Diabetic cataract, a prevalent ocular complication of diabetes mellitus, arises from a complex interplay of pathological mechanisms, with oxidative stress and glycation stress playing central roles. Autophagy, a critical cellular self-protection mechanism, sustains intracellular homeostasis by selectively degrading damaged organelles and misfolded proteins, thereby counteracting the detrimental effects of oxidative and glycation stress under hyperglycemic conditions. Emerging evidence indicates a synergistic interaction between glycation stress and oxidative stress, which may exacerbate autophagic dysfunction and accelerate the onset and progression of diabetic cataract. However, the precise molecular mechanisms underlying this relationship remain incompletely understood. This review systematically examines the regulatory role of autophagy inthe pathogenesis of diabetic cataract, with a particular focus on how autophagic impairment influences disease progression under the combined effects of glycation and oxidative stress. By elucidating these mechanisms, the paper aims to provide novel insights into molecular diagnostic approaches and targeted therapeutic strategies for diabetic cataract.

Forensic medicine has been designated as a first-level discipline,presenting new opportunities and challenges for the development of forensic medicine.Since the 1980s,the establishment of foren-sic medicine discipline and the cultivation of high-level forensic talents have become hot topics in the development of forensic medicine in China.Since the 13th Five-Year Plan,the forensic team of Shanxi Medical University has been aiming at the forefront,proposing the development goals of"Five First-class"and the discipline development path"Six Major Achievements".It has selected benchmark disci-plines,identified gaps in disciplinary development,unified thoughts,formulated completion timelines,concentrated superior resources,assigned tasks to individuals,and created an"Organized Fill-in-the-Blank Format"forensic medicine discipline construction model with the characteristics of the new era.The construction model of forensic medicine has achieved good results in the goals,discipline frame-work,scientific research,talent cultivation,discipline team and platform construction,forming a rela-tively complete discipline construction and management system,and accumulating valuable experience for the construction of first-level discipline and high-level talent cultivation of forensic medicine.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To investigate the characteristics and clinical effects of laparoscopic pneumovesical Cohen and laparoscopic Lich-Gregoir ureteral replantations for the treatment of primary obstructive megaloureter (POM) in children.Methods:A randomized controlled study was conducted.The clinical data of 51 children with unilateral POM admitted to the First Affiliated Hospital of Zhengzhou University from October 2018 to October 2023 were collected.Random number table method was used in the selection of surgical methods.They were divided into the laparoscopic pneumovesical Cohen ureteral replantation group (group A, 22 cases) and the laparoscopic Lich-Gregoir ureteral replantation group (group B, 29 cases) according to the surgical method.The anterior-posterior diameter(APD), maximum ureteral diameter and differential renal function parameters on the affected side were measured by color Doppler ultrasound of the urinary system, and compared between and within the two groups before and after surgery.The operation time, blood loss and postoperative intubation time were compared between the two groups.The incidence of postoperative complications such as reflux, bladder spasm, urinary retention and urinary tract infection was recorded.The independent and paired sample t-tests were used for statistical analysis. Results:The operation time and hematuria duration of group B [(125.7±14.2) min, (1.5±0.6) d] were significantly shorter than those of group A [(142.6±14.7) min, (2.8±0.7) d] (all P<0.05). The APD, maximum ureteral diameter, and differential renal function on the affected side of group A were (21.7±7.9) mm, (11.6±3.2) mm, and (28.2±4.9)% before surgery, and (10.3±4.5) mm, (6.0±2.0) mm and (43.8±4.4)% after surgery, respectively.The APD, maximum ureteral diameter, and differential renal function on the affected side of group B were (21.1±5.6) mm, (11.3±4.6) mm, and (30.2±5.5)% before surgery, and (10.2±4.5) mm, (6.6±2.0) mm, and (42.4±5.2)% after surgery, respectively.There was no statistically significant difference in the values of APD, maximum ureteral diameter, and differential renal function before and after surgery between the two groups of children (all P>0.05). However, there were statistically significant differences in the values of APD, maximum ureteral diameter, and differential renal function before and after surgery between the same group of children (all P<0.01). No significant difference was found in intraoperative blood loss, postoperative intubation time, and postoperative complications between the two groups (all P>0.05). Conclusions:Both surgical methods are effective in the treatment of POM in children.Laparoscopic Lich-Gregoir ureteral replantation has advantages of less operation time compared with laparoscopic pneumovesical Cohen ureteral replantation.

