Aim To investigate the protective effects of methyl rosmarinate(MR)on myocardial injury in-duced by high-altitude hypoxia and explore its underly-ing mechanisms.Methods BALB/c mice were ran-domly divided into a control group,a model group,and low-,medium-,and high-dose MR groups(25,50,and 75 mg·kg-1,respectively).Except for the control group,all other groups were exposed to a hypobaric hypoxia chamber and administered MR via intraperitoneal injection daily for three days.After the experiment,myocardial tissues were collected for he-matoxylin and eosin(HE)staining to observe morpho-logical changes.Levels of malondialdehyde(MDA),glutathione(GSH),and superoxide dismutase(SOD)were measured to evaluate the anti-myocardial injury activity of MR.Network pharmacology was employed to predict drug-disease interaction targets,construct a protein-protein interaction(PPI)network,and identify core targets.Functional enrichment analysis was car-ried out using Gene Ontology(GO)and Kyoto Ency-clopedia of Genes and Genomes(KEGG)pathways.Molecular docking was used to verify the binding affini-ty of MR to core targets,and Western blot was conduc-ted to detect the expression of related proteins.Results MR significantly alleviated myocardial injury caused by high-altitude hypoxia.Network pharmacology analy-sis identified EGFR,Bcl-2,STAT3,MMP9,ESR1,and MTOR as key targets.Molecular docking con-firmed strong binding between MR and these core tar-gets.Western blot results demonstrated that MR im-proved myocardial injury by regulating the expression of STAT3,Bax,and Bcl-2 proteins.Conclusion MR may exert its protective effects on high-altitude hypoxi-a-induced myocardial injury through a multi-target mechanism.

Objective To assess renal oxygen metabolism and iron deposition in type 2 diabetes mellitus(T2DM)patients using a combination of blood oxygen level-dependent(BOLD)and mDixon Quant techniques.Methods Clinical data of 58 T2DM patients from Tianjin First Central Hospital(September 2022-December 2023)were prospectively collected.According to urinary albumin-to-creation ratio(ACR),patients were divided into the normal albuminuria(NAU,ACR＜30 mg/g,n=35)group and the microalbuminuria(MAU,30 mg/g≤ACR＜300 mg/g,n=23)group.Thirty-three healthy volunteers were included as the control group during the same period.All participants underwent renal BOLD and mDixon Quant MRI to obtain cortical and medullary apparent relaxation rate(R2*)values.The differences of general data and image parameter values were compared between groups.Receiver operating characteristic(ROC)curves were used to analyze the diagnostic efficacy of relevant parameters for early renal function changes.Results There were significant differences in body weight,estimated glomerular filtration rate(eGFR)and ACR between the control group,the NAU group and the MAU group(P＜0.01).The R2* value in renal cortex was lower than that in renal medulla(P＜0.01)in the same group.Apart from R2* value of BOLD renal cortex,which showed no significant difference between the three groups(P＜0.05),and the differences in the other parameters were statistically significant(P<0.05).When distinguishing between the control group and the NAU group,the NAU group and the MAU group,as well as between the control group and the early-stage T2DM(NAU+MAU)group,the combined two-sequence approach demonstrated higher area under the curve(AUCs)than any single sequence alone,with AUC value of 0.892(95%CI:0.809-0.975),0.785(95%CI:0.666-0.904)and 0.841(95%CI:0.756-0.926),respectively.Conclusion The combination of BOLD imaging with mDixon Quant enables noninvasive and quantitative assessment of alterations in renal oxygen metabolism and iron content in early-stage T2DM patients.The diagnostic performance of this combined approach surpasses that of individual methods.

Objective:To evaluate the anti-reflux effect of digestive tract reconstruction using esophageal-tubular gastric asymmetric anastomosis after radical resection of esophageal and esophagogastric junction cancer.Methods:The main steps were as follows:(1)oblique incision of the lower esophagus;(2)curved incision of the tubular anterior gastric wall;(3)the lower end of the esophagus was anastomosed to the tubular gastric incision with a 90-degree torsion; (4)The anterior wall of the anastomosis was reinforced with a transverse-inverted suture,the posterior wall with a folded suture,and the corners of the gastric stump were buried with sutures.The anastomosis operation time,postoperative complications and postoperative hospital stay were recorded;the reconstructed structure and anti-reflux effect of the anastomosis were observed by digestive tract radiography,gastroscopy and follow-up investigation.Results:The Department of Gastrointestinal and Thoracic Surgery of Huaian First People's Hospital, affiliated to Nanjing Medical University, treated 5 patients of esophagogastric junction cancer and 20 esophageal cancer cases between August 2022 and November 2024, including 19 men and 6 women, with a mean age of (66.7±7.4) years. The mean anastomosis time was (35.4±5.9) minutes, the intraoperative blood loss was (117.6±33.4) ml and the mean postoperative hospital stay was(16.6±5.2) days, with no complications such as anastomotic leakage and bleeding. Postoperative digestive tract radiography (Trendelenburg position)showed that all the patients had no contrast reflux,gastroscopy showed no signs of reflux esophagitis and bile reflux gastritis, the anastomosis showed an inverted whiskers valve-like structure. The median follow-up time was (16.8±6.3) months, and all patients had no reflux symptoms such as acid reflux and belching,and no acid suppressive medication was needed.Conclusion:The esophageal-tubular gastric asymmetric anastomosis is a safe and effective antireflux reconstruction technique.

