ObjectiveTo construct a prediction model for high responsiveness to short-term aerobic training in patients with Parkinson's disease (PD) based on dual-task gait assessment, and to provide evidence for identifying individuals who are most likely to benefit from such interventions. MethodsA total of 42 patients with PD who visited the outpatient clinic of Tianjin Huanhu Hospital between August 29, 2023 and December 19, 2024 were enrolled. All participants completed a 4-week home-based aerobic cycling training program and underwent dual-task gait assessments pre- and post-training. Patients were classified into high-response group (n = 12) and low-response group (n = 30) according to whether the improvement in gait speed reached the minimal clinically important difference of 0.1 m/s. The clinical validity of this grouping was verified by comparing differences in cardiopulmonary exercise testing parameters and dual-task gait indicators between the two groups pre- and post-training. Based on baseline characteristics, Firth's penalized maximum likelihood logistic regression was applied to construct a predictive model for high responsiveness, and the discriminative performance of the model was assessed preliminarily. ResultsThe high-response group showed significantly greater improvement in gait speed, step length, cadence and the anaerobic threshold to maximal oxygen uptake ratio after training compared with the low-response group (P < 0.05), confirming the clinical validity of the grouping. The baseline anaerobic threshold to maximal oxygen uptake ratio (OR = 3.348), body mass index (OR = 2.229) and age (OR = 0.428) demonstrated certain discriminative ability in the present sample. The area under the receiver operating characteristic curve was 0.831, with an overall prediction accuracy of 81.0%, specificity of 83.3% and sensitivity of 75.0%. Robustness of the model was confirmed via internal validation using the Bootstrap method, which suggested that the results were informative, but further validation was still required. ConclusionThe anaerobic threshold/maximal oxygen uptake ratio, body mass index and age may predict the response to short-term aerobic training in patients with PD.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

Quality control (QC) of biospecimens from oral and maxillofacial tumors patients constitutes a critical foundation for the prevention, diagnosis, treatment, and precision medicine research of these diseases. Biospecimen quality directly governs the discovery and validation of disease biomarkers, the elucidation of pathogenesis, and the efficacy of clinical translation. QC spans the entire biospecimen lifecycle—encompassing collection, processing, storage, transportation, and utilization. Its primary objectives are to ensure sample integrity, reliability, traceability, and consistency, thereby guaranteeing the robustness of research data; the accuracy of molecular subtyping, biomarker identification, and treatment response prediction; and the precision of clinical decision-making. However, current QC frameworks for these biospecimens remain underdeveloped. Drawing on domestic and international technical standards, regulatory guidelines, and recent research advances, this paper elaborates on the importance of implementing a QC management system throughout the biospecimen lifecycle. It focuses on QC methodologies tailored to diverse biospecimen types, examining how standardized sampling procedures, regulated preprocessing workflows, and optimized long-term storage conditions influence sample quality. We aim to provide concrete guidance and a transferable paradigm for establishing standardized QC protocols and an informatics-enabled traceability system specific to oral and maxillofacial tumors. Such efforts are intended to enhance the research value and clinical utility of these biospecimens, furnishing reliable sample resources and technical support for the development of precision diagnostics and therapeutics. Furthermore, we advocate for a dual-track “QC plus Ethics” management framework within biobanks. This approach would reinforce ethical and legal safeguards, establishing a robust barrier to support safe scientific innovation and clinical translation.

With the accelerating aging of the population, the proportion of elderly patients with lung cancer continues to rise, presenting multiple challenges to perioperative management. This paper systematically reviews the clinical characteristics of elderly lung cancer patients. Based on the comprehensive geriatric assessment, it proposes incorporating seven major geriatric syndromes—frailty, delirium, sarcopenia, cognitive impairment, malnutrition, dysphagia, and mood disorders—into the core evaluation system. By integrating multimorbidity management with complication prevention and control, an integrated "geriatric syndrome-multimorbidity-complication" perioperative management model is constructed. Furthermore, this paper outlines stratified intervention strategies for geriatric syndromes, a "five-step" workflow for comorbidity management, and a comprehensive intervention pathway for complications across the preoperative, intraoperative, and postoperative phases. Multidisciplinary team (MDT) collaboration serves as the core mechanism to achieve individualized comprehensive treatment. This paper aims to provide a novel perioperative comprehensive treatment model for elderly lung cancer patients, which is centered on geriatrics, supported by multidisciplinary collaboration, and guided by precision medicine.

