1.Wearable robots can better improve the balance and walking of stroke survivors
Lan ZHANG ; Jianhua HE ; Zhen YANG ; Shantao TANG ; Zhenping DING ; Longjun TAN
Chinese Journal of Physical Medicine and Rehabilitation 2024;46(6):529-533
Objective:To explore the clinical efficacy of a wearable robot for improving the balance and walking function of stroke survivors.Methods:Eighty stroke survivors were randomly divided into an observation group and a control group, each of 40. Both groups were given routine rehabilitation, but the observation group additionally received 20 minutes of training assisted by a wearable robot six days a week for 4 weeks. Before and after the experiment, both groups were evaluated using the Berg Balance Scale (BBS) and functional ambulation categories (FACs). Their movement distance and ellipse area were measured using a Prokin balance instrument, and their step length and pace on the affected side were recorded.Results:Significant improvement in the average BBS and FAC scores, exercise length, ellipse area, and step length and speed on the affected side was observed in both groups. On average, the experimental group′s results were significantly better than those of the control group.Conclusion:Supplementing conventional rehabilitation with wearable robot assistance can significantly improve the balance and walking function of stroke survivors.
2.Chinese thoracic surgery experts consensus on postoperative follow-up plans for esophageal squamous cell carcinoma
Longqi CHEN ; Xiaofei LI ; Jianhua FU ; Song ZHAO ; Yin LI ; Yousheng MAO ; Shuoyan LIU ; Zhentao YU ; Lijie TAN ; Hui LI ; Yongtao HAN ; Chun CHEN ; Mingqiang KANG ; Jian HU ; Zhigang LI ; Hecheng LI ; Renquan ZHANG ; Shidong XU ; Linyou ZHANG ; Kaican CAI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2022;29(02):141-149
Resection is one of the most important treatments for esophageal squamous cell carcinoma, and routine postoperative follow-up is an effective method for early detection and treatment of recurrent metastases, which can improve patients' quality of life and prognosis. This consensus aims to provide a reference for colleagues responsible for postoperative follow-up of esophageal squamous cell carcinoma patients in China, and further improve the standardization of the diagnosis and treatment of esophageal squamous cell carcinoma.
3.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
4.Enzyme-linked immunosorbent assays for quantification of MMMAE-conjugated ADCs and total antibodies in cynomolgus monkey sera
Pei MIN ; Liu TINGTING ; Ouyang LU ; Sun JIANHUA ; Deng XIAOJIE ; Sun XIAOMIN ; Wu WEI ; Huang PENG ; Chen YI-LI ; Tan XIAORONG ; Liu XIAOYUE ; Zhu PENG ; Liu YONGZHEN ; Wang DEHENG ; Wu JUNLIANG ; Wang QI ; Wang GUIFENG ; Gong LIKUN ; Qin QIUPING ; Wang CHUNHE
Journal of Pharmaceutical Analysis 2022;12(4):645-652
Antibody-drug conjugates(ADCs)are commonly heterogeneous and require extensive assessment of exposure-efficacy and exposure-safety relationships in preclinical and clinical studies.In this study,we report the generation of a monoclonal antibody against monomethyl auristatin E(MMAE)and the development,validation,and application of sensitive and high-throughput enzyme-linked immunosor-bent assays(ELISA)to measure the concentrations of MMAE-conjugated ADCs and total antibodies(tAb,antibodies in ADC plus unconjugated antibodies)in cynomolgus monkey sera.These assays were suc-cessfully applied to in vitro plasma stability and pharmacokinetic(PK)studies of SMADC001,an MMAE-conjugated ADC against trophoblast cell surface antigen 2(TROP-2).The plasma stability of SMADC001 was better than that of similar ADCs coupled with PEG4-Val-Cit,Lys(m-dPEG24)-Cit,and Val-Cit linkers.The developed ELISA methods for the calibration standards of ADC and tAb revealed a correlation be-tween serum concentrations and the OD450 values,with R2 at 1.000,and the dynamic range was 0.3-35.0 ng/mL and 0.2-22.0 ng/mL,respectively;the intra-and inter-assay accuracy bias%ranged from-12.2%to-5.2%,precision ranged from-12.4%to-1.4%,and the relative standard deviation(RSD)was less than 6.6%and 8.7%,respectively.The total error was less than 20.4%.The development and validation steps of these two assays met the acceptance criteria for all addressed validation parameters,which suggested that these can be applied to quantify MMAE-conjugated ADCs,as well as in PK studies.Furthermore,these assays can be easily adopted for development of other similar immunoassays.
