Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Quality control (QC) of biospecimens from oral and maxillofacial tumors patients constitutes a critical foundation for the prevention, diagnosis, treatment, and precision medicine research of these diseases. Biospecimen quality directly governs the discovery and validation of disease biomarkers, the elucidation of pathogenesis, and the efficacy of clinical translation. QC spans the entire biospecimen lifecycle—encompassing collection, processing, storage, transportation, and utilization. Its primary objectives are to ensure sample integrity, reliability, traceability, and consistency, thereby guaranteeing the robustness of research data; the accuracy of molecular subtyping, biomarker identification, and treatment response prediction; and the precision of clinical decision-making. However, current QC frameworks for these biospecimens remain underdeveloped. Drawing on domestic and international technical standards, regulatory guidelines, and recent research advances, this paper elaborates on the importance of implementing a QC management system throughout the biospecimen lifecycle. It focuses on QC methodologies tailored to diverse biospecimen types, examining how standardized sampling procedures, regulated preprocessing workflows, and optimized long-term storage conditions influence sample quality. We aim to provide concrete guidance and a transferable paradigm for establishing standardized QC protocols and an informatics-enabled traceability system specific to oral and maxillofacial tumors. Such efforts are intended to enhance the research value and clinical utility of these biospecimens, furnishing reliable sample resources and technical support for the development of precision diagnostics and therapeutics. Furthermore, we advocate for a dual-track “QC plus Ethics” management framework within biobanks. This approach would reinforce ethical and legal safeguards, establishing a robust barrier to support safe scientific innovation and clinical translation.

With the accelerating aging of the population, the proportion of elderly patients with lung cancer continues to rise, presenting multiple challenges to perioperative management. This paper systematically reviews the clinical characteristics of elderly lung cancer patients. Based on the comprehensive geriatric assessment, it proposes incorporating seven major geriatric syndromes—frailty, delirium, sarcopenia, cognitive impairment, malnutrition, dysphagia, and mood disorders—into the core evaluation system. By integrating multimorbidity management with complication prevention and control, an integrated "geriatric syndrome-multimorbidity-complication" perioperative management model is constructed. Furthermore, this paper outlines stratified intervention strategies for geriatric syndromes, a "five-step" workflow for comorbidity management, and a comprehensive intervention pathway for complications across the preoperative, intraoperative, and postoperative phases. Multidisciplinary team (MDT) collaboration serves as the core mechanism to achieve individualized comprehensive treatment. This paper aims to provide a novel perioperative comprehensive treatment model for elderly lung cancer patients, which is centered on geriatrics, supported by multidisciplinary collaboration, and guided by precision medicine.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveTo construct a prediction model for high responsiveness to short-term aerobic training in patients with Parkinson's disease (PD) based on dual-task gait assessment, and to provide evidence for identifying individuals who are most likely to benefit from such interventions. MethodsA total of 42 patients with PD who visited the outpatient clinic of Tianjin Huanhu Hospital between August 29, 2023 and December 19, 2024 were enrolled. All participants completed a 4-week home-based aerobic cycling training program and underwent dual-task gait assessments pre- and post-training. Patients were classified into high-response group (n = 12) and low-response group (n = 30) according to whether the improvement in gait speed reached the minimal clinically important difference of 0.1 m/s. The clinical validity of this grouping was verified by comparing differences in cardiopulmonary exercise testing parameters and dual-task gait indicators between the two groups pre- and post-training. Based on baseline characteristics, Firth's penalized maximum likelihood logistic regression was applied to construct a predictive model for high responsiveness, and the discriminative performance of the model was assessed preliminarily. ResultsThe high-response group showed significantly greater improvement in gait speed, step length, cadence and the anaerobic threshold to maximal oxygen uptake ratio after training compared with the low-response group (P < 0.05), confirming the clinical validity of the grouping. The baseline anaerobic threshold to maximal oxygen uptake ratio (OR = 3.348), body mass index (OR = 2.229) and age (OR = 0.428) demonstrated certain discriminative ability in the present sample. The area under the receiver operating characteristic curve was 0.831, with an overall prediction accuracy of 81.0%, specificity of 83.3% and sensitivity of 75.0%. Robustness of the model was confirmed via internal validation using the Bootstrap method, which suggested that the results were informative, but further validation was still required. ConclusionThe anaerobic threshold/maximal oxygen uptake ratio, body mass index and age may predict the response to short-term aerobic training in patients with PD.

The recombinant human thyroid-stimulating hormone (rhTSH) can be used for differentiated thyroid cancer (DTC) preparation before ¹³¹I therapy, and follow-up. Since its approval by the American Food and Drug Administration (FDA) in 1998, rhTSH has been clinically used in European countries, the United States, and other countries for nearly 30 years. In April 2024, China’s first independently developed rhTSH agent was approved. Based on clinical experience and evidence from domestic and international studies, an expert consensus on the application of rhTSH has been developed following thorough consultations among experts. The consensus offers evidence-based recommendations to guide the appropriate use of rhTSH in clinical practice.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

OBJECTIVES: To study the expression of the transcription factor GATA1 in bronchial asthma (referred to as asthma) and its effect on the expression level of the asthma susceptibility gene orosomucoid 1-like protein 3 (ORMDL3), along with the underlying molecular mechanisms. METHODS: The study included 28 cases of moderate asthma, 46 cases of severe asthma, and 12 normal controls from the Gene Expression Omnibus (GEO) database. The mRNA expression levels of GATA1 and ORMDL3 were analyzed among the asthma patients and the normal controls, including their correlation. The pGL-185/58 plasmid was co-transfected with GATA1 gene siRNA (si-GATA1 group) and siRNA negative control (si-control group) into BEAS-2B cells. Bioinformatics methods were used to predict GATA1 binding sites in the promoter region of the ORMDL3 gene. The dual-luciferase reporter gene system was employed to assess the promoter activity of ORMDL3, while real-time quantitative PCR and Western blotting were used to measure the mRNA and protein expression levels of GATA1 and ORMDL3. Chromatin immunoprecipitation (ChIP) assays were conducted to determine whether GATA1 binds to the promoter region of ORMDL3. RESULTS: The expression levels of GATA1 and ORMDL3 mRNA were significantly higher in the severe asthma group compared to the normal control group (P<0.001). Positive correlations were observed between GATA1 mRNA and ORMDL3 mRNA expression levels in both the moderate and severe asthma groups (r=0.636 and 0.341, respectively; P<0.05). In BEAS-2B cells, the dual-luciferase reporter assay revealed that ORMDL3 promoter luciferase activity, as well as ORMDL3 mRNA and protein expression levels, were lower in the si-GATA1 group compared to the si-control group (P<0.05). ChIP assay results demonstrated that GATA1 could bind to the promoter region of ORMDL3. CONCLUSIONS The expression of GATA1 is increased in asthma patients, which may regulate the promoter activity and expression of the asthma susceptibility gene ORMDL3.
Humans ; Asthma/etiology* ; GATA1 Transcription Factor/analysis* ; Membrane Proteins/physiology* ; Male ; Female ; Promoter Regions, Genetic ; Child ; Transcription, Genetic ; Gene Expression Regulation ; Adolescent ; RNA, Messenger/analysis*

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.