Objective:To explore the application value of machine learning prediction model for neural invasion in gallbladder cancer based on enhanced computed tomography (CT) and clinical characteristics.Methods:The retrospective cohort study was conducted. The clinical and imaging data of 502 patients with gallbladder cancer who were admitted to The First Affiliated Hospital of Xinxiang Medical University from January 2010 to June 2024 were collected. There were 171 males and 331 females, aged 65(range, 35?91)years. All patients underwent preoperative abdominal enhanced CT and radical resection. The 502 patients were randomly divided into a training set of 351 cases and a test set of 151 cases at a 7:3 ratio. The training set was used to construct prediction model, and the test set was used to validate prediction model. Observation indicators: (1)neural invasion in gallbladder cancer and influencing factor analysis; (2) construction and validation of machine learning prediction models for neural invasion in gallbladder cancer. Comparison of count data between groups was conducted using the chi-square test. Comparison of ordinal data between groups was conducted using the Mann-Whitney U test. Logistic regression model was performed for univariate and multivariate analyses. Independent influencing factors were incor-porated to construct machine learning models using the standard library modules based on Python 3.9. Receiver operating characteristic (ROC) curves were plotted, and the accuracy, sensitivity, specificity, area under the curve (AUC), precision, F1 score, positive predictive value, negative predic-tive value, and Kappa value were calculated to evaluate the predictive performance of the models. The Delong test was used to assess the differences in AUC among different models in the test set. The Hosmer-Lemeshow test and Brier score were used to evaluate the calibration of the models. Results:(1) Neural invasion in gallbladder cancer and influencing factor analysis. Of the 502 patients with gallbladder cancer, 131 cases had neural invasion, and 371 cases had no neural invasion. Results of multivariate analysis showed that total bilirubin, carcinoembryonic antigen, CA199, CA125, neutrophil-lymphocyte ratio, liver invasion detected by CT, vascular invasion detected by CT, hilar or retroperi-toneal lymph node metastasis detected by CT, and tumor stages T3 and T4 were independent influencing factors for neural invasion in patients with gallbladder cancer [ odds ratios=3.747, 2.395, 3.917, 3.596, 2.805, 2.377, 3.523, 2.774, 5.080, 6.809, 95% confidence interval ( CI) as 1.890?7.430, 1.154?4.971, 2.054?7.472, 1.807?7.155, 1.506?5.225, 1.241?4.553, 1.666?7.449, 1.483?5.189, 2.050?12.589, 2.552?18.168, P<0.05]. (2) Construction and validation of machine learning predic-tion models for neural invasion in gallbladder cancer. Based on the independent influencing factors, seven machine learning models were constructed, including logistic regression, K-nearest neighbors, support vector machine, random forest, decision tree, back-propagation neural network, and gradient boosting machine. The ROC curves of seven machine learning models in the test set were plotted, and the AUC were 0.900(95% CI as 0.851?0.948), 0.741(95% CI as 0.646?0.829), 0.836(95% CI as 0.762?0.895), 0.782(95% CI as 0.701?0.855), 0.839(95% CI as 0.770?0.901), 0.817(95% CI as 0.738?0.887), 0.843(95% CI as 0.770?0.909), respectively. Results of Delong test showed that the logistic regression model had the highest AUC. The sensitivity and specificity of the logistic regression model were 0.868 and 0.805 respectively, indicating the best balance. Results of Hosmer-Lemeshow test showed that the logistic regression model had a good goodness-of-fit ( χ2=5.320, P>0.05). The Brier score of the logistic regression model was relatively low, as 0.168, which verified its calibration advantage. Conclusion:Total bilirubin, carcinoembryonic antigen, CA199, CA125, neutrophil-to-lymphocyte ratio, liver invasion detected by enhanced CT, vascular invasion detected by enhanced CT, hilar or retroperitoneal lymph node metastasis detected by enhanced CT, and tumor stages T3 and T4 are independent influencing factors for nerve invasion in patients with gallbladder cancer. Seven machine learning models are constructed based on enhanced CT and clinical characteristics to predict neural invasion in gallbladder cancer, of which the logistic regression model demonstrates good predictive performance.

