AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To establish a Chinese drug-related problem （DRP） classification system applicable to pharmacist-led pharmaceutical care in China， providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system， including literature review and analysis， comparison of existing classification systems， refinement of classification items and framework development， two rounds of standard case validation， expert discussion， and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ， assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem（including potential problems）， DRP evaluation， cause （including possible causes of potential problems）， intervention， acceptance of intervention and DRP status]， with 24 primary codes and 96 secondary codes. In the first round of case validation， κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round， κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system， positive ratings （“strongly agree” or “agree”） exceeded 85% for all items. Specifically， positive ratings for“the classification system can provide appropriate category selection”，“ the classification system is comprehensive”，“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability， providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.

Renal fibrosis represents the pivotal pathological process driving the progression of chronic kidney disease (CKD) towards end-stage renal disease. Its core manifestations include chronic inflammation, excessive deposition of extracellular matrix (ECM), and tubulointerstitial injury resulting in functional deterioration. Emerging research on the molecular mechanisms underlying renal fibrosis has established that, beyond the canonical Smad-dependent pathway, transforming growth factor-β1 (TGF-β1) also modulates fibrogenesis through non-canonical signaling pathways, notably the mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) cascades. These non-canonical pathways engage in crosstalk with the canonical Smad pathway, synergistically regulating key processes such as ECM metabolism, inflammatory responses, and epithelial-mesenchymal transition (EMT), thereby collectively orchestrating the initiation and progression of renal fibrosis. Notably, various active components derived from traditional Chinese medicine have demonstrated anti-fibrotic efficacy by modulating these pathways, highlighting their promising multi-target therapeutic potential. This review aims to systematically summarize recent advances in understanding the roles of TGF-β1-mediated MAPK and PI3K/Akt non-canonical signaling pathways in renal fibrosis and to discuss potential therapeutic strategies targeting these pathways.

The prevalence of Class III malocclusion varies among different countries and regions. The populations from Southeast Asian countries (Chinese and Malaysian) showed the highest prevalence rate of 15.8%, which can seriously affect oral function, facial appearance, and mental health. As anterior crossbite tends to worsen with growth, early orthodontic treatment can harness growth potential to normalize maxillofacial development or reduce skeletal malformation severity, thereby reducing the difficulty and shortening the treatment cycle of later-stage treatment. This is beneficial for the physical and mental growth of children. Therefore, early orthodontic treatment for Class III malocclusion is particularly important. Determining the optimal timing for early orthodontic treatment requires a comprehensive assessment of clinical manifestations, dental age, and skeletal age, and can lead to better results with less effort. Currently, standardized treatment guidelines for early orthodontic treatment of Class III malocclusion are lacking. This review provides a comprehensive summary of the etiology, clinical manifestations, classification, and early orthodontic techniques for Class III malocclusion, along with systematic discussions on selecting early treatment plans. The purpose of this expert consensus is to standardize clinical practices and improve the treatment outcomes of Class III malocclusion through early orthodontic treatment.
Humans ; Malocclusion, Angle Class III/classification* ; Orthodontics, Corrective/methods* ; Consensus ; Child

Stem cells play a crucial role in maintaining tissue regenerative capacity and homeostasis. However, mechanisms associated with stem cell senescence require further investigation. In this study, we conducted a proteomic analysis of human dental pulp stem cells (HDPSCs) obtained from individuals of various ages. Our findings showed that the expression of NUP62 was decreased in aged HDPSCs. We discovered that NUP62 alleviated senescence-associated phenotypes and enhanced differentiation potential both in vitro and in vivo. Conversely, the knocking down of NUP62 expression aggravated the senescence-associated phenotypes and impaired the proliferation and migration capacity of HDPSCs. Through RNA-sequence and decoding the epigenomic landscapes remodeled induced by NUP62 overexpression, we found that NUP62 helps alleviate senescence in HDPSCs by enhancing the nuclear transport of the transcription factor E2F1. This, in turn, stimulates the transcription of the epigenetic enzyme NSD2. Finally, the overexpression of NUP62 influences the H3K36me2 and H3K36me3 modifications of anti-aging genes (HMGA1, HMGA2, and SIRT6). Our results demonstrated that NUP62 regulates the fate of HDPSCs via NSD2-dependent epigenetic reprogramming.
Humans ; Dental Pulp/cytology* ; Nuclear Pore Complex Proteins/genetics* ; Cellular Senescence/genetics* ; Stem Cells/metabolism* ; Epigenesis, Genetic ; Cell Proliferation ; Cell Differentiation ; Histone-Lysine N-Methyltransferase/metabolism* ; Cells, Cultured ; Cellular Reprogramming ; Cell Movement ; Proteomics

Instrument separation is a critical complication during root canal therapy, impacting treatment success and long-term tooth preservation. The etiology of instrument separation is multifactorial, involving the intricate anatomy of the root canal system, instrument-related factors, and instrumentation techniques. Instrument separation can hinder thorough cleaning, shaping, and obturation of the root canal, posing challenges to successful treatment outcomes. Although retrieval of separated instrument is often feasible, it carries risks including perforation, excessive removal of tooth structure and root fractures. Effective management of separated instruments requires a comprehensive understanding of the contributing factors, meticulous preoperative assessment, and precise evaluation of the retrieval difficulty. The application of appropriate retrieval techniques is essential to minimize complications and optimize clinical outcomes. The current manuscript provides a framework for understanding the causes, risk factors, and clinical management principles of instrument separation. By integrating effective strategies, endodontists can enhance decision-making, improve endodontic treatment success and ensure the preservation of natural dentition.
Humans ; Root Canal Therapy/adverse effects* ; Consensus ; Root Canal Preparation/adverse effects*

