ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To analyze the current status of human papillomavirus(HPV) vaccination among women aged 9-45 years in Chaoyang District of Beijing, and to provide a basis for further promoting population vaccination.Methods The HPV vaccination(including HPV2, HPV4 and HPV9) data among women aged 9-45 in Chaoyang District of Beijing as of December 31, 2024 in Beijing's immunization planning information system were derived, and the estimated HPV vaccination rate in Beijing's female population was obtained by data analysis.Results By December 31, 2024, the estimated first dose vaccination rate of HPV vaccine among women aged 9-45 years in Chaoyang District of Beijing had been 50. 88%, and the estimated full dose vaccination rate was 48. 66%. The estimated coverage of the first dose and the full dose among girls aged9-15 years was 4. 62% and 2. 87%, respectively. The estimated full dose coverage rate was 62. 73% in subdistrict and 37. 33%in district.Conclusion The estimated HPV vaccination rate of 9-45-year-old women in Chaoyang District of Beijing is higher than that in other regions of China, but the estimated vaccination rate of adolescent women aged 9-15 is significantly lower than that of other age groups. It is recommended to improve the HPV vaccination rate through multiple joint efforts to achieve the action goal of accelerating the elimination of cervical cancer in China and the world as soon as possible.

OBJECTIVE To explore a model for constructing a platform for medical institution formulation and provide insights for promoting their development. METHODS By systematically reviewing the development status and challenges of medical institution preparations in China， and based on the theory of industry-university-research collaborative innovation， the organizational structure， collaborative processes， and safeguard mechanisms of the platform were designed. RESULTS & CONCLUSIONS Medical institution formulations in China mainly faced challenges such as weak research and development （R&D） capacity， uneven quality standards， and blocked transformation pathways. This study established a full-chain， whole- industry collaborative innovation network covering the government， medical institutions， universities/research institutes， pharmaceutical enterprises， and the market， forming a new “government-industry-university-research-application” five-in-one platform model for medical institution formulations. By establishing mechanisms such as multi-entity collaborative cooperation， full- chain intellectual property management， contribution-based benefit distribution， staged risk-sharing， and third-party evaluation， the model clarified the responsibilities and collaborative pathways of all parties. The new model highlights the whole-process transformation of clinical experience-based prescriptions， enabling precise alignment between clinical needs and technological R&D， as well as between preparation achievements and industrial transformation. While breaking down the barriers of traditional platform construction， it effectively achieves optimal resource allocation and complementary advantages， addresses problems emerging in the development of medical institution preparations， and provides reference value for the formulation of relevant systems.

Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.

Objective: To investigate whether membrane vesicles (MVs) of Streptococcus mutans （S.mutans） contain autoinducer-2 (AI-2) and to preliminarily explore the effects of these MVs on the growth and biofilm formation of S. mutans. Methods: MVs were isolated from the S. mutans UA159 strain using differential centrifugation. The isolated MVs were characterized by nanoparticle tracking analysis for particle size and concentration and observed by transmission electron microscopy. The presence of AI-2 was identified using the Vibrio harveyi BB170 bioluminescence assay: the BB170 diluent was supplemented with AB medium (control group), MV extract (MVs group), pre-ultrafiltration supernatant (Sup group), or post-ultrafiltration supernatant (Sup-af group). The effects of MVs on growth and biofilm formation were assessed using the S.mutans UA159 strain or a luxS deletion mutant as the control group, compared with experimental groups stimulated with gradient concentrations of MVs (MVs-2.0E+7, MVs-2.0E+8, and MVs-2.0E+9 groups). Growth curves, MTT assay, and colony-forming unit (CFU) counts were used to determine changes in growth capacity. Biofilm formation was evaluated using crystal violet staining, confocal laser scanning microscopy, and the anthrone method for polysaccharide quantification. Results: Enriched S. mutans MVs were successfully obtained, with an average particle size of approximately 94.19 nm and a concentration of 1.87E+11 particles/mL. The bioluminescence assay showed that the luminescence intensity of the Sup group was higher than that of the Sup-af group, and the MVs group exhibited higher intensity than the control group. Assessments via growth curves, MTT assay, and CFU counts indicated no significant differences in the growth capacity of the various S. mutans strains after treatment with different concentrations of MVs. Crystal violet staining quantification and confocal laser scanning microscopy observations revealed that high-concentration MV treatment (2.0E+9 particles/mL group) resulted in lower biofilm mass compared to the control. The anthrone method showed that the production of both water-soluble and water-insoluble polysaccharides was significantly lower in the high-concentration MV group than in the control. Conclusion S. mutans MVs contain the quorum sensing signal molecule AI-2. These MVs do not significantly affect the growth of S. mutans, but they can regulate biofilm formation and exhibit an inhibitory effect at high concentrations.