Objective To examine the changing prevalence and antimicrobial resistance profiles of Burkholderia cepacia in 52 hospitals across China from 2015 to 2021.Methods A total of 9 261 strains of B.cepacia were collected from 52 hospitals between January 1,2015 and December 31,2021.Antimicrobial susceptibility of the strains was tested using Kirby-Bauer method or automated antimicrobial susceptibility testing systems according to a unified protocol.The results were interpreted according to the breakpoints released in the Clinical & Laboratory Standards Institute(CLSI)guidelines(2023 edition).Results A total of 9 261 strains of B.cepacia were isolated from all age groups,especially elderly patients.The proportion was 11.1％(1 032 strains)in children,significantly lower than the proportion in adults.About half(46.5％,4 310/9 261)of the strains were isolated from patients at least 60 years old and 42.3％(3 919/9 261)of the strains were isolated from young adults.Most isolates(71.1％)were isolated from sputum and respiratory secretions,followed by urine(10.7％)and blood samples(8.1％).B.cepacia isolates were highly susceptible to the five antimicrobial agents recommended in the CLSI M100 document(33rd edition,2023).B.cepacia isolates showed relatively higher resistance rates to meropenem and levofloxacin.However,the resistance rates to ceftazidime,trimethoprim-sulfamethoxazole,and minocycline remained below 8.1％.The percentage of B.cepacia strains resistant to levofloxacin was the highest compared to other antibiotics in any of the three age groups(from 12.4％in the patients＜18 years old to 20.6％in the patients aged 60 years or older).Conclusions B.cepacia is one of the clinically important non-fermenting gram-negative bacteria.Accurate and timely reporting of antimicrobial susceptibility test results and ongoing antimicrobial resistance surveillance are helpful for rational prescription of antimicrobial agents and proper prevention and control of nosocomial infections.

Objective To summarize the changing prevalence of carbapenem resistance in Enterobacterales based on the data of CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021 for improving antimicrobial treatment in clinical practice.Methods Antimicrobial susceptibility testing was performed using a commercial automated susceptibility testing system according to the unified CHINET protocol.The results were interpreted according to the breakpoints of the Clinical & Laboratory Standards Institute(CLSI)M100 31st ed in 2021.Results Over the seven-year period(2015-2021),the overall prevalence of carbapenem-resistant Enterobacterales(CRE)was 9.43％(62 342/661 235).The prevalence of CRE strains in Klebsiella pneumoniae,Citrobacter freundii,and Enterobacter cloacae was 22.38％,9.73％,and 8.47％,respectively.The prevalence of CRE strains in Escherichia coli was 1.99％.A few CRE strains were also identified in Salmonella and Shigella.The CRE strains were mainly isolated from respiratory specimens(44.23±2.80)％,followed by blood(20.88±3.40)％and urine(18.40±3.45)％.Intensive care units(ICUs)were the major source of the CRE strains(27.43±5.20)％.CRE strains were resistant to all the β-lactam antibiotics tested and most non-β-lactam antimicrobial agents.The CRE strains were relatively susceptible to tigecycline and polymyxins with low resistance rates.Conclusions The prevalence of CRE strains was increasing from 2015 to 2021.CRE strains were highly resistant to most of the antibacterial drugs used in clinical practice.Clinicians should prescribe antimicrobial agents rationally.Hospitals should strengthen antibiotic stewardship in key clinical settings such as ICUs,and take effective infection control measures to curb CRE outbreak and epidemic in hospitals.

Objective To characterize the changing species distribution and antibiotic resistance profiles of respiratory isolates in hospitals participating in the CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021.Methods Commercial automated antimicrobial susceptibility testing systems and disk diffusion method were used to test the susceptibility of respiratory bacterial isolates to antimicrobial agents following the standardized technical protocol established by the CHINET program.Results A total of 589 746 respiratory isolates were collected from 2015 to 2021.Overall,82.6％of the isolates were Gram-negative bacteria and 17.4％were Gram-positive bacteria.The bacterial isolates from outpatients and inpatients accounted for(6.0±0.9)％and(94.0±0.1)％,respectively.The top microorganisms were Klebsiella spp.,Acinetobacter spp.,Pseudomonas aeruginosa,Staphylococcus aureus,Haemophilus spp.,Stenotrophomonas maltophilia,Escherichia coli,and Streptococcus pneumoniae.Each microorganism was isolated from significantly more males than from females(P＜0.05).The overall prevalence of methicillin-resistant S.aureus(MRSA)was 39.9％.The prevalence of penicillin-resistant S.pneumoniae was 1.4％.The prevalence of extended-spectrum β-lactamase(ESBL)-producing E.coli and K.pneumoniae was 67.8％and 41.3％,respectively.The overall prevalence of carbapenem-resistant E.coli,K.pneumoniae,Enterobacter cloacae,Pseudomonas aeruginosa,and Acinetobacter baumannii was 3.7％,20.8％,9.4％,29.8％,and 73.3％,respectively.The prevalence of β-lactamase was 96.1％in Moraxella catarrhalis and 60.0％in Haemophilus influenzae.The H.influenzae isolates from children(＜18 years)showed significantly higher resistance rates to β-lactam antibiotics than the isolates from adults(P＜0.05).Conclusions Gram-negative bacteria are still predominant in respiratory isolates associated with serious antibiotic resistance.Antimicrobial resistance surveillance should be strengthened in clinical practice to support accurate etiological diagnosis and appropriate antimicrobial therapy based on antimicrobial susceptibility testing results.