Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveTo construct a prediction model for high responsiveness to short-term aerobic training in patients with Parkinson's disease (PD) based on dual-task gait assessment, and to provide evidence for identifying individuals who are most likely to benefit from such interventions. MethodsA total of 42 patients with PD who visited the outpatient clinic of Tianjin Huanhu Hospital between August 29, 2023 and December 19, 2024 were enrolled. All participants completed a 4-week home-based aerobic cycling training program and underwent dual-task gait assessments pre- and post-training. Patients were classified into high-response group (n = 12) and low-response group (n = 30) according to whether the improvement in gait speed reached the minimal clinically important difference of 0.1 m/s. The clinical validity of this grouping was verified by comparing differences in cardiopulmonary exercise testing parameters and dual-task gait indicators between the two groups pre- and post-training. Based on baseline characteristics, Firth's penalized maximum likelihood logistic regression was applied to construct a predictive model for high responsiveness, and the discriminative performance of the model was assessed preliminarily. ResultsThe high-response group showed significantly greater improvement in gait speed, step length, cadence and the anaerobic threshold to maximal oxygen uptake ratio after training compared with the low-response group (P < 0.05), confirming the clinical validity of the grouping. The baseline anaerobic threshold to maximal oxygen uptake ratio (OR = 3.348), body mass index (OR = 2.229) and age (OR = 0.428) demonstrated certain discriminative ability in the present sample. The area under the receiver operating characteristic curve was 0.831, with an overall prediction accuracy of 81.0%, specificity of 83.3% and sensitivity of 75.0%. Robustness of the model was confirmed via internal validation using the Bootstrap method, which suggested that the results were informative, but further validation was still required. ConclusionThe anaerobic threshold/maximal oxygen uptake ratio, body mass index and age may predict the response to short-term aerobic training in patients with PD.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective To analyze the usage of pediatric drugs in 17 pediatric specialty hospitals from 2016 to 2020, and provide reference and guidance for the development of the essential medicine list （EML） for children and the improvement of the National Reimbursement Drug List （NRDL） in China. Methods Based on the pediatric medication monitoring data from 17 children's specialized hospitals reported to the Chinese Medical Economic Information Network (CMEI) of the Chinese Pharmaceutical Association between 2016 and 2020, this study analyzes the overall situation of the sample hospitals and the clinical use of pediatric drugs according to the major categories of the Anatomical Therapeutic Chemical Classification System （ATC）. Results In the various ATC categories, the trend of systemic use of anti-infective drugs decreasing was significant in the average hospital expenditure, while the trend of respiratory and digestive system and metabolic drugs decreasing was significant in the average hospital DDDS. In 2020, the average number of hospital grade standards for essential drugs （2018 version） accounted for 15.82% of the total number of drug use standards, while the average number of hospital grade standards for medical insurance （2019 version） accounted for 8.23% of the total number of drug use standards. Conclusion The use of pediatric medication in sample hospitals from 2016 to 2020 was generally reasonable, and there would still a certain gap between the actual clinical usage habits with the existing EML and NRDL，which still need to be adjusted.

Objective:To explore the mediating role of coping style and fear of disease progression between health literacy and self-management in postoperative chemotherapy patients with colorectal cancer. It provided a theoretical basis for improving the self-management ability of postoperative chemotherapy patients with colorectal cancer.Methods:Convenience sampling method was used to select postoperative chemotherapy patients with colorectal cancer admitted to the Second Affiliated Hospital of Anhui Medical University from October 2023 to May 2024, and a cross-sectional survey was conducted using Health Literacy Management Scale, Medical Coping Modes Scale, Fear of Progression Questionnaire-Short Form, and Cancer Patient Self-Management Assessment Scale.Results:A total of 229 questionnaires were distributed, of which 220 were returned as valid questionnaires, including 142 males and 78 females, aged (60.05 ± 10.14) years. The total health literacy score was (85.30 ± 9.45) points and self-management score was (150.36 ± 14.10) points among patients undergoing postoperative chemotherapy for colorectal cancer. Self-management was positively correlated with health literacy and facing ( r=0.576, 0.525, both P<0.01), while negatively correlated with avoidance, yielding, and fear of disease progression ( r=-0.660, -0.616, -0.566, all P<0.01). The mediation model showed that facing coping style and fear of disease progression had a chained mediation effect of 0.050 between health literacy and self-management, accounting for 8.36% of the total effect. Conclusions:Self-management in patients with postoperative chemotherapy for colorectal cancer was moderately low. The chain mediating role of coping style and fear of disease progression between health literacy and self-management in postoperative chemotherapy patients with colorectal cancer was established. Nursing staff should strengthen health education for postoperative chemotherapy patients with colorectal cancer, guide patients to face the disease positively, reduce fear, and promote patient self-management.

Objective:To summarize the clinical phenotypes, genotypes, and treatment outcomes of NPRL2-related epilepsy. Methods:This was a case summary.Clinical data of patients with NRPL2 variants admitted to the Department of Pediatrics, Peking University People′s Hospital between October 1, 2013 and October 31, 2023 were retrospectively analyzed.Previous reports of patients with the same disease were reviewed. Results:Six cases of NPRL2-related epilepsy were collected, and 37 cases were reported in the previous literatures.The age of onset ranged from 3 days to 18 years with the median age of 24 months.There were 15 patients with onset in infancy.Among the 41 patients diagnosed with epilepsy, 73.1% (30/41) had focal seizures, 34.1% (14/41) had frontal lobe epilepsy, and 17.1% (7/41) had epileptic spasms.Among the patients with known cranial imaging, 58.6% (17/29) had cortical malformations. NPRL2 variants involved 11 nonsense mutations, 10 splice site mutations, 7 frameshift mutations, 1 large fragment deletion, and 14 missense mutations; among them, 39 mutations were pathogenic or likely pathogenic, while the rest 4 mutations had unclear pathogenicity.Among the 27 patients with known outcomes, 11 (40.7%) had no seizures after administration of 1 or 2 types of drugs, and 16 (59.2%) had drug-resistant epilepsy.Among the 16 patients, 1 had no seizures after treatment with 3 types of anti seizure medications, and 7 had no seizures after surgery.Most patients had varying degrees of delay in intellectual and motor development. Conclusions:Patients with NPRL2 variants usually present with frequent focal seizures and epileptic spasms, and the age of onset varies greatly.About half of the patients have drug-resistant epilepsy, half of whom have cortical malformations.For those with drug-resistant epilepsy and abnormal cranial imaging, surgery may be considered.