T-cell acute lymphoblastic leukemia (T-ALL) is a highly aggressive hematologic malignancy with a poor prognosis, despite advancements in treatment. Many patients struggle with relapse or refractory disease. Investigating the role of the super-enhancer (SE) regulated gene ubiquitin-specific protease 20 (USP20) in T-ALL could enhance targeted therapies and improve clinical outcomes. Analysis of histone H3 lysine 27 acetylation (H3K27ac) chromatin immunoprecipitation sequencing (ChIP-seq) data from six T-ALL cell lines and seven pediatric samples identified USP20 as an SE-regulated driver gene. Utilizing the Cancer Cell Line Encyclopedia (CCLE) and BloodSpot databases, it was found that USP20 is specifically highly expressed in T-ALL. Knocking down USP20 with short hairpin RNA (shRNA) increased apoptosis and inhibited proliferation in T-ALL cells. In vivo studies showed that USP20 knockdown reduced tumor growth and improved survival. The USP20 inhibitor GSK2643943A demonstrated similar anti-tumor effects. Mass spectrometry, RNA-Seq, and immunoprecipitation revealed that USP20 interacted with hypoxia-inducible factor 1 subunit alpha (HIF1A) and stabilized it by deubiquitination. Cleavage under targets and tagmentation (CUT&Tag) results indicated that USP20 co-localized with HIF1A, jointly modulating target genes in T-ALL. This study identifies USP20 as a therapeutic target in T-ALL and suggests GSK2643943A as a potential treatment strategy.

Background: Maturity-onset diabetes of the young (MODY) due to variants of hepatocyte nuclear factor 1-beta (HNF1β) (MODY5) has not been well studied in the Chinese population. This study aimed to estimate its prevalence and evaluate the application of a clinical screening method (Faguer score) in Chinese early-onset diabetes (EOD) patients. Methods: Among 679 EOD patients clinically diagnosed with type 2 diabetes mellitus (age at diagnosis ≤40 years), the exons of HNF1β were sequenced. Functional impact of rare variants was evaluated using a dual-luciferase reporter system. Faguer scores ≥8 prompted multiplex ligation-dependent probe amplification (MLPA) for large deletions. Pathogenicity of HNF1β variants was assessed following the American College of Medical Genetics and Genomics (ACMG) guidelines. Results: Two rare HNF1β missense mutations (E105K and G454R) were identified by sequencing in five patients, showing functional impact in vitro. Another patient was found to have a whole-gene deletion by MLPA in 22 patients with the Faguer score above 8. Following ACMG guidelines, six patients carrying pathogenic or likely pathogenic variant were diagnosed with MODY5. The estimated prevalence of MODY5 in Chinese EOD patients was approximately 0.9% or higher. Conclusion MODY5 is not uncommon in China. The Faguer score is helpful in deciding whether to perform MLPA analysis on patients with negative sequencing results.