5.Bronchial arteriography CT combined with bronchoscopy in diagnosis of Dieulafoy′s disease (a report of 5 cases)
Zicheng HUANG ; Chunmei TANG ; Shengli CHEN ; Yanbin ZHANG ; Dongliang ZHU ; Jinwen TAN ; Guodong CHEN ; Hui ZHANG ; Jianhua LU
Journal of Chinese Physician 2022;24(11):1697-1701
Objective:To investigate the diagnostic value of bronchial arteriography CT (BA-ACT) combined with bronchoscopy (BS) in bronchial Dieulafoy′s disease (BDD), and the role of bronchial artery embolization (BAE) in the treatment of BDD.Methods:Retrospective analysis was made on the clinical data of 5 patients suspected of being BDD treated by BS in Guangzhou First People′s Hospital or Guangzhou Thoracic Hospital from January 2008 to January 2018 due to hemoptysis. Bronchial arteriography (BAG) and BA-ACT were performed during the operation of interventional embolization. BAG rotary acquisition data were post-processed according to BS findings, and BA-ACT reconstruction images of the diseased bronchi and bronchial arteries were obtained. BS reexamination and clinical follow-up observation were carried out after embolization to analyze the effect of embolization.Results:There were one BDD lesion for the five patients respectively, and the BAG lacked characteristic manifestations. Bronchoscopy revealed BDD foci to present as papillary (case 1-case 3), nodular (case 4), or lirellate (case 5) subbronchial submucosal protrusion lesions. On the BA-ACT reconstruction plot, the BDD lesions of papillary, nodular and carination manifested correspondingly as a bronchial artery branches locally " pointed arch" shaped (cases 1-case 4) or " bead-like" (case 5) fold and protruding toward the bronchial lumen. The BDD lesions of the cases 1-case 4 retraction and disappearance after one BAE were observed by BS examination, and no hemoptysis recurrence during the follow-up period (54-91 months). The ridge like BDD lesion of the case 5 remained unchanged after BAE, and hemoptysis recurred at 71 months after the first BAE; the uncollapsed foci were supplied by two collateral vessels that confirmed by second BAG and BA-ACT, and no hemoptysis for 71 months followed up after second BAE.Conclusions:BA-ACT combined with BS enables a locative and qualitative diagnosis of BDD, and BAE is a very effective treatment method for BDD.
6.Exploration of an integrated competency development model for undergraduates training by participating the international Genetic Engineering Machine Competition.
Qiyao WANG ; Pengfei LI ; Shuhong GAO ; Youyuan LI ; Hui WU ; Gaoyi TAN ; Jianhua FAN ; Mian ZHOU ; Lixin ZHANG ; Yingping ZHUANG
Chinese Journal of Biotechnology 2021;37(4):1457-1463
Starting from participating the high-level professional competition, our school has built a talent training system with the spirit of "biomaker" and an innovative practical ability training system. Such system takes the interest of student as the starting point, and relies on the strong scientific research and teaching infrastructure. The programme gives full play to students' initiatives and enhances the scientific research literacy and comprehensive ability of undergraduates majoring in biotechnology. It is an effective exploration of the traditional university education model and meets the urgent demand for innovative talents training in the era of rapid development of life sciences.
