ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To analyze the current status of human papillomavirus(HPV) vaccination among women aged 9-45 years in Chaoyang District of Beijing, and to provide a basis for further promoting population vaccination.Methods The HPV vaccination(including HPV2, HPV4 and HPV9) data among women aged 9-45 in Chaoyang District of Beijing as of December 31, 2024 in Beijing's immunization planning information system were derived, and the estimated HPV vaccination rate in Beijing's female population was obtained by data analysis.Results By December 31, 2024, the estimated first dose vaccination rate of HPV vaccine among women aged 9-45 years in Chaoyang District of Beijing had been 50. 88%, and the estimated full dose vaccination rate was 48. 66%. The estimated coverage of the first dose and the full dose among girls aged9-15 years was 4. 62% and 2. 87%, respectively. The estimated full dose coverage rate was 62. 73% in subdistrict and 37. 33%in district.Conclusion The estimated HPV vaccination rate of 9-45-year-old women in Chaoyang District of Beijing is higher than that in other regions of China, but the estimated vaccination rate of adolescent women aged 9-15 is significantly lower than that of other age groups. It is recommended to improve the HPV vaccination rate through multiple joint efforts to achieve the action goal of accelerating the elimination of cervical cancer in China and the world as soon as possible.

Liver fibrosis is caused by various factors such as viral infection， alcohol intake， and metabolism-related damage， leading to the replacement of normal tissue by fibrous scars. As a regulatory factor for cell proliferation， insulin-like growth factor 1 （IGF-1） participates in the regulation of cell cycle， the promotion of cell proliferation and differentiation， and the inhibition of cell apoptosis by binding to its receptor insulin-like growth factor-1 receptor （IGF-1R）. Studies have shown that the IGF-1/IGF-1R signaling pathway can regulate the process of liver fibrosis by affecting the senescence and apoptosis of hepatocytes， the activation and proliferation of hepatic stellate cells， and the dysfunction of endothelial cells. In addition， the IGF-1/IGF-1R signaling system can also regulate multiple mechanisms such as DNA damage repair， cell proliferation， lipid metabolism， cell senescence， and oxidative stress， thereby providing new strategies and potential targets for the prevention and treatment of liver fibrosis. This article summarizes the mechanism of action of IGF-1/IGF-1R and its signal transduction system in mediating liver fibrosis by regulating DNA damage repair in different cells， in order to provide a theoretical basis for the treatment of liver fibrosis.

OBJECTIVE To introduce the development of an intelligent prescription review decision-support system for anti-tumor drugs and assess its clinical application outcomes. METHODS Relevant data sources， including national and local pharmaceutical administration policies， clinical practice guidelines/consensus， hospital information systems data， and genetic testing results， were integrated. Adhering to the principles of structure， standardization and dynamic updating， a knowledge base covering chemotherapeutic， targeted and immunotherapeutic agents was constructed using a dual-dimensional modeling approach that combined “drug attributes” and “clinical contexts”. This knowledge base was then embedded into the hospital’s electronic medical order system to establish the prescription review decision-support system. The application and performance of the system were evaluated at Shanghai Sixth People’s Hospital Affiliated to Shanghai Jiao Tong University School of Medicine. RESULTS A knowledge base containing 18 318 prescription review rules for anti-tumor drugs was constructed， and a closed-loop prescription review system was successfully established， encompassing pre-prescription real-time intervention， in-process interactive review， and post-prescription evaluation and analysis. From 2021 to 2024， the system generated a total of 57 879 alerts for prescriptions of five typical categories of anti-tumor drugs. For platinum-containing prescriptions， 22 577 alerts were generated， with Cisplatin for injection （lyophilized） being the most frequently alerted drug （13 445 alerts）， and “ototoxicity risk due to combined use” alerts remained high （7 682 alerts）. For methotrexate-containing prescriptions， 3 721 alerts were recorded， primarily related to “precaution-related issues” （76.4%， 2 843/3 721）. For doxorubicin-containing prescriptions， 17 301 alerts were triggered， primarily related to “dosage and administration” （14 315 alerts）. For human epidermal growth factor receptor 2-targeted agents-containing prescriptions， 1 007 alerts were issued， mostly related to “reimbursement restrictions” （956 alerts）. For programmed death-1/programmed death-ligand 1 inhibitors-containing prescriptions， the alerts increased year by year， totaling 13 273 alerts， primarily related to “inappropriate indication” （9 118 alerts）. Over the 4 years， the physician response rates to system alerts were 21.4%， 27.1%， 33.5% and 51.6%， respectively. CONCLUSIONS An intelligent decision-support system for anti-tumor drug prescription review， encompassing a closed-loop process of “real-time pre-event intervention， interactive in-event prescription review， post-event evaluation and analysis”， has been successfully constructed and implemented throughout the entire workflow. There is a discernible trend in this hospital， where the focus on monitoring anti-tumor drugs is shifting towards immunotherapy drugs. Additionally， the acceptance rate of physicians regarding prescription review opinions has been steadily increasing year by year.

