ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To analyze the current status of human papillomavirus(HPV) vaccination among women aged 9-45 years in Chaoyang District of Beijing, and to provide a basis for further promoting population vaccination.Methods The HPV vaccination(including HPV2, HPV4 and HPV9) data among women aged 9-45 in Chaoyang District of Beijing as of December 31, 2024 in Beijing's immunization planning information system were derived, and the estimated HPV vaccination rate in Beijing's female population was obtained by data analysis.Results By December 31, 2024, the estimated first dose vaccination rate of HPV vaccine among women aged 9-45 years in Chaoyang District of Beijing had been 50. 88%, and the estimated full dose vaccination rate was 48. 66%. The estimated coverage of the first dose and the full dose among girls aged9-15 years was 4. 62% and 2. 87%, respectively. The estimated full dose coverage rate was 62. 73% in subdistrict and 37. 33%in district.Conclusion The estimated HPV vaccination rate of 9-45-year-old women in Chaoyang District of Beijing is higher than that in other regions of China, but the estimated vaccination rate of adolescent women aged 9-15 is significantly lower than that of other age groups. It is recommended to improve the HPV vaccination rate through multiple joint efforts to achieve the action goal of accelerating the elimination of cervical cancer in China and the world as soon as possible.

OBJECTIVE To provide a reference for anticoagulant therapy and pharmaceutical care of the breast cancer patient with pulmonary thromboembolism （PTE） accompanied by multiple comorbidities. METHODS Clinical pharmacists participated in the diagnosis and treatment of a breast cancer patient with PTE accompanied by severe thrombocytopenia and suspected antiphospholipid syndrome secondary to systemic lupus erythematosus， and provided personalized pharmaceutical care as developing individualized anticoagulation plans and monitoring patient bleeding. For the occurrence of PTE， the clinical pharmacist recommended stopping all breast cancer drugs. The clinical pharmacists also cleared that severe thrombocytopenia was not the absolute contraindication for anticoagulant treatment and suggested fondaparinux sodium as the initial anticoagulation regimen. Further， warfarin was recommended as the long-term anticoagulation regimen with a recommended treatment course of at least 3-6 months by the clinical pharmacists. Whether to continue indefinite anticoagulation therapy was based on the results of the antiphospholipid antibodies after 12 weeks combined with the tumor treatment regimen. RESULTS The physicians adopted the advice of the clinical pharmacists. After treatment， the patient’s blood phlegm and anhelation disappeared and the platelets returned to normal. The patient was allowed to be discharged with medication. CONCLUSIONS Taking the “anticoagulation-bleeding” as the starting point， the clinical pharmacists develop individualized medication plans for patients so as to ensure the safety and effectiveness of medication in the patient by providing pharmaceutical care， such as analyzing the causal relationship between breast cancer treatment-related drugs and PTE， assessing the risk of bleeding and thrombus recurrence， and monitoring patients’ bleeding symptoms and signs and coagulation indicators.

[Objective] To explore the relationship between anti-HEV antibody reactivity rate and different age groups in Chinese voluntary blood donors by Meta-analysis. [Methods] Literatures on anti-HEV IgG reactivity rate and anti-HEV IgM reactivity rate of voluntary blood donors in different age groups in China were searched from China National Knowledge Infrastructure (CNKI), PubMed and Wanfang Medicine database, with a search time from January 1, 2007 to December 31, 2023. Risk difference (RD) was selected as the effect size after grouping the included literature according to age, and meta-analysis was performed using Review Manager 5.3 software. [Results] A total of 17 articles were included, among which 16 were about anti-HEV IgG and 15 about anti-HEV IgM. Based on different age grouping methods, they were divided into two groups. The age groups of group A were divided into ≤ 20 years old, 21-30 years old, 31-40 years old, 41-50 years old and >50 years old. The age groups of group B were divided into 18-25 years old, 26-35 years old, 36-45 years old, and ≥46 years old. The pooled results of Meta-analysis showed that the RD value of anti-HEV IgG reactivity rate in group A was 22.92% [95% CI (19.02%, 26.82%)], and the RD value of anti-HEV IgM reactivity rate was 0.67% [95% CI (0.51%, 0.82%)]. The RD value of anti-HEV IgG reactivity rate in group B was 33.03% [95% CI (28.01%, 38.05%)], and the RD value of anti-HEV IgM reactivity rate was 1.13% [95% CI (1.05%, 1.21%)]. The results of subgroup analysis showed that in both group A and B, the anti-HEV IgG reactivity rate in voluntary blood donors increased with age. In group A, no increase in the reactivity rate of anti-HEV IgM with age was found in voluntary blood donors. In group B, the anti-HEV IgM reactivity rate increased with age. Further analysis showed that in the two groups of A and B, the anti-HEV IgM reactivity rate increased with age in areas where the anti-HEV IgM reactivity rate was greater than 1%. [Conclusion] The anti-HEV IgG reactivity rate and anti-HEV IgM reactivity rate in voluntary blood donors increased with age.