Biological Science Disciplines
;
Biotechnology
;
Genetic Engineering
;
Humans
;
Students
;
Universities
7.The application of thoracoscopic segmentectomy in children and infants with congenital pulmonary diseases
Zheng TAN ; Jiangen YU ; Jianhua LI ; Liang LIANG ; Ting HUANG ; Yue GAO
Chinese Journal of Thoracic and Cardiovascular Surgery 2021;37(12):741-744
Objective:To evaluate the efficacy of anatomic thoracoscopic pulmonary segmentectomy in the treatment of congenital pulmonary diseases in children and infants.Methods:There were 38 cases, 21 males and 17 females, aged from 6 months to 10 years old and 2 months, mean(28.1±20.7) months, and weight 6.0-27.5 kg, mean(11.93±4.05) kg who were scheduled to undergo thoracoscopic segmental pneumonectomy from July 2019 to March 2020. Among the 38 cases, there were 27 cases of congenital pulmonary airway malformation and 11 cases of intralobar pulmonary sequestrations, including 1 case of intralobar pulmonary sequestrations with extralobar pulmonary sequestrations and 1 case of intralobar pulmonary sequestrations with bronchial cyst. 3D computed tomography bronchography and angiography(3D-CTBA) was performed before operation to identify the specific lung segment of the lesion. According to the results to plan the operation plan, determine the specific resection of the lung segment.Results:The operation was completed successfully in all groups. The operation time was(72.5±18.2)min, the bleeding volume was(17.3±2.9) ml, chest tube drainage time was(3.1±0.8) days, and the postoperative discharge time was(8.1±2.8) days. Postoperative complications included infection(1 case), atelectasis(1 case), hydropneumothorax(1 case) and pneumothorax(1 case). There was no conversion to thoracotomy and enlarged pulmonary lobectomy. There was no recurrence during the follow-up of 1-9 months.Conclusion:Lung-preserving segmentectomy is technically feasible and safe for congenital pulmonary diseases in children. The 3D-CTBA technique can be used to understand the specific pulmonary segments invaded by the lesions and the relationship between the corresponding pulmonary vessels and bronchi before operation, which is of positive significance for the resection of complex pulmonary segments and good preoperative surgical planning.
8.Noninvasive treatment of recurrent and acquired pectus excavatum with vacuum disk
Yue GAO ; Jianhua LI ; Jiangen YU ; Zhuo SHI ; Zheng TAN ; Liang LIANG ; Ting HUANG ; Xu HAN
Chinese Journal of Thoracic and Cardiovascular Surgery 2021;37(4):241-244
Objective:To evaluate the effect of vacuum disk(VD) for non-invasive treatment of recurrent and acquired pectus excavatum(PE).Methods:From June 2017 to June 2019, 29 patients recruited from our outpatient clinic were included in this retrospective study and followed-up every 3 month according to the schedule. The patients were distributed into three groups(group 1 treated ≤6 months; group 2 treated from 6 months to 12 months; group 3 treated >12 months). The device should be applied regularly for more than 2 hours daily. The deformity chest wall was scanned by three-dimensional(3D)scanner at clinic, and the 3D-depth(3D-DE) and 3D-Haller index(3D-HI) of PE were calculated through Geomagic software.Results:In this cohort, 29 patients were eligible, 18 symmetrical PE and 11 asymmetric PE. The application time ranged from 3 months to 15 months(average 7.6 months). 4 paitents was lifted to a normal level, 23 patients were differently improved. However, 2 paitents had no improvement. The average of the depth and 3D-HI of all patients were improved from 17.7 mm to 11.6 mm and 1.739 to 1.598, respectively. It’s no statistically significant difference for the elevation of 3D-DE and 3D-HI between symmetrical and asymmetric PE( t=-2.821, P=0.558; t=0.074, P=0.068). When comparing the improvement of 3D-DE or 3D-HI of PE to the patient's treatment time, a statistically significant difference was proved between the group 2 and group 1( t=-2.261, P=0.014; t=-0.436, P=0.043), but not between the group 3 and group 2( t=-1.240, P=0.139; t=0.622, P=0.568). The main side effects include moderate subcutaneous hematoma(84%), petechial bleeding(27%), thoracalgia(32%) and chest tightness(17%), no other side effect appear till now. Conclusion:VD for treatment of recurrent and acquired PE is convenient, safe and noninvasive, which can be an alternative treatment for recurrent and acquired PE, However, long term of efficacy evaluation is still needed.