Aim To explore the effects of high glucose on KIAA0753 and CCSAP and the relationship between KIAA0753 and CCSAP and osteogenic differentiation and calcium signaling pathway under high glucose con-ditions.Methods Mouse embryonic osteoblast pre-cursor cells(MC3T3-E1)were induced by osteoblast medium with glucose concentrations of 5.5 and 25 mmol·L-1,and the protein expressions of KIAA0753 and CCSAP were detected by Western blot.The over-expressed plasmid was transfected into human embry-onic kidney cells(HEK-293T),and the interaction between KIAA0753 and CCSAP was detected by co-im-munoprecipitation.MC3T3-E1 cells were treated in the osteogenic medium with different glucose concentrations and induction times.Alkaline phosphatase(ALP)ac-tivity was detected with a kit.The expression of KI-AA0753,CCSAP,osteopontin,osteocalcin,and other proteins were assessed using Western blot.and then 5.5,25 mmol·L-1,and 25 mmol·L-1+OE-CCSAP three groups of MC3T3-E1 cells were set.The expression of KIAA0753,OCN,OPN protein,and ALP activity were detected successively.The diabetic mouse model dataset in Gene Expression Omnibus was used to screen differential genes for bioinformatics a-nalysis.MC3T3-E1 cells were set up in three groups,5.5,25 mmol·L-1,and 25 mmol·L-1+OE-KI-AA0753,respectively.The calcium/calmodulin-de-pendent protein kinase Ⅱ beta(CAMK2B)and phos-pholamban(PLN)were detected by Western blot.Re-sults Compared with the 5.5 mmol·L-1 group,25 mmol·L-1 inhibited the expression of KIAA0753 and CCSAP proteins in osteoblasts,and there was an inter-action between KIAA0753 and CCSAP.At the same time,25 mmol·L-1 also inhibited the expression of ALP,OPN,and OCN proteins in osteoblasts.Overex-pression of CCSAP at 25 mmol·L-1 up-regulated the expression of KIAA0753,OCN,OPN,and ALP.The differential genes of the diabetic mouse model were mainly concentrated in the aspects of"signal receptor and signal regulation".25 mmol·L-1 glucose inhibi-ted the expression of CAMK2B and PLN proteins in os-teoblasts,and overexpression of KIAA0753 at 25 mmol·L-1 upregulated the expression of CAMK2B and PLN proteins.Conclusions High glucose inhibits the expression of KIAA0753 and CCSAP protein,inhibits the osteogenic differentiation and calcium signaling in mouse embryonic osteoblast precursor cells,overex-pression of CCSAP saves the inhibitory effect of high glucose on osteogenic differentiation,and overexpres-sion of KIAA0753 reverses the inhibitory effect of high glucose on calcium signaling pathway.

Objective To assess renal oxygen metabolism and iron deposition in type 2 diabetes mellitus(T2DM)patients using a combination of blood oxygen level-dependent(BOLD)and mDixon Quant techniques.Methods Clinical data of 58 T2DM patients from Tianjin First Central Hospital(September 2022-December 2023)were prospectively collected.According to urinary albumin-to-creation ratio(ACR),patients were divided into the normal albuminuria(NAU,ACR＜30 mg/g,n=35)group and the microalbuminuria(MAU,30 mg/g≤ACR＜300 mg/g,n=23)group.Thirty-three healthy volunteers were included as the control group during the same period.All participants underwent renal BOLD and mDixon Quant MRI to obtain cortical and medullary apparent relaxation rate(R2*)values.The differences of general data and image parameter values were compared between groups.Receiver operating characteristic(ROC)curves were used to analyze the diagnostic efficacy of relevant parameters for early renal function changes.Results There were significant differences in body weight,estimated glomerular filtration rate(eGFR)and ACR between the control group,the NAU group and the MAU group(P＜0.01).The R2* value in renal cortex was lower than that in renal medulla(P＜0.01)in the same group.Apart from R2* value of BOLD renal cortex,which showed no significant difference between the three groups(P＜0.05),and the differences in the other parameters were statistically significant(P<0.05).When distinguishing between the control group and the NAU group,the NAU group and the MAU group,as well as between the control group and the early-stage T2DM(NAU+MAU)group,the combined two-sequence approach demonstrated higher area under the curve(AUCs)than any single sequence alone,with AUC value of 0.892(95%CI:0.809-0.975),0.785(95%CI:0.666-0.904)and 0.841(95%CI:0.756-0.926),respectively.Conclusion The combination of BOLD imaging with mDixon Quant enables noninvasive and quantitative assessment of alterations in renal oxygen metabolism and iron content in early-stage T2DM patients.The diagnostic performance of this combined approach surpasses that of individual methods.