Objective:To analyze the predictive role of WT1 expression levels pre-and early post-transplantation on relapse and overall survival(OS)in patients with acute myeloid leukemia(AML)undergoing allogeneic hematopoietic stem cell transplantation(allo-HSCT)during their first complete remission(CR1).Methods:A retrospective analysis was conducted on the clinical data of 107 adult AML patients who underwent allo-HSCT during their CR1 at our center between May 2012 and December 2021.The predictive role of bone marrow WT1 expression levels before transplantation and at 3 and 6 months post-transplantation on relapse and OS was explored in combination with relevant clinical factors.Results:The median follow-up time for the 107 patients was 70(range:11-117)months.Among the patients,15 cases died.Kaplan-Meier survial analysis showed that the 3-year overall survival(OS)rate was 85.0％.20 patients experienced relapse,with a median time to relapse of 8(range:0.5-44)months and a l-year cumulative relapse rate of 13.1％.The overall median value of WT1 before transplantation,3 months after transplantation,and 6 months after transplantation was 0.26％(range:0％-23.64％),with an upper quartile value of 0.74％.No statistically significant differences in WT1 expression levels were observed among the pre-transplantation,3-month post-transplantation,and 6-month post-transplantation time points(P=0.227).Univariate analysis showed that patients with WT1 levels＞0.74％at 3 months post-transplantation had a higher 1-year relapse rate(P=0.029)and lower 3-year OS rate(P＜0.001)compared to patients with WT1 levels ≤0.74％.Other significant factors affecting 1-year relapse included stem cell source(P=0.041)and chronic graft-versus-host disease(cGVHD)(P=0.013).For 3-year OS,additional influencing factors were genetic high risk(P=0.048)and stem cell source(P=0.016).Multivariate analysis revealed that WT1 level＞0.74％at 3 months post-transplantation had a trend to affect 1-year relapse rate(HR=3.309,95％CI:0.958-11.431,P=0.058),while the absence of cGVHD was an independent risk factor for 1-year relapse(HR=3.473,95％CI:0.749-16.100,P=0.037).Only WT1 level＞0.74％at 3 months post-transplantation was an independent risk factor for 3-year OS(HR=6.886,95％CI:2.402-19.738,P＜0.001).Conclusion:High WT1 expression level at 3 months post-transplantation in AML patients undergoing allo-HSCT during CR1 affects the 1-year relapse rate and 3-year OS,and is an independent risk factor affecting 3-year OS.These findings suggest that dynamic monitoring of WT1 expression levels has certain value in prognostic assessment of AML patients who received allo-HSCT during CR1.

This article introduces the experience of Academician SHI Xuemin in treatment of stroke combined with obstructive sleep apnea hypopnea syndrome. It is believed that this disease is the syndrome of "stroke of lung qi exhaustion". It is rooted at the deficiency of primary qi, and lung qi declining; and characterized by phlegm stagnation, qi reversion and mind blockage. This disease is manifested as somnolence-like symptoms, snoring-like breathing and sawing-like expectorating. The therapeutic regimen focuses on "governing qihai (sea of qi ), regulating the spirit and adjusting the orifice closure". The main acupoints include Neiguan (PC6), Shuigou (GV26) and Sanyinjiao (SP6) to regain the consciousness and open the orifices. Besides, Renying (ST9) is added to regulate the respiration, Baihui (GV20) and Sishencong (EX-HN1) to harmonize the spirit, and Fengchi (GB20), Wangu (GB12) and Yifeng (TE17) to open the orifice for the treatment of symptoms. It provides a new idea for the clinical diagnosis and treatment of stroke with accompanying symptoms.
Humans ; Sleep Apnea, Obstructive/complications* ; Acupuncture Therapy ; Stroke/physiopathology* ; Male ; Acupuncture Points ; Female ; Middle Aged ; Qi ; Aged ; Lung/physiopathology* ; Snoring/physiopathology* ; Adult ; Drugs, Chinese Herbal/administration & dosage*

Early-onset colorectal cancer (EOCRC) shows a different epidemiological trend compared to later-onset colorectal cancer, with its incidence rising in most regions and countries worldwide. However, the reasons behind this trend remain unclear. The etiology of EOCRC is complex and could involve both genetic and environmental factors. Apart from Lynch syndrome and Familial Adenomatous Polyposis, sporadic EOCRC exhibits a broad spectrum of pathogenic germline mutations, genetic polymorphisms, methylation changes, and chromosomal instability. Early-life exposures and environmental risk factors, including lifestyle and dietary risk factors, have been found to be associated with EOCRC risk. Meanwhile, specific chronic diseases, such as inflammatory bowel disease, diabetes, and metabolic syndrome, have been associated with EOCRC. Interactions between genetic and environmental risk factors in EOCRC have also been explored. Here we present findings from a narrative review of epidemiological studies on the assessment of early-life exposures, of EOCRC-specific environmental factors, and their interactions with susceptible loci. We also present results from EOCRC-specific genome-wide association studies that could be used to perform Mendelian randomization analyses to ascertain potential causal links between environmental factors and EOCRC.
Humans ; Colorectal Neoplasms/etiology* ; Risk Factors ; Genome-Wide Association Study ; Genetic Predisposition to Disease/genetics*