Objective: To evaluate the performance of 5T magnetic resonance imaging (MRI) in visualizing dental pulp and periodontal ligament (PDL) tissues in vivo in the young adult population, thereby providing a basis for the application of high-field MRI technology in clinical oral examinations. Methods: The study was approved by the Ethics Committee of the hospital. A total of 15 healthy volunteers (413 permanent teeth altogether) were recruited and underwent full-mouth 5T MRI scans. Among them, six volunteers (168 permanent teeth) also received both 3T MRI and cone-beam computed tomography (CBCT) scans. Two dental specialists independently evaluated the imaging quality of the dental pulp and PDL on the images using a 5-point Likert scale and recorded the number of detectable root canals for each tooth. Inter-rater agreement was assessed using weighted kappa statistics and intraclass correlation coefficient (ICC). Non-parametric tests were employed to compare differences in imaging performance among different tissue structures, tooth positions, and imaging modalities. Results: 5T MRI can achieve in vivo imaging for most dental pulp tissues and partial periodontal membrane structures. There was a high level of agreement between the two raters in their imaging scores for the dental pulp and PDL (dental pulp κ = 0.934, PDL κ = 0.737). The imaging scores for dental pulp were significantly higher than those for PDL (P < 0.001), and the scores for molar dental pulp were lower than those for premolars and anterior teeth. In the multimodal comparison involving six volunteers, the raters showed good consistency in scoring dental pulp and PDL imaging across 5T MRI, 3T MRI, and CBCT, as well as in root canal counts (5T MRI for dental pulp κ = 0.971, 3T MRI for dental pulp κ = 0.933, CBCT for dental pulp κ = 0.964; 5T MRI for PDL κ = 0.625, 3T MRI for PDL κ = 0.667, CBCT for PDL κ = 0.571; ICC for root canal counts all ≥ 0.990). The imaging scores for dental pulp and PDL using 5T MRI were significantly higher than those using 3T MRI (dental pulp: P < 0.001; PDL: P = 0.022), but there was no statistically significant difference in the detection rate of the number of root canals between the two (P > 0.05). Although the imaging scores for dental pulp and PDL as well as the detection rate of the number of root canals with 5T MRI were inferior to those with CBCT (dental pulp: P < 0.001; PDL: P = 0.02; number of root canals: P < 0.05), 5T MRI can truly achieve "direct imaging" of these two soft tissues. Conclusion 5T MRI enables effective in vivo direct imaging of dental pulp and PDL tissues in the young adult population, indicating its potential clinical application value in the diagnosis and treatment of pulp and periodontal diseases.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

Objective To develop an innovative recognition algorithm that aids physicians in the identification of pulmonary nodules. Methods Patients with pulmonary nodules who underwent thoracoscopic surgery at the Department of Thoracic Surgery, Affiliated Drum Tower Hospital of Nanjing University Medical School in December 2023, were enrolled in the study. Chest surface exploration data were collected at a rate of 60 frames per second and a resolution of 1 920×1 080. Frame images were saved at regular intervals for subsequent block processing. An algorithm database for lung nodule recognition was developed using the collected data. Results A total of 16 patients were enrolled, including 9 males and 7 females, with an average age of (54.9±14.9) years. In the optimized multi-topology convolutional network model, the test results demonstrated an accuracy rate of 94.39% for recognition tasks. Furthermore, the integration of micro-variation amplification technology into the convolutional network model enhanced the accuracy of lung nodule identification to 96.90%. A comprehensive evaluation of the performance of these two models yielded an overall recognition accuracy of 95.59%. Based on these findings, we conclude that the proposed network model is well-suited for the task of lung nodule recognition, with the convolutional network incorporating micro-variation amplification technology exhibiting superior accuracy. Conclusion Compared to traditional methods, our proposed technique significantly enhances the accuracy of lung nodule identification and localization, aiding surgeons in locating lung nodules during thoracoscopic surgery.

OBJECTIVE To systematically evaluate risk prediction models for chemotherapy-induced myelosuppression in breast cancer， and provide a scientific reference for clinical healthcare workers in selecting or developing effective predictive models. METHODS A systematic search was conducted for studies on predictive models of the risk of chemotherapy-induced myelosuppression in breast cancer across the CNKI， VIP， Wanfang， PubMed， Web of Science， Cochrane Library， Embase， and Scopus databases， with a time frame of the establishment of the database to May 7， 2024. Literature was independently screened by 2 investigators， data were extracted according to critical appraisal and data extraction for systematic reviews of predictive model studies， and the risk of bias evaluation tool for predictive model studies was used to analyze the risk of bias and applicability of the included studies. RESULTS There were totally 7 studies， comprising 12 models. Among them， 11 models indicated an area under the subject operating characteristic curve of 0.600-0.908； 2 models indicated calibration. The common predictor variables of the included models were age， pre-chemotherapy neutrophil count， pre-chemotherapy lymphocyte count， and pre-chemotherapy albumin. The overall risk of bias of the 7 studies was high， which was mainly attributed to the flaws in the study design， insufficient sample sizes， inappropriate treatment of variables， non-reporting of missing data， and the lack of indicators for the assessment of the models， but the applicability was good. CONCLUSIONS The predictive performance of risk predictive models for chemotherapy-induced myelosuppression in breast cancer remains to be further enhanced， and the overall risk of model bias is high. Future studies should follow the specifications of model development and reporting， then combine machine learning algorithms to develop risk predictive models with good predictive performance， high stability， and low risk of bias， so as to provide a decision-making basis for the clinic.