AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

The seed kernel of Momordica cochinchinensis, i.e., Momordicae Semen, is used for medicinal purposes, but to date, no research has been reported on its chemical constituents. In this study, the chemical constituents of Momordicae Semen were investigated for the first time using silica gel column chromatography, semi-preparative HPLC, HR-MS, and NMR. As a result, eight compounds were isolated and identified as: p-hydroxybenzoic acid-7-O-trehaloside(mubeside A, 1), 2,6-dimethoxyphenol-O-β-D-apiosyl-(1→2)-β-D-glucoside(mubeside B, 2), 1-O-p-methoxybenzoyl-1,4-benzenediol-4-O-β-D-apiosyl-(1→2)-β-D-glucoside(mubeside C, 3), 1-O-p-hydroxybenzoyl-1,4-benzenediol-4-O-β-D-apiosyl-(1→2)-β-D-glucoside(mubeside D, 4), gypsogenin-3-O-β-D-galactosyl-(1→2)-β-D-glucuronoside(5), quillaic acid-3-O-β-D-galactosyl-(1→2)-β-D-glucuronoside(6), violanthin(7), and kaempferitrin(8). Compounds 1-4 are new compounds, while compounds 5-8 were isolated from Momordicae Semen for the first time.
Glycosides/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Molecular Structure ; Magnetic Resonance Spectroscopy ; Chromatography, High Pressure Liquid

The chemical components of Carthami Flos were investigated by using macroporous resin, silica gel column chromatography, reversed-phase octadecylsilane(ODS) column chromatography, Sephadex LH-20, and semi-preparative high-performance liquid chromatography(HPLC). The planar structures of the compounds were established based on their physicochemical properties and ultraviolet-visible(UV-Vis), infrared(IR), high-resolution electrospray ionization mass spectrometry(HR-ESI-MS), and nuclear magnetic resonance(NMR) spectroscopic technology. The absolute configurations were determined by comparing the calculated and experimental electronic circular dichroism(ECD). Six flavonoid C-glycosides were isolated from the 30% ethanol elution fraction of macroporous resin obtained from the 95% ethanol extract of Carthami Flos, and identified as saffloquinoside F(1), 5-hydroxysaffloneoside(2), iso-5-hydroxysaffloneoside(3), isosafflomin C(4), safflomin C(5), and vicenin 2(6). Among these, the compounds 1 to 3 were new chalcone C-glycosides. The compounds 1, 2, 4, and 5 could significantly increase the viability of H9c2 cardiomyocytes damaged by oxygen-glucose deprivation/reoxygenation(OGD/R) at a concentration of 50 μmol·L~(-1), showing their good cardioprotective activity.
Glycosides/pharmacology* ; Flowers/chemistry* ; Drugs, Chinese Herbal/pharmacology* ; Carthamus tinctorius/chemistry* ; Chalcones/pharmacology* ; Animals

The mandibular condyle is a critical growth center in craniofacial bone development, especially during postnatal stages. Postnatal condyle osteogenesis requires precise spatiotemporal coordination of growth factor signaling cascades and hierarchical gene regulatory networks. Plagl1, which encodes a zinc finger transcription factor, is a paternally expressed gene. We demonstrate that PLAGL1 is highly expressed in cranial neural crest cell (CNCC)-derived lineage cells in mouse condyles. Using the CNCC-derived lineage-specific Plagl1 knockout mouse model, we evaluate the function of PLAGL1 during postnatal mouse condyle development. Our findings show that PLAGL1 contributes significantly to osteoblast differentiation, and its deficiency impairs osteogenic lineage differentiation, which consequently disrupts mandibular condyle development. Mechanistically, insulin-like growth factor 2 (IGF2) in complex with IGF-binding proteins (IGFBPs) has been identified as the principal PLAGL1 effector responsible for osteogenic regulation during postnatal condyle morphogenesis. Plagl1 deficiency significantly downregulates the IGF2/IGFBP pathway, leading to disordered glucose metabolism, defective extracellular matrix organization, and impaired ossification. Exogenous IGF2 treatment rescues impaired osteoblast differentiation caused by Plagl1 deficiency. In conclusion, the PLAGL1-IGF2 axis is a critical regulator of osteogenesis during mandibular condyle development.
Animals ; Osteogenesis/genetics* ; Insulin-Like Growth Factor II/metabolism* ; Mice ; Transcription Factors/metabolism* ; Mice, Knockout ; Cell Differentiation ; DNA-Binding Proteins/genetics* ; Mandibular Condyle/growth & development* ; Osteoblasts/cytology* ; Signal Transduction ; Neural Crest/cytology*

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective To explore the influence of radiation protection knowledge-attitude-practice (RP-KAP) on occupational stress of radiation workers. Methods A total of 314 radiation workers from five hospitals in Shijiazhuang City were selected as the study subjects using the convenient sampling method. The Chinese version of the "Effort-Reward Imbalance (ERI) Questionnaire" and the "Radiation Protection Knowledge, Attitude, and Practice Questionnaire" were used for investigation. Results The detection rate of occupational stress in ERI model among the radiation workers was 74.5% (234/314). The RP-KAP practice dimension score of the population in the occupational stress group was lower than that in the non-occupational stress group (P<0.05). The results of binary logistic regression analysis showed that radiation workers with lower RP-KAP practice dimension score had a higher risk of occupational stress (P<0.01), and the risks of occupational stress among population of interventional radiology group and radiotherapy group were higher than that of X-ray diagnosis group and nuclear medicine group (both P<0.05), after controlling for confounding factors such as gender, age, type of work, professional title, daily working hours, weekly working hours and regular vacation. Conclusion RP-KAP is the influencing factor of occupational stress in the radiation workers. To improve the radiation workers' knowledge of radiation protection, protection awareness and compliance with protective behavior can effectively reduce or even eliminate occupational stress.