Objective:To evaluate the anti-reflux effect of digestive tract reconstruction using esophageal-tubular gastric asymmetric anastomosis after radical resection of esophageal and esophagogastric junction cancer.Methods:The main steps were as follows:(1)oblique incision of the lower esophagus;(2)curved incision of the tubular anterior gastric wall;(3)the lower end of the esophagus was anastomosed to the tubular gastric incision with a 90-degree torsion; (4)The anterior wall of the anastomosis was reinforced with a transverse-inverted suture,the posterior wall with a folded suture,and the corners of the gastric stump were buried with sutures.The anastomosis operation time,postoperative complications and postoperative hospital stay were recorded;the reconstructed structure and anti-reflux effect of the anastomosis were observed by digestive tract radiography,gastroscopy and follow-up investigation.Results:The Department of Gastrointestinal and Thoracic Surgery of Huaian First People's Hospital, affiliated to Nanjing Medical University, treated 5 patients of esophagogastric junction cancer and 20 esophageal cancer cases between August 2022 and November 2024, including 19 men and 6 women, with a mean age of (66.7±7.4) years. The mean anastomosis time was (35.4±5.9) minutes, the intraoperative blood loss was (117.6±33.4) ml and the mean postoperative hospital stay was(16.6±5.2) days, with no complications such as anastomotic leakage and bleeding. Postoperative digestive tract radiography (Trendelenburg position)showed that all the patients had no contrast reflux,gastroscopy showed no signs of reflux esophagitis and bile reflux gastritis, the anastomosis showed an inverted whiskers valve-like structure. The median follow-up time was (16.8±6.3) months, and all patients had no reflux symptoms such as acid reflux and belching,and no acid suppressive medication was needed.Conclusion:The esophageal-tubular gastric asymmetric anastomosis is a safe and effective antireflux reconstruction technique.

Objective:To analyze the predictive role of WT1 expression levels pre-and early post-transplantation on relapse and overall survival(OS)in patients with acute myeloid leukemia(AML)undergoing allogeneic hematopoietic stem cell transplantation(allo-HSCT)during their first complete remission(CR1).Methods:A retrospective analysis was conducted on the clinical data of 107 adult AML patients who underwent allo-HSCT during their CR1 at our center between May 2012 and December 2021.The predictive role of bone marrow WT1 expression levels before transplantation and at 3 and 6 months post-transplantation on relapse and OS was explored in combination with relevant clinical factors.Results:The median follow-up time for the 107 patients was 70(range:11-117)months.Among the patients,15 cases died.Kaplan-Meier survial analysis showed that the 3-year overall survival(OS)rate was 85.0％.20 patients experienced relapse,with a median time to relapse of 8(range:0.5-44)months and a l-year cumulative relapse rate of 13.1％.The overall median value of WT1 before transplantation,3 months after transplantation,and 6 months after transplantation was 0.26％(range:0％-23.64％),with an upper quartile value of 0.74％.No statistically significant differences in WT1 expression levels were observed among the pre-transplantation,3-month post-transplantation,and 6-month post-transplantation time points(P=0.227).Univariate analysis showed that patients with WT1 levels＞0.74％at 3 months post-transplantation had a higher 1-year relapse rate(P=0.029)and lower 3-year OS rate(P＜0.001)compared to patients with WT1 levels ≤0.74％.Other significant factors affecting 1-year relapse included stem cell source(P=0.041)and chronic graft-versus-host disease(cGVHD)(P=0.013).For 3-year OS,additional influencing factors were genetic high risk(P=0.048)and stem cell source(P=0.016).Multivariate analysis revealed that WT1 level＞0.74％at 3 months post-transplantation had a trend to affect 1-year relapse rate(HR=3.309,95％CI:0.958-11.431,P=0.058),while the absence of cGVHD was an independent risk factor for 1-year relapse(HR=3.473,95％CI:0.749-16.100,P=0.037).Only WT1 level＞0.74％at 3 months post-transplantation was an independent risk factor for 3-year OS(HR=6.886,95％CI:2.402-19.738,P＜0.001).Conclusion:High WT1 expression level at 3 months post-transplantation in AML patients undergoing allo-HSCT during CR1 affects the 1-year relapse rate and 3-year OS,and is an independent risk factor affecting 3-year OS.These findings suggest that dynamic monitoring of WT1 expression levels has certain value in prognostic assessment of AML patients who received allo-HSCT during CR1.

