AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Autoimmune pancreatitis is a special type of chronic pancreatitis that can lead to abnormal pancreatic exocrine function in patients. Autoimmune pancreatitis comorbid with pancreatic exocrine insufficiency has a complex pathogenesis， and there is limited research on this topic， leading to the lack of understanding of such patients in clinical practice. This article introduces the epidemiology of autoimmune pancreatitis， briefly describes the pathogenesis of pancreatic exocrine insufficiency caused by autoimmune pancreatitis， and summarizes the various detection methods for pancreatic exocrine function， nutritional assessments， lifestyle management， and drug therapy， in order to strengthen the understanding of autoimmune pancreatitis comorbid with pancreatic exocrine insufficiency and improve the clinical diagnosis and treatment of pancreatic exocrine insufficiency.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

ObjectiveTo study the chemical constituents of Bidens pilosa and the in vitro antiproliferative activity of some compounds against gastric cancer cells. MethodsThe chemical constituents were isolated and purified by methods such as silica gel column chromatography， preparative thin layer chromatography， medium pressure preparation chromatography， semi-preparative high performance liquid chromatography（HPLC） and recrystallization， their structures were identified on the basis of physicochemical properties， spectral data and circular dichroism spectra. Thiazole blue（MTT） assay was used to determine the in vitro inhibitory activityies of some isolated compounds against human gastric cancer SGC-7901 cells， and molecular docking was used to predict their potential targets. ResultsTwenty-five compounds were isolated from the petroleum ether fraction of B. pilosa and identified as bidpillignan A（1）， 5α， 8α-epidioxy-（22E， 24R）-ergosta-6， 22-diene-3β-ol（2）， 3β-hydroxysitost-5-en-7-one（3）， （20R）-6β-hydroxystigmasta-4， 22-dien-3-one（4）， 3β-hydroxylstigmasta-5， 22-dien-7-one（5）， （22E， 24S）-24-methyl-5α-choleata-7， 22-diene-3β， 5α， 6β-triol（6）， stigamast-5-ene-3β， 7α-diol（7）， stigmast-5， 22-diene-3β， 7α-diol（8）， 7β-hydroxysitosterol（9）， stigmasterol（10）， artabotrol（11）， cosmosoic acid（12）， ent-4（15）-eudesmene-1β， 6α-diol（13）， clovandiol（14）， 1H-indole-3-carboxaldehyde（15）， 6， 7-dimethoxycoumarin（16）， 3'， 4'-dimethoxyquercetin（17）， 8， 8'-bis-（dihydroconiferyl）-diferuloylate（18）， hydroxydihydrobovolide（19）， 2-deacetyl-11β， 13-dihydroxyxanthinin（20）， loliolide（21）， pubescone（22）， （+）-dehydrovomifoliol（23）， 2， 3-dihydroxypropyl palmitate（24） and n-hexadecane acid（25）. Among them， compound 1 was a new compound， compounds 3-9， 11-12， 18-20， 22-23 were first isolated from Bidens genus plants， and compounds 13 and 14 were isolated from this plant for the first time. Compounds 17 and 18 showed good in vitro proliferation inhibitory activities against SGC-7901 cells with the half inhibitory concentrations（IC₅₀） of 3.11， 7.22 μmol·L^-1， respectively. Molecular docking results showed that the potential targets of the two exerting anti-gastric cancer activity might be vascular endothelial growth factor receptor 2（VEGFR2） and poly（adenosine diphosphate-ribose） polymerase 7（PARP7）. ConclusionOne new compound， 14 genus first compounds， and 2 species first compounds were isolated from B. pilosa， among which compounds 17 and 18 processed anti-gastric cancer cell proliferation activity in vitro， and the targets may be VEGFR2 and PARP7.

Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.

Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.

Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.

ObjectiveTo improve the quality and service performance of community visual health services in Shanghai, and to establish a set of reasonable and effective evaluation index system for community visual health services. MethodsCentered on the national and Shanghai-based visual health policies and based on the current status and development trends of community visual health service program in Shanghai, the candidate indicators were formed through literature review and expert interviews, firstly. The framework of an evaluation index system was formulated through qualitative research successively, which was further revised and perfected using the Delphi method. Coefficient weights were calculated using the analytic hierarchy process (AHP), culminating in the establishment of the community visual health evaluation index system, lastly. ResultsA total of 22 visual health experts from district-level center for disease control, hospital ophthalmology and leaders in charging of visual health service in community health centers participated in the Delphi questionnaire survey, with a questionnaire recovery rate of 100% and an expert authority coefficient of 0.86, indicating high credibility. After a round of correspondence to experts’ importance ratings and discussions, a comprehensive evaluation index system comprising 3 primary indicators, 12 secondary indicators, and 47 tertiary indicators, along with 5 additional indicators, was finalized. ConclusionAn index system tailored to effective evaluation for community visual health initiatives was drawn up in this study, which can promote the capacity building in community eye health services, facilitating the high-quality development of visual health courses, and enhancing residents’ eye health.

Intestinal fibrosis is a major complication of inflammatory bowel disease (IBD), leading to a high incidence of surgical interventions and significant disability. Despite its clinical relevance, no targeted pharmacological therapies are currently available. This review aims to explore the underlying mechanisms driving intestinal fibrosis and address unresolved scientific questions, offering insights into potential future therapeutic strategies. We conducted a literature review using data from PubMed up to October 2024, focusing on studies related to IBD and fibrosis. Intestinal fibrosis results from a complex network involving stromal cells, immune cells, epithelial cells, and the gut microbiota. Chronic inflammation, driven by factors such as dysbiosis, epithelial injury, and immune activation, leads to the production of cytokines like interleukin (IL)-1β, IL-17, and transforming growth factor (TGF)-β. These mediators activate various stromal cell populations, including fibroblasts, pericytes, and smooth muscle cells. The activated stromal cells secrete excessive extracellular matrix components, thereby promoting fibrosis. Additionally, stromal cells influence the immune microenvironment through cytokine production. Future research would focus on elucidating the temporal and spatial relationships between immune cell-driven inflammation and stromal cell-mediated fibrosis. Additionally, investigations are needed to clarify the differentiation origins of excessive extracellular matrix-producing cells, particularly fibroblast activation protein (FAP) + fibroblasts, in the context of intestinal fibrosis. In conclusion, aberrant stromal cell activation, triggered by upstream immune signals, is a key mechanism underlying intestinal fibrosis. Further investigations into immune-stromal cell interactions and stromal cell activation are essential for the development of therapeutic strategies to prevent, alleviate, and potentially reverse fibrosis.
Humans ; Fibrosis/metabolism* ; Inflammatory Bowel Diseases/pathology* ; Animals ; Transforming Growth Factor beta/metabolism* ; Intestines/pathology*