Objective To analyze the epidemiological characteristics and molecular subtypes of typhoid and paratyphoid fever in Dalian, and to provide scientific basis for the development of effective prevention and control measures for typhoid and paratyphoid fever. Methods Descriptive epidemiological methods were used to analyze the data of typhoid and paratyphoid reported in Dalian from 2019 to 2023. Pulsed field gel electrophoresis (PFGE) was used for bacterial molecular typing and cluster analysis of the homology of strains. Results A total of 32 cases of typhoid and paratyphoid fever were reported in Dalian from 2019 to 2023. There was no statistically significant difference in the incidence rate between years ( χ²=4.41, P>0.05). There were two peaks in the time distribution. The age of onset was between 30 and 69 years old, and the difference in sex ratio between men and women was statistically significant ( χ²=4.00, P<0.05). The top two occupations with the highest number of cases of typhoid and paratyphoid fever were retired people, housework and unemployed, and the difference in the incidence rate among occupations was not statistically significant (χ²=4.59, P>0.05). PFGE experiment results showed that 32 typhoid and paratyphoid strains isolated from patients can be divided into 25 types. Conclusion The typhoid fever epidemic in Dalian remains stable at a relatively low level from 2019 to 2023. The PFGE banding patterns are relatively scattered, but there are dominant subtypes among them, which may be local epidemic strains.

Background Lead is a typical persistent environmental pollutant that can accumulate in bones for decades. During pregnancy, alterations in calcium metabolism promote the mobilization of bone lead, resulting in secondary exposure; however, the mechanisms by which pregnancy-associated bone lead mobilization affects maternal renal function remain unclear. Objective To investigate the role of mitochondrial dysfunction in pregnancy-related bone lead mobilization-induced renal injury. Methods Newly weaned female Wistar rats were randomly assigned to a control or a lead-exposed group administered either 0.05% sodium acetate or 0.05% lead acetate in drinking water. Following a 4-week lead exposure and a 4-week washout period, the females were co-housed with healthy age-matched males for mating. Rats were sacrificed at early (gestational day 3) and late (gestational day 17) pregnancystages, respectively. Renal histopathology was assessed using hematoxylin and eosin staining staining. Mitochondria-related indicators, including oxidative stress, inflammatory responses, and energy metabolism, were measured. Differential metabolites were identified using serum metabolomics. Results Renal injury in the lead-exposed pregnant rats progressed in a time-dependent manner, characterized by degeneration of proximal tubular epithelial cells, glomerular hyaline changes, and interstitial inflammatory cell infiltration. Repeated measures ANOVA indicated a significant interaction between the treatment factor (lead exposure) and the temporal factor (gestational stage) on renal injury (P<0.001). Further analysis of mitochondrial function-related indicators in late-pregnancy renal tissue revealed that the lead exposure group exhibited significantly increased levels of malondialdehyde (MDA) and reactive oxygen species (ROS) (P<0.05), accompanied by a reduction in superoxide dismutase (SOD) and reduced glutathione (GSH) activities (P<0.05); regarding inflammatory markers, levels of interleukin-18 (IL-18) and interleukin-1β (IL-1β) were elevated (P<0.01), whereas interleukin-33 (IL-33) was decreased in the lead-exposed group (P<0.05); energy metabolism-related indicators, including adenosine triphosphate (ATP) level, Na⁺-K⁺-ATPase and Ca²⁺-Mg²⁺-ATPase activities, and mitochondrial respiratory chain complexes I, III, and V activities, were significantly reduced (P<0.05) in the lead-exposed gorup. The typical differential metabolite N-methylisoleucine, identified through serum metabolomics analysis, was negatively correlated with blood lead levels, kidney injury scores, and IL-1β, while positively correlated with catalase (CAT) activity and Ca²⁺-Mg²⁺-ATPase. Conclusions Mitochondrial dysfunction may play a critical role in renal injury induced by bone lead mobilization during late gestation.

