1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Development and evaluation of classification system for drug-related problems in China
Shuang ZOU ; Tingting LU ; Lei BAO ; Yun LIAO ; Ling LI ; Ping ZHANG
China Pharmacy 2026;37(3):371-376
OBJECTIVE To establish a Chinese drug-related problem (DRP) classification system applicable to pharmacist-led pharmaceutical care in China, providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system, including literature review and analysis, comparison of existing classification systems, refinement of classification items and framework development, two rounds of standard case validation, expert discussion, and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ, assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem(including potential problems), DRP evaluation, cause (including possible causes of potential problems), intervention, acceptance of intervention and DRP status], with 24 primary codes and 96 secondary codes. In the first round of case validation, κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round, κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system, positive ratings (“strongly agree” or “agree”) exceeded 85% for all items. Specifically, positive ratings for“the classification system can provide appropriate category selection”,“ the classification system is comprehensive”,“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability, providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.
3.Research advances in autoimmune pancreatitis with pancreatic exocrine insufficiency
Xiang AO ; Chenxiao LIU ; Xianda ZHANG ; Taojing RAN ; Chunhua ZHOU ; Duowu ZOU
Journal of Clinical Hepatology 2025;41(2):395-400
Autoimmune pancreatitis is a special type of chronic pancreatitis that can lead to abnormal pancreatic exocrine function in patients. Autoimmune pancreatitis comorbid with pancreatic exocrine insufficiency has a complex pathogenesis, and there is limited research on this topic, leading to the lack of understanding of such patients in clinical practice. This article introduces the epidemiology of autoimmune pancreatitis, briefly describes the pathogenesis of pancreatic exocrine insufficiency caused by autoimmune pancreatitis, and summarizes the various detection methods for pancreatic exocrine function, nutritional assessments, lifestyle management, and drug therapy, in order to strengthen the understanding of autoimmune pancreatitis comorbid with pancreatic exocrine insufficiency and improve the clinical diagnosis and treatment of pancreatic exocrine insufficiency.
4.Clinical practice guidelines for intraoperative cell salvage in patients with malignant tumors
Changtai ZHU ; Ling LI ; Zhiqiang LI ; Xinjian WAN ; Shiyao CHEN ; Jian PAN ; Yi ZHANG ; Xiang REN ; Kun HAN ; Feng ZOU ; Aiqing WEN ; Ruiming RONG ; Rong XIA ; Baohua QIAN ; Xin MA
Chinese Journal of Blood Transfusion 2025;38(2):149-167
Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.
5.Identification of Chemical Constituents of Bidens pilosa and Analysis of Its Anti-gastric Cancer Cell Proliferation Activity in Vitro
Yu HAN ; Chang LIU ; Jiao LIU ; Tao ZHANG ; Zhongmei ZOU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(2):154-164
ObjectiveTo study the chemical constituents of Bidens pilosa and the in vitro antiproliferative activity of some compounds against gastric cancer cells. MethodsThe chemical constituents were isolated and purified by methods such as silica gel column chromatography, preparative thin layer chromatography, medium pressure preparation chromatography, semi-preparative high performance liquid chromatography(HPLC) and recrystallization, their structures were identified on the basis of physicochemical properties, spectral data and circular dichroism spectra. Thiazole blue(MTT) assay was used to determine the in vitro inhibitory activityies of some isolated compounds against human gastric cancer SGC-7901 cells, and molecular docking was used to predict their potential targets. ResultsTwenty-five compounds were isolated from the petroleum ether fraction of B. pilosa and identified as bidpillignan A(
6.Criteria and prognostic models for patients with hepatocellular carcinoma undergoing liver transplantation
Meng SHA ; Jun WANG ; Jie CAO ; Zhi-Hui ZOU ; Xiao-ye QU ; Zhi-feng XI ; Chuan SHEN ; Ying TONG ; Jian-jun ZHANG ; Seogsong JEONG ; Qiang XIA
Clinical and Molecular Hepatology 2025;31(Suppl):S285-S300
Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.
7.Criteria and prognostic models for patients with hepatocellular carcinoma undergoing liver transplantation
Meng SHA ; Jun WANG ; Jie CAO ; Zhi-Hui ZOU ; Xiao-ye QU ; Zhi-feng XI ; Chuan SHEN ; Ying TONG ; Jian-jun ZHANG ; Seogsong JEONG ; Qiang XIA
Clinical and Molecular Hepatology 2025;31(Suppl):S285-S300
Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.
8.Criteria and prognostic models for patients with hepatocellular carcinoma undergoing liver transplantation
Meng SHA ; Jun WANG ; Jie CAO ; Zhi-Hui ZOU ; Xiao-ye QU ; Zhi-feng XI ; Chuan SHEN ; Ying TONG ; Jian-jun ZHANG ; Seogsong JEONG ; Qiang XIA
Clinical and Molecular Hepatology 2025;31(Suppl):S285-S300
Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.
9.Construction of an evaluation index system for community visual health services in Shanghai
Chengyuan ZHANG ; Yuting WU ; Yajun PENG ; Tao YU ; Yi XU ; Senlin LIN ; Haidong ZOU ; Lina LU
Shanghai Journal of Preventive Medicine 2025;37(3):282-287
ObjectiveTo improve the quality and service performance of community visual health services in Shanghai, and to establish a set of reasonable and effective evaluation index system for community visual health services. MethodsCentered on the national and Shanghai-based visual health policies and based on the current status and development trends of community visual health service program in Shanghai, the candidate indicators were formed through literature review and expert interviews, firstly. The framework of an evaluation index system was formulated through qualitative research successively, which was further revised and perfected using the Delphi method. Coefficient weights were calculated using the analytic hierarchy process (AHP), culminating in the establishment of the community visual health evaluation index system, lastly. ResultsA total of 22 visual health experts from district-level center for disease control, hospital ophthalmology and leaders in charging of visual health service in community health centers participated in the Delphi questionnaire survey, with a questionnaire recovery rate of 100% and an expert authority coefficient of 0.86, indicating high credibility. After a round of correspondence to experts’ importance ratings and discussions, a comprehensive evaluation index system comprising 3 primary indicators, 12 secondary indicators, and 47 tertiary indicators, along with 5 additional indicators, was finalized. ConclusionAn index system tailored to effective evaluation for community visual health initiatives was drawn up in this study, which can promote the capacity building in community eye health services, facilitating the high-quality development of visual health courses, and enhancing residents’ eye health.
10.Chinese expert consensus on integrated case management by a multidisciplinary team in CAR-T cell therapy for lymphoma.
Sanfang TU ; Ping LI ; Heng MEI ; Yang LIU ; Yongxian HU ; Peng LIU ; Dehui ZOU ; Ting NIU ; Kailin XU ; Li WANG ; Jianmin YANG ; Mingfeng ZHAO ; Xiaojun HUANG ; Jianxiang WANG ; Yu HU ; Weili ZHAO ; Depei WU ; Jun MA ; Wenbin QIAN ; Weidong HAN ; Yuhua LI ; Aibin LIANG
Chinese Medical Journal 2025;138(16):1894-1896

Result Analysis
Print
Save
E-mail