It is very limited that the benefit of perioperative chemotherapy in early non-small cell lung cancer (NSCLC), and the 5-year survival rate is only 5% higher than surgery. Antibodies that block programmed cell death protein 1/programmed death-ligand 1 significantly improve the survival of advanced NSCLC. The value of immunotherapy in early NSCLC is also being explored. This paper firstly summarized and analyzed the progress of immunotherapy in the perioperative period of NSCLC. Secondly, the safety and feasibility of surgical resection after neoadjuvant immunotherapy were discussed. Finally, the clinical value of different therapeutic efficacy prediction indicators was summarized, in order to clarify the current status of immunotherapy in the perioperative period, so as to improve the clinical benefits of early NSCLC patients.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

Numerous c-mesenchymal-epithelial transition(c-MET)inhibitors have been reported as potential anticancer agents.However,most fail to enter clinical trials owing to poor efficacy or drug resistance.To date,the scaffold-based chemical space of small-molecule c-MET inhibitors has not been analyzed.In this study,we constructed the largest c-MET dataset,which included 2,278 molecules with different struc-tures,by inhibiting the half maximal inhibitory concentration(IC50)of kinase activity.No significant differences in drug-like properties were observed between active molecules(1,228)and inactive mol-ecules(1,050),including chemical space coverage,physicochemical properties,and absorption,distri-bution,metabolism,excretion,and toxicity(ADMET)profiles.The higher chemical diversity of the active molecules was downscaled using t-distributed stochastic neighbor embedding(t-SNE)high-dimensional data.Further clustering and chemical space networks(CSNs)analyses revealed commonly used scaffolds for c-MET inhibitors,such as M5,M7,and M8.Activity cliffs and structural alerts were used to reveal"dead ends"and"safe bets"for c-MET,as well as dominant structural fragments consisting of pyr-idazinones,triazoles,and pyrazines.Finally,the decision tree model precisely indicated the key structural features required to constitute active c-MET inhibitor molecules,including at least three aromatic het-erocycles,five aromatic nitrogen atoms,and eight nitrogen-oxygen atoms.Overall,our analyses revealed potential structure-activity relationship(SAR)patterns for c-MET inhibitors,which can inform the screening of new compounds and guide future optimization efforts.

Obesity, as a chronic recurrent disease, has become a major public health challenge in China. To implement the requirements of the Healthy China Initiative (2019—2030), under domestic guidelines or consensus statements on overweight and obesity, and in alignment with the latest scientific advances globally, the Quality control protocol for adult overweight and obesity screening in health management (examination) institutions (2025 edition) was developed. This protocol was drafted by the Health Management Center of Shanghai Changzheng Hospital and formulated through multiple rounds of deliberation by experts in China’s health examination quality control field. The protocol establishes unified standards for screening facilities, personnel qualifications, and measurement or testing procedures. It defines specific screening items, outlines a standardized screening pathway, and sets requirements for the final medical review, ensuring the scientific validity, effectiveness, and safety of the screening process. The implementation of this protocol will enhance the consistency of weight management practices for adults across health examination institutions and strengthen the quality control of overweight and obesity screening programs.

