highlights the adjustment of stimulation intensity according to scalp-cortex distance recommends either MRI‑guided neuronavigation or the Beam F3/F4 heuristic approach for accurate target localization， thereby providing precise rTMS intervention protocol for sleep disorders in the elderly， aiming to enhance clinical efficacy while ensuring treatment safety. ［Funded by National Key Research and Development Program （number， 2023YFC3603200）； General Program of Shenzhen Science and Technology Innovation Commission （number， JCYJ20240813112859008， JCYJ20240813112900002）； Youth Program of Shenzhen Kangning Hospital （number， KN2023A004）； www.guidelines-registry.cn number， PREPARE-2026CN530］

Objective To investigate the relationship of skin failure (SF) with nutritional status in elderly critically ill patients and analyze the predictive efficiency of nutritional status on SF. Methods A total of 340 elderly critically ill patients admitted to the hospital from January 2020 to January 2025 were selected as research subjects. According to whether skin failure occurred, the above patients were classified into skin failure group and non-skin failure group. The nutritional status indicators [serum albumin (ALB), prealbumin (PA), total protein (TP), hemoglobin (Hb), body mass index (BMI), nutritional risk score (NRS 2002)] were compared between both groups. Multivariate analysis was performed on statistically significant indicators, and ROC curve was applied to analyze the predictive value. Results Among the 340 elderly critically ill patients, 142 cases (41.76%) developed skin failure. The ALB, PA, TP, Hb and BMI in the skin failure group were lower than those in the non-skin failure group (P<0.05) while the NRS2002 score was higher (P<0.05). After logistic multivariate analysis, ALB, PA and Hb were independent influencing factors of skin failure (P<0.05). ROC curve analysis revealed that the predictive value of ALB (AUC=0.850, 95%CI: 0.808-0.888, Z=-3.707, P<0.001) was better than that of PA (AUC=0.770, 95%CI: 0.717-0.816, Z=-3.100, P=0.002) or Hb (AUC=0.773, 95%CI: 0.722-0.819, Z=-2.556, P=0.011). Conclusion The occurrence of skin failure in elderly critically ill patients is closely related to nutritional status. ALB, PA and Hb are independent risk factors of SF, and ALB has the best predictive efficiency on SF.

Objective To explore the prevalence of depressive symptoms in postoperative patients with ovarian cancer and to analyze its influencing factors from multiple dimensions, including clinical characteristics, psychological factors, and laboratory indicators. Methods A cross-sectional study was conducted, which enrolled 235 postoperative patients with ovarian cancer. Depressive status was assessed using the patient health questionnaire, and the demographic, pathological, and medical record data of the patients were collected using the generalized anxiety disorder scale, Pittsburgh sleep quality index, European organization for research and treatment of cancer quality of life questionnaire core 30, and ECOG performance status score. Peripheral blood tumor marker (CA125), routine blood test, lymphocyte subsets, and serum cytokine levels were measured. Univariate and multivariate binary logistic regression analysis were used for statistical analysis. Results The prevalence of depression in postoperative patients with ovarian cancer was 39.15% (92/235). Univariate analysis showed that ECOG score ≥ 2 points, pain, anxiety, poor sleep quality, low quality of life, low life satisfaction, tumor recurrence, six or more cycles of chemotherapy, as well as higher levels of CA125, NLR, and NAR, and lower hemoglobin levels were significantly associated with depression (all P<0.05). Multivariate binary Logistic regression analysis showed that anxiety (OR=1.975, 95%CI: 1.231-3.170), sleep efficiency (OR=4.181, 95%CI: 1.211-14.43), sleep latency (OR=34.806, 95%CI: 4.258-284.542), ECOG performance status score, cognitive function (OR=0.918, 95%CI: 0.868-0.97), and life satisfaction were independent risk factors for depression (all P<0.05). Laboratory indicators were not independent influencing factors in the multivariate Logistic regression model. Conclusion Depression in postoperative patients with ovarian cancer is influenced by physiological, psychological, and social factors. Clinical management should focus on patients with anxiety, sleep disorders, poor physical condition, and low life satisfaction, and a comprehensive prevention and treatment strategy centered on psychological intervention and taking into account symptom management and social support should be implemented.

ObjectiveTo investigate the epidemiological and clinical characteristics of human bocavirus (HBoV) in hospitalized children with acute lower respiratory tract infection (ALRTI) at a single-center children’s hospital in Shanghai, thereby providing evidence for the diagnosis, treatment, and prevention of HBoV infection. MethodsA retrospective study was conducted on 19 537 hospitalized children with ALRTI at Shanghai Children’s Hospital from January 2021 to December 2023. Multiplex polymerase chain reaction (PCR) combined with capillary electrophoresis was used to detect HBoV and 12 other common respiratory viruses /atypical pathogens. The positive detection rate, demographic characteristics (sex, age), temporal distribution (year, season) of HBoV, as well as the clinical characteristics of severe and non-severe pneumonia were analyzed. ResultsThe overall HBoV-positive rate was 2.57% (503/19 537), with 59.44% (299/503) being single infections and 40.56% (204/503) being co-infections. The positive detection rate was significantly higher in boys than that in girls (2.78% vs 2.33%, χ²=3.88, P=0.049). The highest infection rate was observed in toddlers, followed by infants (χ²=379.57, P<0.001). The positive rate peaked in 2021 and reached its lowest point in 2023 (χ²=45.49, P<0.001), with epidemics mainly prevalent in summer and autumn. The main clinical symptoms were cough (90.06%, 453/503), fever (75.94%, 382/503), and wheezing (39.96%, 201/503). Children with severe pneumonia showed a higher incidence of wheezing compared with the non-severe group (P<0.001), while underlying diseases and co-infections had no significant association with disease severity (P>0.05). ConclusionHBoV was an important pathogen of ALRTI in children, predominantly affecting infants and toddlers, with higher susceptibility in boys and seasonal peaks in autumn and summer. The main clinical manifestations included cough, fever, and wheezing, with wheezing being more prevalent in children with severe pneumonia.

ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.