OBJECTIVE To establish a Chinese drug-related problem （DRP） classification system applicable to pharmacist-led pharmaceutical care in China， providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system， including literature review and analysis， comparison of existing classification systems， refinement of classification items and framework development， two rounds of standard case validation， expert discussion， and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ， assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem（including potential problems）， DRP evaluation， cause （including possible causes of potential problems）， intervention， acceptance of intervention and DRP status]， with 24 primary codes and 96 secondary codes. In the first round of case validation， κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round， κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system， positive ratings （“strongly agree” or “agree”） exceeded 85% for all items. Specifically， positive ratings for“the classification system can provide appropriate category selection”，“ the classification system is comprehensive”，“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability， providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.

The promulgation of the Technical Specifications for Clinical Use of Blood (2025 Edition) signifies that China's clinical blood transfusion management has transitioned from mere technical operations to a new stage centered on patient blood management (PBM). Through an in-depth comparison of the new and old specifications, this paper analyzes the core transformations regarding conceptual reconstruction, legal alignment, technological upgrades, and closed-loop management. The new specifications establish PBM principles, reinforce legal safeguards for informed consent and emergency treatment, and construct a comprehensive, refined quality control system by specifying compatibility testing standards and introducing a post-transfusion evaluation system. Medical institutions should seize this opportunity to update management protocols and information systems, deepen multidisciplinary collaboration, and drive the profound transformation of clinical blood use from focusing solely on safety assurance to placing equal emphasis on science and value.

Objective To explore the effects of CYP2C19, CYP2C9 and CYP3A5 genotypes on the plasma concentration of voriconazole in children. Methods Collected blood samples from 50 hospitalized children with invasive fungal infections who received intravenous voriconazole from January 2020 to December 2020. High performance liquid chromatography was used to detect the blood trough concentration of voriconazole, and the time-of-flight mass spectrometry detection system was used to detect the genotypes of CYP2C19, CYP2C9 and CYP3A5, and the effects of children’s genotyping on the plasma concentration, efficacy and adverse reactions of voriconazole were analyzed. Results The total effective rate of 50 children with IFI was 84% （42/50 cases） after voriconazole treatment. The incidence of adverse reactions was 20% （10/50 cases）. The measured plasma concentration of voriconazole ranged from 0.56~7.62 μg/ml. Combined with the different mutation types of CYP2C19 gene loci, three metabolic activities were produced: fast, medium and slow, and the test results showed that there were 16 cases of fast metabolism, 27 cases of intermediate metabolism and 7 cases of slow metabolism. There was a significant difference in plasma concentrations among the three groups （F=15.359, P<0.001）, and the drug concentrations in the fast metabolic group were significantly lower than those in the intermediate metabolic and slow metabolic groups. The mutations of CYP2C9 and CYP3A5 had no significant effect on the plasma concentrations of the drugs, which were （F=2.213, P=0.086 and F=0.757, P=0.475）. Conclusion Voriconazole had significant efficacy in the treatment of invasive fungal infections in children, and the adverse reactions were mild. CYP2C19 genotype was significantly related to the rate of drug metabolism and was an important factor affecting blood drug concentration, the detection of drug concentration and genotype of voriconazole was helpful to adjust the effective drug dose clinically and would achieve more scientific and individualized treatment.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

ObjectiveTo investigate the clinical characteristics and risk factors of Mycoplasma pneumoniae pneumonia （MPP） in children based on a dual classification integrating imaging features and clinical severity. MethodsMedical records of 2 054 pediatric patients with MPP were retrospectively analyzed. The cohort was stratified into severe consolidation （n=253）， severe non-consolidation （n=118）， non-severe consolidation （n=393）， and non-severe non-consolidation groups （n=1 290） based on clinical and radiological findings. Inter group data and characteristics were compared and multiple regression analysis was conducted to construct a prediction model for severe consolidation group. ResultsSignificant differences were observed among the groups in terms of age， duration of fever， length of hospital stay， presence of pulmonary rales， inflammatory markers ［C-reactive protein （CRP） and lactate dehydrogenase （LDH）］， the use of hormones， and bronchoscopic treatment （all P < 0.05）. Compared with the severe non-consolidation group， non-severe consolidation group， and non-severe non-consolidation group， children in severe consolidation group exhibited the longest duration of fever ［8 （6， 11） days vs 6 （2， 9）， 7 （6， 9） and 6 （3， 8） days， respectively］ and the longest length of hospital stay ［7 （5， 8） days vs 6 （5， 8）， 6 （5， 8） and 6 （4， 7） days， respectively］. They also had the highest incidence of reduced breath sounds ［34 cases （13.4%） vs 2 cases （1.7%）， 29 cases （7.4%） and 13 cases （1.0%）， respectively］ and a substantially higher rate of coinfections， particularly viral infections ［63 cases （24.9%） vs 23 cases （19.5%）， 60 cases （15.3%） and 190 cases （14.7%）， respectively］. Multivariate analysis indicated that the independent risk factors for severe MPP （SMPP） were age > 4.5 years， length of hospital stay > 6.5 days， reduced breath sounds， neutrophil-to-lymphocyte ratio （NLR） > 1.66， LDH > 370.5 U/L， CRP > 9.5 mg/L， and coinfection with viruses. Reduced breath sounds （OR = 5.58， 95% CI： 2.45 - 12.69） and coinfection with bacteria （OR = 3.11， 95% CI： 1.43 - 6.75） were identified as the most significant risk factors for pulmonary consolidation in non-severe MPP children. Additionally， reduced breath sounds， coinfection with viruses， LDH > 365.5 U/L， and CRP > 32.1 mg/L were risk factors for severe pneumonia in children with pulmonary consolidation. For non-consolidation MPP children， the presence of pulmonary dry rales （OR = 2.28， 95% CI： 1.46 - 3.56） was the primary independent risk factor for the development of severe pneumonia. ConclusionThe chest imaging findings of MPP are associated with clinical severity， and the risk factor model constructed based on this imaging-clinical classification can assist in achieving precise hierarchical diagnosis and treatment in clinical practice.