Objective:To analyze the clinical features and risk factors for renal injury in children with antineutrophil cytoplasmic antibody (ANCA)-positive IgA vasculitis (IgAV).Methods:A case-control study was conducted. Seventy-two ANCA-positive IgAV children hospitalized at the Children′s Hospital of Chongqing Medical University from January 2017 to October 2022 were enrolled as the ANCA-positive group. Propensity score matching (1∶4) using the nearest neighbor was performed with age and gender as covariate, and 288 cases ANCA-negative IgAV children were included as the ANCA-negative group. Patients with renal injury were named ANCA-positive IgAV nephritis (IgAVN) group and ANCA-negative IgAVN group, respectively. The ANCA-positive IgAVN group was further divided into myeloperoxidase (MPO) group and proteinase 3 (PR3) group based on the type of ANCA. Clinical data including manifestations, laboratory tests, renal injury, and prognosis were collected. Comparisons between groups were performed using independent sample t-tests, Mann-Whitney U tests, χ2 tests, or Fisher′s exact tests. Kaplan-Meier curves were used to assess differences in the time to renal injury onset, and multivariate logistic regression was performed to identify independent risk factors for renal injury. Results:Among the 72 ANCA-positive IgAV children (41 males, 31 females, age of 7.7 (5.3, 11.2) years), no significant difference in age or gender was observed compared to the ANCA-negative group (both P>0.05). The ANCA-positive group had higher IgM levels, a higher incidence of recurrent rash, and shorter thrombin time (all P<0.05). Among children with renal injury, the ANCA-positive group showed significant differences in the incidence of hematuria, clinical classification, and grade A prognosis compared to the ANCA-negative group (all P<0.05), but no difference was found in the time to renal involvement onest or renal pathology (all P>0.05). The MPO group had higher rates of microscopic hematuria, gross hematuria, acute renal insufficiency, glomerular sclerosis, and grade B prognosis compared to the ANCA-negative IgAVN group (all P<0.05), with a later onset of renal involvement ( P<0.05). Elevated serum creatinine ( OR=1.08, 95% CI 1.03-1.14) and shortened thrombin time ( OR=0.71, 95% CI 0.55-0.92) were independent risk factors for renal injury in ANCA-positive IgAV children (all P<0.05). Conclusions:Children with ANCA-positive IgAV are more likely to experience recurrent rash. MPO-ANCA-positive IgAVN children have higher risks of hematuria, acute kidney injury and glomerular sclerosis, with later-onset but poorer renal prognosis compared to ANCA-negative IgAVN children. Higher serum creatinine levels and shorter thrombin time may be associated with renal injury in children with ANCA-positive IgAV.

Objective:To obtain a prevalent respiratory syncytial virus (RSV) clinical isolate in Beijing and analyze the genotype and biological characteristics of the strain.Methods:A nasopharyngeal secretion specimen was collected from a child with RSV infection in Beijing in 2023 and used for viral isolation. Viral nucleic acid was amplified using qRT-PCR. The isolated virus was identified by transmission electron microscopy, indirect immunofluorescence assay, and plaque formation assay. A phylogenetic analysis was conducted based on the whole-genome sequencing results. Virus titers were determined, and replication characteristics were analyzed. The efficacy of the isolated strain for in vitro screening of antiviral drugs was validated. Results:A clinical RSV isolate, named hRSV/C-Tan/BJ 202301, was successfully isolated, which could form syncytia in Hep-2 cells. Spherical, filamentous, and irregular virus particles were observed by electron microscopy. Immunofluorescence detection showed green fluorescence in Hep-2 cells, and plaque assay showed round plaques, which were similar to the Long strain in morphology. Genomic sequence analysis showed that it belonged to ON1 genotype. It exhibited similar cell growth kinetics characteristics with the Long strain and could be used for antiviral drug screening in vitro. Conclusions:In this study, one RSV strain is successfully isolated and identified. The biological characteristics and the phylogenetic relationship of this strain reflect the characteristics of the circulating strains in Beijing, which provides experimental material for RSV vaccine development and antiviral drug screening in China.

In protein engineering, while computational models are increasingly used to predict mutation effects, their evaluations primarily rely on high-throughput deep mutational scanning (DMS) experiments that use surrogate readouts, which may not adequately capture the complex biochemical properties of interest. Many proteins and their functions cannot be assessed through high-throughput methods due to technical limitations or the nature of the desired properties, and this is particularly true for the real industrial application scenario. Therefore, the desired testing datasets, will be small-size (∼10-100) experimental data for each protein, and involve as many proteins as possible and as many properties as possible, which is, however, lacking. Here, we present VenusMutHub, a comprehensive benchmark study using 905 small-scale experimental datasets curated from published literature and public databases, spanning 527 proteins across diverse functional properties including stability, activity, binding affinity, and selectivity. These datasets feature direct biochemical measurements rather than surrogate readouts, providing a more rigorous assessment of model performance in predicting mutations that affect specific molecular functions. We evaluate 23 computational models across various methodological paradigms, such as sequence-based, structure-informed and evolutionary approaches. This benchmark provides practical guidance for selecting appropriate prediction methods in protein engineering applications where accurate prediction of specific functional properties is crucial.