Objective To clone the glycosyltransferase gene UGT708Z1 in Anemarrhena asphodeloides and perform its bioinformatics analysis,prokaryotic expression analysis and functional characterization.Methods A candidate glycosyltransferase gene UGT708Z1 was mined and screened out from Anemarrhena asphodeloides based on the transcriptome data.According to its full-length open reading frame,the specific primers with homologous arms were designed.Subsequently,the UGT708Z1 gene was cloned by PCR.The prokaryotic expression recombinant vector pET-32a(+)-UGT708Z1 was constructed through homologous recombination technology,and the soluble target protein was obtained by prokaryotic expression and purified protein technology.Finally,the function of UGT708Z1 was identified through enzymatic reaction in vitro.Results Sequence analysis showed that the open reading frame of UGT708Z1 was 1377 bp,encoding 458 amino acids.The result of prokaryotic expression showed that UGT708Z1 successfully expressed the soluble target protein,and the purified recombinant protein was 70.86 kDa.The results of enzymatic reaction in vitro showed that UGT708Z1 had flavonoid 7-OH glycosylation activity and could catalyze icaritin to produce icariside I.In addition,UGT708Z1 also possessed the activities of catalyzing the 7-O-glycosylation of quercetin and apigenin.Conclusion In this study,a flavonol glycosyltransferase UGT708Z1 was successfully cloned and identified from Anemarrhena asphodeloides,which would lay a foundation for further analysis of flavonol glycosides biosynthesis.

Aim To explore the effects of high glucose on KIAA0753 and CCSAP and the relationship between KIAA0753 and CCSAP and osteogenic differentiation and calcium signaling pathway under high glucose con-ditions.Methods Mouse embryonic osteoblast pre-cursor cells(MC3T3-E1)were induced by osteoblast medium with glucose concentrations of 5.5 and 25 mmol·L-1,and the protein expressions of KIAA0753 and CCSAP were detected by Western blot.The over-expressed plasmid was transfected into human embry-onic kidney cells(HEK-293T),and the interaction between KIAA0753 and CCSAP was detected by co-im-munoprecipitation.MC3T3-E1 cells were treated in the osteogenic medium with different glucose concentrations and induction times.Alkaline phosphatase(ALP)ac-tivity was detected with a kit.The expression of KI-AA0753,CCSAP,osteopontin,osteocalcin,and other proteins were assessed using Western blot.and then 5.5,25 mmol·L-1,and 25 mmol·L-1+OE-CCSAP three groups of MC3T3-E1 cells were set.The expression of KIAA0753,OCN,OPN protein,and ALP activity were detected successively.The diabetic mouse model dataset in Gene Expression Omnibus was used to screen differential genes for bioinformatics a-nalysis.MC3T3-E1 cells were set up in three groups,5.5,25 mmol·L-1,and 25 mmol·L-1+OE-KI-AA0753,respectively.The calcium/calmodulin-de-pendent protein kinase Ⅱ beta(CAMK2B)and phos-pholamban(PLN)were detected by Western blot.Re-sults Compared with the 5.5 mmol·L-1 group,25 mmol·L-1 inhibited the expression of KIAA0753 and CCSAP proteins in osteoblasts,and there was an inter-action between KIAA0753 and CCSAP.At the same time,25 mmol·L-1 also inhibited the expression of ALP,OPN,and OCN proteins in osteoblasts.Overex-pression of CCSAP at 25 mmol·L-1 up-regulated the expression of KIAA0753,OCN,OPN,and ALP.The differential genes of the diabetic mouse model were mainly concentrated in the aspects of"signal receptor and signal regulation".25 mmol·L-1 glucose inhibi-ted the expression of CAMK2B and PLN proteins in os-teoblasts,and overexpression of KIAA0753 at 25 mmol·L-1 upregulated the expression of CAMK2B and PLN proteins.Conclusions High glucose inhibits the expression of KIAA0753 and CCSAP protein,inhibits the osteogenic differentiation and calcium signaling in mouse embryonic osteoblast precursor cells,overex-pression of CCSAP saves the inhibitory effect of high glucose on osteogenic differentiation,and overexpres-sion of KIAA0753 reverses the inhibitory effect of high glucose on calcium signaling pathway.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.