9.Test and discussion on SPECT performance under the Chinese health industry standard WS523-2019
Hui LIU ; Zhan TAN ; Jie YAO ; Hezheng ZHAI ; Zhangfan CHEN ; Ling ZHANG ; Feng WANG ; Honglei LI ; Hongtao HE ; Wangyuan LI ; Shuai ZHANG ; Jianhua GENG
Chinese Journal of Radiological Medicine and Protection 2021;41(7):534-538
Objective:To discuss the problems existing in the implementation of the Chinese health industry standard WS 523-2019 by testing SPECT device.Methods:Under the WS 523-2019 standards, a total of 10 SPECT devices were tested with regard to their SPECT reconstructed spatial resolution (SRSR), system planar sensitivity (SPS), system spatial resolution (SSR), whole body system spatial resolution (WSSR), intrinsic uniformity (IU), intrinsic count rate performance (ICR), intrinsic spatial resolution (ISR) and intrinsic spatial linearity(ISL).Result:Under the requirements of WS 523-2019 standards for qualified limits, there are 3 devices with ISL unqualified and the rest of the performances qualified. The new standards basically can meet the clinical requirements and reflected the overall performance of SPECT.Conclusions:The distance between the radiation source and the surface of the detector has great influence on the spatial resolution.In the measurement of ISL, there must be a lead grid separately in the x and y directions. The lead grids with the parallel slits shall be positioned on the detector with the center slit centered on the detector. It is suggested to add rotation center in the new standards.
10.Four-stitch cholangiojejunostomy
Shuyou PENG ; Congyun HUANG ; Jianhua ZHU ; Liming WU ; Wenying LIU ; Yong TAN ; Zaixing OUYANG ; Hao SONG
Chinese Journal of Hepatobiliary Surgery 2021;27(7):517-519
Objective:To evaluate the clinical application efficacy of four-stitch cholangiojejunostomy.Methods:Of 38 patients who received four-needle biliary and enterointestinal anastomosis in the Department of Hepatobiliary Surgery, Yuebei People's Hospital Affiliated to Shantou University Medical College from November 2016 to April 2020 were included, and the diseases, surgical methods and postoperative complications of four-needle biliary and enterointestinal anastomosis were analyzed.Results:There were 26 males and 12 females with an average of 57.3(44-77) years. Among 38 patients, there were 12 hilar cholangiocarcinoma patients, 10 pancreatic head cancer, 9 duodenal papillary cancer, 4 intrahepatic and extrahepatic bile duct stones, 1 pancreatic cystic adenoma, 1 gastric cancer invading pancreatic head and 1 gallbladder carcinoma. The procedure included pancreatoduodenectomy in 20, radical resection of hilar cholangiocarcinoma in 12, hepatectomy with biliary-enteric anastomosis in 4, radical resection of gastric cancer combined with pancreaticoduodenectomy in 1, radical resection of gallbladder carcinoma in 1. One, two and three ductal openings were anastomosed in 27, 7 and 4 patients, respectively. 10 patients have bile duct diameter <6 mm. Postoperative anastomotic leakage occurred in 1, and all patients were received followed-up visit for 2 months to 4 years without anastomotic stenosis.Conclusion:Four-stitch cholangiojejunostomy is simple, safe, effective, and convenient for small biliary ductal surgeries.

Result Analysis
Print
Save
E-mail