Objective To preliminarily investigate the safety and efficacy of donor pancreas needle biopsy in simultaneous pancreas-kidney transplantation. Methods Clinical data of 7 cases undergoing donor pancreas biopsy were collected retrospectively. All cases underwent donor pancreas biopsy before or during simultaneous pancreas-kidney transplantation. Frozen section or paraffin sectioning techniques were used for tissue preparation, and hematoxylin-eosin and Masson staining were performed to histologically evaluate the donor pancreas. The quality of donor pancreas was comprehensively assessed by combining histological findings with the donor's clinical data. Postoperative follow-up data of 5 simultaneous pancreas-kidney transplant recipients were collected to summarize the safety of donor pancreas biopsy and the prognosis of transplant recipients. Results The 7 pancreas donors were aged 28 to 62 years, with a body mass index ranging from 20.76 to 27.68 kg/m². Liver ultrasound indicated fatty liver in 3 cases, while pancreatic ultrasound did not reveal any significant abnormalities. Among them, biopsy was performed on 2 donors after completion of pancreatic procurement and processing, and the frozen section histology showed moderate acute pancreatitis changes (edema of acinar cells, necrosis and inflammatory cell infiltration). Combined with a serum amylase level elevated more than 3 times the upper limit of normal value, these two donor pancreases were finally discarded. The remaining 5 cases underwent biopsy immediately after pancreatic vascular anastomosis during simultaneous pancreas-kidney transplantation, and histological evaluation was performed on paraffin-embedded sections. No biopsy-related complications (such as bleeding, pancreatic fistula, etc.) occurred after transplantation. One recipient died of severe infection 2 months after transplantation, while the other 4 recipients were followed up for more than 5 years, with well-functioning transplant kidneys and pancreases. Conclusions Donor pancreas biopsy is relatively safe, and the risk of biopsy-related complications after transplantation is controllable. Comprehensive assessment of donor pancreas quality by combining histological evaluation with the donor's clinical indicators is conducive to improving the accuracy of donor pancreas selection and organ utilization.

Driven by the growing practical need to accelerate drug development and the continuous innovation of trial design in recent years， the number of protocol amendments during clinical trials have gradually increased， and the changed contents have become more flexible and complex， which significantly heightens the difficulty of ethical review on amendments. Against this backdrop， it is of great importance to fully leverage the role and responsibilities of ethics committees， effectively control clinical trial risks， and ensure subject safety. This paper analyzed development trends of protocol amendments in recent years， sorted out requirements for protocol amendments in Chinese regulations and guiding principles， and examined difficulties of amendment ethical review in practical work. Based on these， targeted strategies and recommendations were proposed， namely， strengthening the integration with scientific review， enhancing the formal review， adjusting the scope of review according to approval notifications， and adopting appropriate review methods， with a view to providing insights and references for the management of the amendment ethical review in drug clinical trials.

BackgroundAnxiety exhibits a rising prevalence among college students. Investigating the mechanisms through which family function relates to anxiety and examining the moderating role of emotion regulation strategies within this context hold substantial implications for promoting mental health among college students. However， existing research has not sufficiently elucidated the complex interplay among family function， emotion regulation， and anxiety among college students. Further research is warranted to clarify the underlying mechanisms linking family function to anxiety outcomes and to examine the potential moderating role of emotion regulation strategies in this causal pathway. ObjectiveTo explore the relationship between family function and anxiety among lower-grade college students， and to validate the moderating role of emotion regulation strategies in this relationship， thereby offering evidence-based insights for anxiety reduction interventions in this population. MethodsIn March 2023， a total of 1 980 first- and second-year students from a comprehensive university in Shanghai were selected using the cluster sampling method. A self-designed demographic questionnaire， the Emotion Regulation Questionnaire （ERQ）， the Family Adaptability and Cohesion Evaluation Scale Ⅱ-Chinese Version （FACES Ⅱ-CV）， and the Symptom Checklist-90 （SCL-90） were utilized for assessment. Pearson correlation analysis and Spearman correlation analysis were employed to test the correlations of each variable. Hierarchical linear regression analysis was conducted to certify the moderating role of emotion regulation strategies in the relationship between family function and anxiety. ResultsCompared with female students， male students scored significantly lower on ERQ cognitive reappraisal （t=-5.793， P<0.01） but significantly higher on ERQ expressive suppression （t=8.359， P<0.01）. For lower-grade college students， scores on adaptability and cohesion subscales of FACES Ⅱ-CV showed a positive association with cognitive reappraisal in ERQ （r=0.251， 0.302， P<0.01）， while simultaneously displaying negative correlations with both expressive suppression in ERQ （r=-0.113， -0.154， P<0.01） and anxiety in SCL-90 （r=-0.243， -0.202， P<0.01）. Notably， anxiety scores in SCL-90 were inversely related to cognitive reappraisal scores in ERQ （r=-0.159， P<0.01） but directly associated with expressive suppression scores in ERQ （r=0.171， P<0.01）. Hierarchical regression analysis indicated that cognitive reappraisal significantly moderated the relationship between family cohesion and anxiety （β=-0.421， P<0.01）. ConclusionThe cognitive reappraisal strategy serves as a moderator in the relationship between family cohesion and anxiety， potentially mitigating the escalation of anxiety levels associated with family dysfunction. ［Funded by Science and Technology Development Fund of Shanghai Pudong New Area （number， PKJ2023-Y21）］

ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.