Objective To investigate the distribution and antimicrobial resistance profiles of clinically isolated Haemophilus influenzae and Moraxella catarrhalis in hospitals across China from 2015 to 2021,and provide evidence for rational use of antimicrobial agents.Methods Data of H.influenzae and M.catarrhalis strains isolated from 2015 to 2021 in CHINET program were collected for analysis,and antimicrobial susceptibility testing was performed by disc diffusion method or automated systems according to the uniform protocol of CHINET.The results were interpreted according to the CLSI breakpoints in 2022.Beta-lactamases was detected by using nitrocefin disk.Results From 2015 to 2021,a total of 43 642 strains of Haemophilus species were isolated,accounting for 2.91％of the total clinical isolates and 4.07％of Gram-negative bacteria in CHINET program.Among the 40 437 strains of H.influenzae,66.89％were isolated from children and 33.11％were isolated from adults.More than 90％of the H.influenzae strains were isolated from respiratory tract specimens.The prevalence of β-lactamase was 53.79％in H.influenzae strains.The H.influenzae strains isolated from children showed higher resistance rate than the strains isolated from adults.Overall,779 strains of H.influenzae did not produce β-lactamase but were resistant to ampicillin(BLNAR).Beta-lactamase-producing strains showed significantly higher resistance rates to these antimicrobial agents than the β-lactamase-nonproducing strains.Of the 16 191 M.catarrhalis strains,80.06％were isolated from children and 19.94％isolated from adults.M.catarrhalis strains were mostly susceptible to both amoxicillin-clavulanic acid and cefuroxime,evidenced by resistance rate lower than 2.0％.Conclusions The emergence of antibiotic-resistant H.influenzae due to β-lactamase production poses a challenge for clinical anti-infective treatment.Therefore,it is very important to implement antibiotic resistance surveillance for H.influenzae and guide rational antibiotic use.All local clinical microbiology laboratories should actively improve antibiotic susceptibility testing and strengthen antibiotic resistance surveillance for H.influenzae.

Objective To understand the changing composition and antibiotic resistance of bacterial species in the clinical isolates from outpatient and emergency department(hereinafter referred to as outpatients)and inpatient children over time in various hospitals,and to provide laboratory evidence for rational antibiotic use.Methods The data on clinically isolated pathogenic bacteria and antimicrobial susceptibility of isolates from outpatients and inpatient children in the CHINET program from 2015 to 2021 were collected and analyzed.Results A total of 278 471 isolates were isolated from pediatric patients in the CHINET program from 2015 to 2021.About 17.1％of the strains were isolated from outpatients,primarily group A β-hemolytic Streptococcus,Escherichia coli,and Staphylococcus aureus.Most of the strains(82.9％)were isolated from inpatients,mainly SS.aureus,E.coli,and H.influenzae.The prevalence of methicillin-resistant S.aureus(MRSA)in outpatients(24.5％)was lower than that in inpatient children(31.5％).The MRSA isolates from outpatients showed lower resistance rates to the antibiotics tested than the strains isolated from inpatient children.The prevalence of vancomycin-resistant Enterococcus faecalis or E.faecium and penicillin-resistant S.pneumoniae was low in either outpatients or inpatient children.S.pneumoniae,β-hemolytic Streptococcus and S.viridans showed high resistance rates to erythromycin.The prevalence of erythromycin-resistant group A β-hemolytic Streptococcus was higher in outpatients than that in inpatient children.The prevalence of β-lactamase-producing H.influenzae showed an overall upward trend in children,but lower in outpatients(45.1％)than in inpatient children(59.4％).The prevalence of carbapenem-resistant Klebsiella pneumoniae(CRKpn),carbapenem-resistant Pseudomonas aeruginosa(CRPae)and carbapenem-resistant Acinetobacter baumannii(CRAba)was 14％,11.7％,47.8％in outpatients,but 24.2％,20.6％,and 52.8％in inpatient children,respectively.The prevalence of multidrug-resistant E.coli,K.pneumoniae,Proteus mirabilis,P.aeruginosa and A.baumannii strains was lower in outpatients than in inpatient children.The prevalence of fluoroquinolone-resistant E.coli,ESBLs-producing K.pneumoniae,ESBLs-producing P.mirabilis,carbapenem-resistant E.coli(CREco),CRKpn,and CRPae was lower in children in outpatients than in inpatient children,but the prevalence of CRAba in 2021 was higher than in inpatient children.Conclusions The distribution of clinical isolates from children is different between outpatients and inpatients.The prevalence of MRSA,ESBL,and CRO was higher in inpatient children than in outpatients.Antibiotics should be used rationally in clinical practice based on etiological diagnosis and antimicrobial susceptibility test results.Ongoing antimicrobial resistance surveillance and prevention and control of hospital infections are crucial to curbing bacterial resistance.