Background As common public facilities essential to daily life, hair and beauty salons frequently contain various airborne toxic and hazardous pollutants potentially leading to adverse health effects for salon practitioners. Objective To characterize the indoor air pollution profiles of common contaminants in hair and beauty salons in Shanghai and to evaluate the associated health risks for practitioners, in order to provide a scientific basis for strengthening the public health management in Shanghai and protecting the health of practitioners. Methods The air quality monitoring data of hair and beauty salons in Shanghai from 2016 to 2024 were obtained from the “Health Hazard Factors Monitoring Program for Public Places” of the National Institute of Environmental Health, Chinese Center for Disease Control and Prevention. Monitoring indicators included particulate matter ≤10 μm in aerodynamic diameter (PM₁₀), particulate matter ≤2.5 μm in aerodynamic diameter (PM_2.5), formaldehyde, ammonia, benzene, toluene, and xylene. Indicator compliance rates were calculated across various years in accordance with GB 9666-1996 Hygienic standard for barber shop and beauty shop and GB 37488-2019 Hygiene indicators and limit for public places; specifically, PM_2.5 was assessed against the limits stipulated in GB/T 18883-2022 Standards for indoor air quality. A questionnaire survey was conducted among salon practitioners to collect weekly working days and daily working hours. The non-carcinogenic risks associated with inhalation exposure to formaldehyde, ammonia, benzene, toluene, and xylene as well as the carcinogenic risks posed by formaldehyde and benzene were evaluated following WS/T 777-2021 Technical guide for environmental health risk assessment of chemical exposure and the U.S. Environmental Protection Agency inhalation risk model. Results The overall compliance rates of PM₁₀, formaldehyde, ammonia, benzene, and toluene in the air of hair and beauty salons in Shanghai from 2016 to 2024 were 92.13%, 96.59%, 96.15%, 94.93%, and 94.97%, respectively; the overall compliance rate of xylene was a little lower (85.92%), and the overall compliance rate of PM_2.5 was 57.18%. The P₅₀ concentrations of PM₁₀, PM_2.5, formaldehyde, ammonia, benzene, toluene, and xylene did not exceed the corresponding limits. The P₅₀ of non-carcinogenic risk indicator (hazard quotient, HQ) for formaldehyde, ammonia, benzene, toluene, and xylene were <1. The probabilities of non-carcinogenic risk HQ >1 for formaldehyde and xylene were 41.4% and 10.9%, respectively, which were higher than that of other pollutants. The P₅₀ of carcinogenic risk (CR) for formaldehyde and benzene were between 1.0×10⁻⁶ and 1.0×10⁻⁴, while the probabilities of CR >1.0×10⁻⁴ were 16.9% and 14.0%, respectively. Conclusion The overall compliance rate of common pollutant concentrations in the air of hair and beauty salons in Shanghai is high, and the hygienic condition meets the requirements of national standards. The non-carcinogenic health risks posed by formaldehyde and xylene to employees (with formaldehyde being more prominent), as well as the carcinogenic risks associated with formaldehyde and benzene, deserve heightened attention in future health supervision.