In maintaining normal function and activation processes, glycolysis, lipid metabolism, and amino acid metabolism play key roles in the energy demand of platelets. In the resting state, platelets primarily rely on glycolysis and aerobic oxidation to generate energy. Upon activation, platelets preferentially utilize glycolysis, as it can more rapidly provide the required ATP. In addition to glycolysis, platelets can also utilize glycogen and fatty acids as additional energy sources. The ATP provided by fatty acid oxidation is crucial for platelet activation. Additionally, during platelet storage, distinctive changes in energy metabolism occur. In the early stages of storage, platelets primarily rely on glycolysis and the pentose phosphate pathway (PPP) to generate energy. In the mid-storage phase, there is an increase in tricarboxylic acid cycle (TCA) metabolism. In the later stages of storage, cellular metabolism gradually declines. The regulation and flexibility of these metabolic pathways play a critical role in the survival and function of platelets in different states.

OBJECTIVE To provide reference for improving the pre-prescription review system and reducing the occurrence of medication error by analyzing the drug-related problems （DRPs） in the pre-prescription review orders of pediatric outpatient clinics using the Pharmaceutical Care Network Europe （PCNE） classification system. METHODS The data of pre-prescription review orders were retrospectively collected from outpatient department of Shanghai Children’s Medical Center， Shanghai Jiao Tong University School of Medicine from July 2022 to June 2023； DRPs in the pre-prescription review orders were classified and summarized by using the PCNE classification system （version 9.1）， and then analyzed in terms of types and causes of issues， and the acceptance of interventions. RESULTS A total of 66 017 DRPs orders were included， involving 41 165 patients. The proportion of DRPs orders in children aged ≤5 years old was the highest （58.25%）， followed by children aged 6-12 years old （33.52%）； the department with the highest proportion of DRPs was internal medicine of pediatrics department （71.41%）； the department with the highest incidence of DRPs was thoracic surgery department （9.73%）； top three drug categories of DRPs orders were systemic anti- infective drugs （25.26%）， Chinese patent medicines （24.74%） and respiratory drugs （22.38%）. Referring to PCNE classification system， the types of DRPs mainly focused on treatment safety （64.86%）； the reasons of DRPs orders mainly focused on dose selection （82.09%）， of which 41.26% were due to excessive drug dosage； 92.13% of interventions could be accepted and fully executed by doctors. CONCLUSIONS DRPs orders identified by the pre-prescription review system can be effectively analyzed by using PCNE classification system. Pharmacists should focus on medication use in children aged ≤5 years old， update and develop personalized prescription review rules timely， and meet the rational needs of clinical medication for children.

OBJECTIVE To provide a reference for anticoagulant therapy and pharmaceutical care of the breast cancer patient with pulmonary thromboembolism （PTE） accompanied by multiple comorbidities. METHODS Clinical pharmacists participated in the diagnosis and treatment of a breast cancer patient with PTE accompanied by severe thrombocytopenia and suspected antiphospholipid syndrome secondary to systemic lupus erythematosus， and provided personalized pharmaceutical care as developing individualized anticoagulation plans and monitoring patient bleeding. For the occurrence of PTE， the clinical pharmacist recommended stopping all breast cancer drugs. The clinical pharmacists also cleared that severe thrombocytopenia was not the absolute contraindication for anticoagulant treatment and suggested fondaparinux sodium as the initial anticoagulation regimen. Further， warfarin was recommended as the long-term anticoagulation regimen with a recommended treatment course of at least 3-6 months by the clinical pharmacists. Whether to continue indefinite anticoagulation therapy was based on the results of the antiphospholipid antibodies after 12 weeks combined with the tumor treatment regimen. RESULTS The physicians adopted the advice of the clinical pharmacists. After treatment， the patient’s blood phlegm and anhelation disappeared and the platelets returned to normal. The patient was allowed to be discharged with medication. CONCLUSIONS Taking the “anticoagulation-bleeding” as the starting point， the clinical pharmacists develop individualized medication plans for patients so as to ensure the safety and effectiveness of medication in the patient by providing pharmaceutical care， such as analyzing the causal relationship between breast cancer treatment-related drugs and PTE， assessing the risk of bleeding and thrombus recurrence， and monitoring patients’ bleeding symptoms and signs and coagulation indicators.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Objective To investigate the safety, economic benefits and psychological effects of day breast conserving surgery for breast cancer. Methods The demographic data and clinical data of breast cancer patients undergoing day (day surgery group) and ward (ward surgery group) breast conserving surgeries in West China Hospital of Sichuan University from March 2020 to June 2021 were retrospectively collected; the demographic data, clinical data, medical and related transportation costs, and preoperative and postoperative BREAST-Q scores of breast cancer patients undergoing day (day surgery group) and ward (ward surgery group) breast conserving surgery in West China Hospital of Sichuan University from June 2021 to June 2022 were prospectively collected. The safety, economic benefit, and psychological satisfaction of day surgery was analyzed. Results A total of 42 women with breast cancer were included in the retrospective study and 39 women with breast cancer were included in the prospective study. In both prospective and retrospective studies, the mean age of patients in both groups were <50 years. There were only statistical differences between the two groups in the aspects of hypertension (P=0.022), neoadjuvant chemotherapy (P=0.037) and postoperative pathological estrogen receptor (P=0.033) in the prospective study. In postoperative complications, there were no statistical differences in the surgical-related complications or anesthesia-related complications between the two groups in either the prospective study or the retrospective study (P>0.05). In terms of the overall cost, we found that the day surgery group was more economical than the ward surgery group in the prospective study (P=0.002). There were no statistical differences in postoperative psychosocical well-being, sexual well-being, satisfaction with breasts or chest condition between the two groups (P>0.05). Conclusion It is safe and reliable to carry out breast conserving surgery in day surgery center under strict management standards, which can save medical costs and will not cause great psychological burden to patients.