Peri-implant keratinized mucosa (PIKM) augmentation refers to surgical procedures aimed at increasing the width of PIKM. Consensus reports emphasize the necessity of maintaining a minimum width of PIKM to ensure long-term peri-implant health. Currently, several surgical techniques have been validated for their effectiveness in increasing PIKM. However, the selection and application of PIKM augmentation methods may present challenges for dental practitioners due to heterogeneity in surgical techniques, variations in clinical scenarios, and anatomical differences. Therefore, clear guidelines and considerations for PIKM augmentation are needed. This expert consensus focuses on the commonly employed surgical techniques for PIKM augmentation and the factors influencing their selection at second-stage surgery. It aims to establish a standardized framework for assessing, planning, and executing PIKM augmentation procedures, with the goal of offering evidence-based guidance to enhance the predictability and success of PIKM augmentation.
Humans ; Consensus ; Dental Implants ; Mouth Mucosa/surgery* ; Keratins

With the growing emphasis on maternal and child oral health, the significance of managing oral health across preconception, pregnancy, and infancy stages has become increasingly apparent. Oral health challenges extend beyond affecting maternal well-being, exerting profound influences on fetal and neonatal oral development as well as immune system maturation. This expert consensus paper, developed using a modified Delphi method, reviews current research and provides recommendations on maternal and child oral health management. It underscores the critical role of comprehensive oral assessments prior to conception, diligent oral health management throughout pregnancy, and meticulous oral hygiene practices during infancy. Effective strategies should be seamlessly integrated across the life course, encompassing preconception oral assessments, systematic dental care during pregnancy, and routine infant oral hygiene. Collaborative efforts among pediatric dentists, maternal and child health workers, and obstetricians are crucial to improving outcomes and fostering clinical research, contributing to evidence-based health management strategies.
Humans ; Pregnancy ; Female ; Infant ; Consensus ; Mouth Diseases/therapy* ; Pregnancy Complications/therapy* ; Oral Health ; Infant, Newborn ; Delphi Technique ; Oral Hygiene

BACKGROUND: Primary pulmonary mucoepidermoid carcinoma (PMEC) is an exceedingly rare malignancy originating from bronchial submucosal glands, accounting for <0.2% of lung cancers. Histologically characterized by a triphasic composition of mucinous, epidermoid, and intermediate cells, PMEC is classified into low-grade (favorable prognosis) and high-grade (aggressive behavior) subtypes. This study aimed to investigate the clinicopathological characteristics and prognostic indicators of PMEC. METHODS: Clinicopathological, radiological, molecular, and survival data from 26 PMEC patients were retrospectively analyzed, including immunohistochemical profiles and MAML2 rearrangement status, supplemented by literature review. RESULTS: The cohort comprised 14 males and 12 females (mean age: 55.6 years). Eight patients (30.8%) were smokers, and 19 (73.1%) presented with symptoms. Central tumors predominated (n=19, 73.1%) versus peripheral lesions (n=7, 26.9%). Computed tomography (CT) imaging consistently revealed hypo-to-isodense masses/nodules. Pathologically, 19 cases were low-grade and 7 high-grade. Immunohistochemically, the tumor cells were positive for CK7, P40, P63 and CK5/6, and the Ki-67 index ranged from 2% to 70%. MAML2 rearrangement was detected in 52.4% (11/21) of tested cases. Clinical staging distribution: stage I (n=14), stage II (n=8), stage III (n=3), stage IV (n=1). Treatment modalities: radical surgery alone (n=13), surgery with adjuvant chemotherapy (n=11), chemoradiotherapy (n=1), and conservative management (n=1). With a median follow-up of 57 months, 6 patients (23.1%) died. Prognostic analysis demonstrated: (1) Significantly inferior survival in high-grade versus low-grade groups (P<0.05); (2) Lymph node metastasis, advanced stage, Ki-67>20%, and high-grade histology significantly correlated with reduced overall survival (P<0.05); (3) Lymph node metastasis constituted an independent poor prognostic factor (HR=12.73, 95%CI: 1.22-132.96). CONCLUSIONS PMEC exhibits distinct clinicopathological features, with MAML2 rearrangement present in approximately half of cases. Lymph node metastasis, advanced stage, high Ki-67 proliferation index, and high-grade histology are key determinants of poor prognosis, with lymph node metastasis serving as an independent risk factor.
Humans ; Male ; Female ; Middle Aged ; Carcinoma, Mucoepidermoid/mortality* ; Lung Neoplasms/mortality* ; Trans-Activators/genetics* ; Prognosis ; Adult ; Gene Rearrangement ; Aged ; Retrospective Studies ; Transcription Factors/genetics* ; DNA-Binding Proteins/genetics*