ObjectiveTo investigate the intervention mechanism of the traditional Chinese medicine Number 2 Feibi recipe （N2FBR） in idiopathic pulmonary fibrosis （IPF）， focusing on its effects on endoplasmic reticulum （ER） stress， apoptosis， stemness maintenance， and regenerative capacity of alveolar type Ⅱ epithelial cells （AT2 cells）， and to validate the modern translational pathway of the theory of "deficiency of Zong Qi leading to pulmonary atelectasis and atrophy". MethodsA mouse model of pulmonary fibrosis was induced by bleomycin （BLM）. Mice were randomly divided into blank control， model， low-， and high-dose N2FBR intervention groups （9.1， 18.2 g·kg^-1）， and prednisolone intervention group （6.5 mg·kg^-1）. Pulmonary histopathological changes and collagen deposition were evaluated using hematoxylin-eosin （HE） and Masson's trichrome staining. Hydroxyproline （HYP） content was measured by the alkaline hydrolysis method. Lung coefficient and pulmonary function parameters were evaluated. The mRNA expression levels of fibrosis-related factors， including collagen type Ⅰ alpha 1 chain （ColIa1）， alpha-smooth muscle actin （α-SMA）， and tissue inhibitor of metalloproteinase 1 （Timp1）， were detected by real-time polymerase chain reaction （Real-time PCR）. Cell apoptosis was assessed using the terminal deoxynucleotidyl transferase dUTP nick-end labeling （TUNEL） assay. Apoptosis of AT2 cells was further evaluated by double immunofluorescence staining for surfactant protein C （SPC） and cysteine-aspartic protease-3 （Caspase-3）. Endoplasmic reticulum （ER） stress in AT2 cells was examined by double staining for SPC and protein kinase R-like endoplasmic reticulum kinase （PERK）. Ultrastructural changes of ER and lamellar bodies in AT2 cells were observed by transmission electron microscopy （TEM）. The expression levels of key proteins involved in ER stress and apoptosis pathways， including PERK， activating transcription factor 4 （ATF4）， and Caspase-3， were detected by Western blot. Double immunofluorescence staining of SPC and Ki-67 antigen （Ki-67） was performed to evaluate the proliferative capacity of AT2 cells. Lineage tracing technology （labeling AT2 cells with GFP） combined with Krt8 labeling was used to evaluate intermediate differentiation states， and morphological transformation of AT2 cells into alveolar type Ⅰ epithelial cells （AT1） was observed. ResultsBLM-induced mice exhibited significant structural disruption of lung tissue， increased collagen deposition， elevated lung coefficient， decreased pulmonary function， and upregulation of fibrosis-related factors （P<0.01）. High-dose N2FBR treatment significantly ameliorated lung tissue damage and dysfunction， significantly reduced HYP content （P<0.01）， and significantly downregulated ColIa1， α-SMA， and Timp1 expression （P<0.01）. Apoptosis analysis showed increased TUNEL-positive and Caspase-3-positive AT2 cells in the model group， which was significantly reduced by high-dose N2FBR treatment. TEM revealed swollen ER structures in AT2 cells of the model group， which tended to return to normal following treatment. PERK protein staining analysis showed evident ER stress in AT2 cells of the model group， which were markedly alleviated in the treatment group. The expression levels of ER stress-related proteins PERK and ATF4， as well as the apoptosis-related protein Caspase-3， were elevated in the model group and significantly reduced after treatment. TEM also revealed disrupted lamellar body structures in the model group， which tended to recover in the treatment group. Regarding the proliferative capacity of AT2 cells， the proportion of Ki-67⁺SPC⁺ AT2 cells significantly increased in the treatment group （P<0.01）. Lineage tracing showed that the proportion of keratin 8-positive green fluorescent protein-positive （Krt8⁺GFP⁺） cells increased in the model group， indicating differentiation arrest. This proportion was significantly reduced in the treatment group， and the morphology of GFP⁺ cells exhibited a flattened， extended shape， suggesting restored differentiation toward AT1 cells. ConclusionN2FBR alleviates ER stress in AT2 cells， reduces AT2 cell apoptosis， restores lamellar body structure and function， enhances proliferation activity， and alleviates differentiation arrest to promote differentiation into AT1 cells， thereby repairing the alveolar epithelium and effectively blocking the progression of pulmonary fibrosis. Its traditional Chinese medicine mechanism of "replenishing Zong Qi， harmonizing Qi and blood， and unblocking pulmonary meridians" closely aligns with the modern regulatory pathway of AT2 stem cells， providing a novel theoretical basis and experimental evidence for the intervention of IPF with traditional Chinese medicine.

ObjectiveThis paper aims to explore the in vitro anti-psoriasis activity and potential mechanism of Kangfuxin liquid （KFX liquid）， providing experimental evidence for the anti-psoriasis effect of KFX liquid. MethodsFirstly， the uninduced human immortalized keratinocyte cells （HaCaT cells） were divided into seven groups， namely the control group and KFX liquid groups with different doses （5， 10， 20， 40， 80， 160 g·L^-1）. After being treated with different concentrations of KFX liquid， the effect of KFX liquid on the normal cell proliferation was detected by using the cell counting kit-8 （CCK-8） method. Secondly， the uninduced HaCaT cells were divided into six groups， namely the control group and recombinant human interleukin-7A （rh-IL-7A） groups with different doses （5， 10， 50， 100， 120 g·L^-1）. After being treated with different concentrations of recombinant human interleukin-17A （rh IL-17A） liquid， the effect of rh IL-17A on cell proliferation was detected. The optimal induction concentration was screened. Then， normal HaCaT cells were divided into a control group and KFX liquid groups with different doses （5， 10， 20， 40， 80， 160 g·L^-1）. Except for the control group， the other groups established psoriasis cell models with the optimal induction concentration of rh IL-17A. After being treated with different concentrations of KFX liquid， the effects of KFX liquid on the psoriasis-like HaCaT cell proliferation were investigated. Finally， the uninduced HaCaT cells were divided into six groups， namely the control group， rh IL-17A group， methotrexate （MTX） group， and KFX liquid groups with different doses （20， 40， 80 g·L^-1）. Except for the control group， the other groups used the optimal induction concentration of rh IL-17A to establish psoriasis cell models. After being treated with different drugs， the cell migration levels were detected through scratch assays， and real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect the relative mRNA expression levels of Ki-67 antigen （Ki67）， S100 calcium-binding protein A7 （S100A7）， S100 calcium-binding protein A8 （S100A8）， and S100 calcium-binding protein A9 （S100A9）， thereby comprehensively evaluating the in vitro anti-psoriasis activity of KFX liquid. By detecting the relative mRNA expression levels of interleukin-1β （IL-1β）， interleukin-6 （IL-6）， and chemokine-20 （CXCL-20） inflammatory-related factors in psoriasis-like HaCaT cells and the protein expression levels of Janus kinase 3 （JAK3）， phosphorylated Janus kinase 3 （p-JAK3）， signal transducer and activator of transcription 3 （STAT3）， and phosphorylated signal transducer and activator of transcription 3 （p-STAT3）， the mechanism was explored. ResultsCompared with that of control group， when treated with 80 g·L^-1 KFX liquid for 72 h （P<0.05） and at different times with 160 g·L^-1 KFX liquid， the HaCaT cell proliferation activity was significantly affected （P<0.01）， while the other concentrations of KFX liquid had no significant differences in cell morphology and cell proliferation activity at different times， indicating that the KFX liquid is relatively safe for HaCaT cells and has no obvious toxic side effects. Compared with that of control group， when treated with different concentrations of rh IL-17A for 24 h， the HaCaT cell proliferation activity was significantly enhanced， and the cell activity was the strongest when the concentration was 100 μg·L^-1 （P<0.05）， with a density close to 100% and intact cell morphology， indicating that 100 μg·L^-1 is the optimal concentration for inducing HaCaT cell proliferation. The results of the KFX liquid treatment on rh IL-17A-induced psoriasis-like cells show that the KFX liquid not only effectively inhibits the rh IL-17A-induced psoriasis-like HaCaT cell proliferation activity （P<0.01）， but also significantly reduces the migration ability of rh IL-17A-induced psoriasis-like HaCaT cells （P<0.01）， and the relative mRNA expression levels of Ki67， S100A7， S100A8， and S100A9 （P<0.01）. Moreover， the KFX liquid can significantly reduce the relative mRNA expression levels of IL-1β， IL-6， and CXCL-20 in rh IL-17A-induced psoriasis-like cells （P<0.01）， and significantly inhibit the phosphorylation levels of JAK3 and STAT3 proteins （P<0.05， P<0.01）. ConclusionThe KFX liquid has no obvious toxicity to uninduced HaCaT cells. It can inhibit rh IL-17A-induced psoriasis-like HaCaT cell proliferation， reduce the cell migration ability， and has good in vitro anti-psoriasis activity. Its action mechanism may be related to downregulating the expression levels of inflammation-related cytokines in the JAK3/STAT3 signaling pathway and inhibiting the phosphorylation levels of JAK3 and STAT3 proteins.